Functional molecular marker for rapidly identifying largemouth bass anti-rhabdovirus individuals and application of functional molecular marker

Abstract

The invention relates to the technical field of molecular marker breeding, in particular to a functional molecular marker for rapidly identifying largemouth bass rhabdovirus-resistant individuals and application of the functional molecular marker. The invention develops a functional molecular marker, the molecular marker with significant difference is identified by re-sequencing genomes of disease-resistant and susceptible individuals, specific primers are designed, and the disease-resistant and susceptible individuals are successfully distinguished by combining PCR (Polymerase Chain Reaction) amplification and agarose gel electrophoresis technologies. In the experiment process, a rhabdovirus challenge experiment is carried out on largemouth micropterus salmoides offspring seeds in an artificial infection mode, and a susceptible group (SL) and a disease-resistant group (RL) are defined. RNA (Ribonucleic Acid) extraction and qPCR (Quantitative Polymerase Chain Reaction) are adopted for detecting the difference of virus loads, and PCR amplification and gene sequencing analysis are carried out on disease-resistant and susceptible individuals, so that the accuracy of functional markers is verified. Disease-resistant and susceptible amplification products are 1273bp and 1134bp single bands respectively, show significant gene difference, and provide technical support for rapid screening of disease-resistant individuals.

Description

Technical Field

[0001] The invention relates to the technical field of molecular marker breeding, and in particular to a functional molecular marker for rapidly identifying largemouth bass resistant to rhabdovirus and an application thereof. Background Art

[0002] Largemouth bass ( Micropterus salmoides ), also known as California bass, has been introduced into my country since 1980. It has rapidly become an important freshwater economic aquaculture species in my country due to its strong adaptability, fast growth rate, short breeding cycle, delicious meat and no intramuscular spines. Largemouth black bass is also known as the "fifth major fish". With the upgrading of the industry and structural adjustment, the scale of largemouth black bass breeding has expanded year by year, and the problems in industrial development have become increasingly serious. At present, there are only "Youyu No. 1" and "Youyu No. 3" in China. The distribution of high-quality seedlings is uneven, mainly concentrated in the Pearl River Delta region, and the existing varieties cannot meet market demand. Secondly, the germplasm is seriously degraded and diseases are frequent. In recent years, the self-breeding of seedlings by aquaculture operators has led to serious inbreeding, smaller individual sizes, slower growth rates, and frequent diseases, causing great economic losses (the mortality rate of rhabdovirus can reach more than 50%). However, with the continuous expansion of the scale of breeding, the germplasm degradation and disease problems of largemouth black bass are becoming increasingly serious, especially those caused by rhabdovirus ( Micropterus salmoides Viral diseases caused by rhabdovirus (MSRV) have become one of the main factors restricting the development of the industry.

[0003] MSRV is a highly pathogenic pathogen that is particularly deadly to fry (2-5 cm in total length). After infection, it can cause the fish to turn black, become lethargic, swim abnormally, and have a swollen abdomen, ultimately leading to a mortality rate of over 90%. The spread of MSRV is highly contagious and is particularly prevalent when water temperature changes suddenly (such as in April-May and October-November). There is currently no effective drug or vaccine for the virus, and prevention and control mainly rely on antibiotics and management of the aquaculture environment. However, the abuse of antibiotics may lead to increased bacterial resistance and have a negative impact on the ecological environment of the water body. In aquaculture, disease-resistant breeding has become an important strategy to improve aquaculture efficiency and reduce losses. Traditional phenotypic selection methods rely on long-term observation and breeding experiments, which are not only greatly affected by environmental factors, but also have low efficiency. Molecular marker-assisted selection (MAS) provides technical support for rapid and efficient disease-resistant breeding through the precise screening of disease-resistant gene loci.

[0004] In recent years, domestic and foreign studies have used SNP technology to screen disease resistance markers for a variety of fish. For example, the Chinese invention patent application (CN118910289A, Publication No.: 2024-10-09) filed by the applicant also discloses a molecular marker primer for rapid identification of largemouth bass resistant to high temperatures. The molecular marker consists of a forward primer and a reverse primer. The forward primer P1-F sequence is CTACACACCAGTAAAGAGGCAGG, and the reverse primer P1-R sequence is CTTCTGTATCCATTGGCTTCTGC. The use of molecular marker primers for PCR amplification can accurately distinguish between largemouth bass resistant to high temperatures and those not resistant to high temperatures. This method is faster, more accurate, and less costly. It can quickly identify and screen largemouth bass with high temperature resistance at an early stage, improve breeding efficiency, and accelerate the breeding process of largemouth bass resistant to high temperatures.

[0005] In addition, Chinese invention patent applications (publication numbers: CN117965755A, CN118127178A, CN117947179A) have developed efficient and stable molecular markers around SNP (single nucleotide polymorphism) sites associated with MSRV resistance, and established a method for rapid screening of disease-resistant individuals. Through PCR amplification and high-resolution melting curve (HRM) typing technology, the disease-resistant genotype of largemouth bass can be accurately identified, providing an important technical means for achieving disease-resistant breeding and improving the quality of largemouth bass varieties.

[0006] Although significant progress has been made in molecular marker-assisted breeding for disease resistance in largemouth bass, SNP markers have low polymorphism, complex detection, high cost, and limited scope of application. InDel (insertion / deletion) markers usually have obvious length differences due to the insertion or deletion of bases, and are suitable for MAS breeding. They have certain advantages in terms of ease of operation, cost, and polymorphism, especially under conventional laboratory conditions, and are easier to operate and conduct rapid detection. In response to the lack of InDel molecular markers for largemouth bass and the demand for disease resistance breeding, the present invention has developed a comprehensive molecular marker identification and screening system to provide a scientific basis and practical tools for achieving green and healthy breeding of largemouth bass. Summary of the invention

[0007] In order to solve the above technical problems, the present invention has developed a functional molecular marker for rapid screening of disease-resistant individuals. Furthermore, by resequencing the genomes of disease-resistant and susceptible individuals, molecular markers with significant differences were identified, and specific primers were designed. PCR amplification and agarose gel electrophoresis technology were combined to successfully distinguish disease-resistant and susceptible individuals. During the experiment, largemouth black bass seedlings were subjected to rhabdovirus challenge experiments by artificial infection to identify susceptible groups (SL) and disease-resistant groups (RL). RNA extraction and qPCR were used to detect the difference in viral load, and PCR amplification and gene sequencing analysis were performed on disease-resistant and susceptible individuals to verify the accuracy of the functional markers. The amplified products of the disease-resistant and susceptible types were single bands of 1273bp and 1134bp, respectively, showing significant genetic differences, which provided technical support for the rapid screening of disease-resistant individuals.

[0008] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions: A functional molecular marker for rapidly identifying largemouth bass resistant to rhabdovirus, the functional molecular marker comprising a susceptible type and a resistant type, the nucleotide sequence of the susceptible type molecular marker being shown in SEQ ID NO:1, and the nucleotide sequence of the resistant type molecular marker being shown in SEQ ID NO:2.

[0009] Furthermore, the present invention also provides primers for identifying the functional molecular markers.

[0010] Preferably, the primer consists of a forward primer and a reverse primer, the sequence of the forward primer D1-F is GCAGATCCTCAACATGCTGCTG, and the sequence of the reverse primer D1-R is CAGGACAGTCAAGGACAGTGAG.

[0011] Furthermore, the present invention also provides a kit comprising the primers.

[0012] Furthermore, the present invention also provides the use of the functional molecular marker, the primer or the kit in the rapid identification of largemouth bass resistant to rhabdovirus.

[0013] Furthermore, the present invention also provides the use of the functional molecular marker, the primer or the kit in the breeding of largemouth bass resistant to rhabdovirus.

[0014] Furthermore, the present invention also provides a method for rapidly identifying individuals of largemouth bass that are resistant to rhabdovirus, the method comprising the following steps: 1) Extraction of DNA from largemouth bass; 2) Using the molecular marker primers to perform PCR amplification on largemouth bass DNA, after the PCR amplification is completed, agarose gel electrophoresis is used for detection, and the individuals with the nucleotide sequence shown in SEQ ID NO: 1 in the amplification product are susceptible individuals, and the individuals with the nucleotide sequence shown in SEQ ID NO: 2 in the amplification product are resistant individuals.

[0015] Preferably, the PCR reaction system is: 2×Taq PCR mix 10 μL; Depc H2O 8 μL; DNA template 1 μL; forward primer and reverse primer: 0.5 μL / 0.5 μL.

[0016] Preferably, the PCR reaction program is: 95°C - 5 min; 94°C -30 s; 72°C - 90 s; 35 cycles; 72°C extension for 8 min, and then storage at 4°C.

[0017] Furthermore, the present invention also provides application of the method in breeding of largemouth bass resistant to rhabdovirus.

[0018] The present invention adopts the above-mentioned technical scheme to provide a functional molecular marker for resistance to rhabdovirus for largemouth bass and its application method, which overcomes the limitations of traditional disease-resistant breeding methods such as long breeding cycle, low efficiency and susceptibility to interference from environmental factors, and significantly improves the efficiency and accuracy of disease-resistant population selection.

[0019] The technical effects of the present invention are embodied in the following aspects: 1. Rapid and accurate screening of disease-resistant individuals The developed functional molecular markers (D1-F / D1-R primers) combined with PCR amplification and agarose gel electrophoresis technology can effectively distinguish the disease-resistant (1273bp) and susceptible (1134bp) individuals of largemouth bass. Compared with traditional phenotypic selection, the present invention can significantly reduce breeding time, avoid screening errors caused by environmental factors, and ensure the accuracy of screening.

[0020] 2. Improve the efficiency of disease-resistant population selection The present invention uses molecular marker-assisted breeding (MAS) as the core technology, and provides an efficient and stable screening tool for the complex traits of rhabdovirus infection, which significantly accelerates the construction of disease-resistant populations of largemouth black bass, shortens the breeding cycle, and meets the market's urgent demand for high-quality seedlings.

[0021] 3. Optimize the use of breeding resources The disease-resistant individuals screened by the present invention can be used as parents for disease-resistant breeding of largemouth bass, thus avoiding the problem of germplasm degeneration caused by inbreeding, further improving the utilization rate of breeding resources, and laying a foundation for establishing a population with genetic stability and strong disease resistance.

[0022] 4. Improve the economic benefits of breeding The application of the present invention can effectively reduce the mortality rate and breeding losses caused by rhabdovirus infection, reduce the use of antibiotics from the source, reduce breeding costs, and at the same time provide technical guarantees for green and healthy breeding, with significant economic and ecological benefits.

[0023] In summary, the present invention takes molecular markers as the core and realizes the rapid construction of disease-resistant populations through accurate and efficient screening of disease-resistant individuals, providing reliable technical guarantee for the genetic improvement and industrial upgrading of largemouth black bass, and has important application value and promotion prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Screening of molecular markers for largemouth bass resistance to rhabdovirus (resistant type - 1273bp, susceptible type - 1134bp).

[0025] Figure 2 This is a comparative analysis of gene sequencing for disease-resistant and susceptible types of largemouth bass. DETAILED DESCRIPTION

[0026] The following is a clear and complete description of the technical solutions in the embodiments of the present invention in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] 1. Experimental Methods 1. Largemouth bass rhabdovirus challenge experiment In mid-April, 600 largemouth bass seedlings with a total length of 2-4 cm were collected and kept in the laboratory for one week before the rhabdovirus challenge experiment. 300 of them were randomly selected as the experimental group and the remaining 300 as the control group. Feeding was stopped 2 days before the experiment. The artificial infection method of largemouth bass was virus immersion. Before the experiment, 300 experimental fish were placed in a 100L plastic culture barrel and 1×10 5 The challenge experiment was carried out with MSRV at a concentration of cope number / mL. The experimental water temperature was 25℃, the dissolved oxygen was >5mg / L, and the challenge time was 4h. After the challenge, the experimental fish were placed in a new breeding barrel with circulation for normal feeding, and a small amount of feed was fed every 2 days. The control group also adopted the same breeding method.

[0028] During the 1-3 days of experimental fish culture, the diseased fish with obvious spinning, black body color, and bleeding gills and tails were collected as the susceptible group (SL), and the individuals that survived 7 days after the infection were collected as the disease-resistant group (RL). During the infection period, the liver tissues of the SL individuals were collected and quickly stored in liquid nitrogen, and then stored in a -80℃ refrigerator for RNA extraction, and the tail fins were collected and placed in 95% alcohol and stored at -20℃ for DNA extraction. The livers of the RL were collected after the experiment and stored in the same way.

[0029] 2. Detection of viral load of rhabdovirus challenge in largemouth bass Trizol was used to extract RNA from liver tissues of SL and RL, and the RNA quality was tested by spectrophotometer and agarose gel electrophoresis. After the extracted RNA was found to be of qualified quality, it was reversed using a cDNA reverse kit, and then the viral load was detected using qPCR fluorescence quantification.

[0030] 3. Resequencing of largemouth bass anti-rhabdovirus individuals Ten tail fins of susceptible SL and resistant AL with high virus load were selected and sent to Shanghai Meiji Biotech Co., Ltd. for genome resequencing analysis. After analyzing the susceptible and resistant types, a specific primer D1 was developed, which can accurately distinguish the resistant and susceptible types of largemouth bass, which will be beneficial to the screening of largemouth bass resistant to rhabdovirus and the construction of populations.

[0031] 4. Screening of molecular markers for resistance to rhabdovirus in largemouth bass 4.1 PCR amplification and gel electrophoresis detection D1-F: GCAGATCCTCAACATGCTGCTG D1-R: CAGGACAGTCAAGGACAGTGAG Using the functional marker developed by the present invention, PCR amplification was performed using DNA samples of disease-resistant and susceptible samples of largemouth bass as templates. The PCR reaction system was: 2× Taq PCR mix 10μL; Depc H2O 8μL; DNA template 1μL; MF / -R: 0.5μL / 0.5μL. The reaction procedure was: 95℃- 5 min; 94℃ -30 s; 72℃- 90 s; 35 cycles; 72℃ extension 8 min, and then stored at 4℃. After PCR amplification, 2% agarose gel electrophoresis was used for detection, V-120V, A-400mA, T-100min.

[0032] 2. Results Analysis PCR amplification and agarose gel electrophoresis were performed on 18 disease-resistant and susceptible largemouth bass samples, and the results showed that both disease-resistant and susceptible individuals of largemouth bass were single bands, with sizes of 1273 bp (nucleotide sequence as shown in SEQ ID NO:2) and 1134 bp (nucleotide sequence as shown in SEQ ID NO:1), respectively.

[0033] 3. Sequencing Analysis The SanPrep column DNA gel recovery kit (Shanghai Biotechnology Co., Ltd.) was used to Figure 1 The obtained disease-resistant 1273bp and susceptible 1134bp bands were cut and recovered, and after confirming that the concentration was qualified, they were connected with the pESI-T vector and transformed into DH5ɑ competent cells. The positive clones were selected and sent to Shanghai Biotech Co., Ltd. for sequencing. The sequencing results are shown in the figure. Figure 2 As shown, RL represents a 1273 bp band and SL represents a 1134 bp band in males.

[0034] IV. Experimental Examples 1. Purpose In order to verify the actual application effect of the functional molecular marker of the present invention, its high efficiency, accuracy and actual breeding effect in the rapid screening of largemouth bass resistant to rhabdovirus were demonstrated.

[0035] 2. Experimental Design 2.1 Experimental groups Experimental group (method of the present invention): using the functional molecular marker developed by the present invention, combined with PCR amplification and agarose gel electrophoresis technology to screen disease-resistant (1273 bp) and susceptible (1134 bp) individuals; Control group 1 (traditional phenotypic selection): through artificial challenge experiments, observe the survival phenotype to screen disease-resistant individuals; Control group 2 (random selection): The same number of individuals were randomly selected as the disease-resistant group.

[0036] 2.2 Experimental Materials Experimental fish: 900 healthy, uniform-sized (2-4 cm) largemouth bass fry. Rhabdovirus (MSRV): concentration 1×10 5 copies / mL.

[0037] Testing materials and instruments: PCR kit, Trizol reagent, agarose electrophoresis reagent, etc. Experimental equipment: qPCR instrument, gel electrophoresis system, etc.

[0038] 2.3 Experimental methods Functional molecular marker screening (experimental group) DNA from the caudal fin of largemouth bass was extracted. PCR amplification was performed using primers D1-F / D1-R. The amplified products were detected by agarose gel electrophoresis to distinguish between the disease-resistant type (1273 bp) and the susceptible type (1134 bp).

[0039] Traditional phenotypic selection (control group 1) The seedlings were artificially challenged with the virus (25°C, virus contact for 4 hours) and observed for 7 days, and the surviving individuals were identified as disease-resistant.

[0040] Random selection (control group 2) There were no specific screening criteria, and individuals were randomly selected as the disease-resistant population.

[0041] Subsequent test verification Disease resistance test: The disease-resistant individuals screened out will be artificially infected with the virus again, and the survival rate will be calculated.

[0042] Growth performance test: The disease-resistant individuals selected in each group were cultured for 60 days, and the average body length and weight gain were tested.

[0043] Genetic stability analysis: The offspring of the selected disease-resistant individuals are tested for disease resistance using the same screening method.

[0044] 3. Data Recording and Analysis 3.1 Screening efficiency Record the time and cost required for each group to screen 100 disease-resistant individuals.

[0045] Experimental group: The time of PCR amplification and electrophoresis detection was shorter.

[0046] Control group 1: Phenotypic observation takes 7 days, and the challenge experiment affects the environmental cost.

[0047] Control group 2: No scientific selection basis, shortest time consumption but high randomness.

[0048] 3.2 Screening accuracy The disease-resistant individuals screened out in each group were challenged with the virus again and their survival rates were compared.

[0049] 3.3 Disease resistance Compare the disease resistance (survival rate) and viral load (detected by qPCR) of the disease-resistant population after screening.

[0050] 3.4 Growth performance After 60 days of breeding, the average body length and weight gain of disease-resistant individuals in each group were calculated to evaluate the growth potential of disease-resistant individuals.

[0051] 3.5 Genetic stability Determine the disease resistance and genotype distribution of the offspring of disease-resistant individuals and evaluate genetic stability.

[0052] 4. Experimental Data 4.1 Screening efficiency

[0053] Result analysis: The screening time of the experimental group was significantly shortened (about 1 / 84 of that of the control group 1), and the cost was lower than that of the traditional phenotypic selection. Although the control group 2 was short, there was no scientific basis for screening, and it was difficult to guarantee the effect.

[0054] 4.2 Screening accuracy

[0055] Result analysis: The disease-resistant individuals selected in the experimental group showed a significantly higher survival rate. The control group 1 was affected by the phenotypic observation error and its accuracy was lower than that of the experimental group. The performance of the control group 2 was close to random and could not meet the actual needs.

[0056] 4.3 Disease resistance 4.3.1 Viral load (qPCR detection)

[0057] Result analysis: The experimental group had the lowest individual viral load, indicating the strongest resistance to disease.

[0058] 4.3.2 Survival rate

[0059] 4.4 Growth performance

[0060] Result analysis: The growth rate of disease-resistant individuals in the experimental group was significantly better than that in the control group, showing higher breeding potential.

[0061] 4.5 Genetic stability Proportion of disease-resistant offspring

[0062] 5. Experimental conclusion The molecular marker screening method of the present invention shows higher screening efficiency (time reduction of 80%) and lower cost (reduction of 30%). The disease-resistant individuals screened out are significantly better than the control group in terms of disease resistance (viral load, survival rate) and growth performance (body length, weight gain). The proportion of disease-resistant offspring is high and the genetic stability is good, which provides a scientific basis for constructing disease-resistant populations. Comprehensive verification shows that the present invention has significant technical advantages in disease-resistant breeding and has promotion and application value.

[0063] The above is a description of the embodiments of the present invention. Through the above description of the disclosed embodiments, professionals and technicians in the field can implement or use the present invention. Various modifications to these embodiments will be apparent to professionals and technicians in the field. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown in this article, but will conform to the widest range consistent with the principles and novelties disclosed herein.

Claims

1. A reagent for rapid identification of functional molecular markers of largemouth bass resistant to rhabdovirus, characterized in that: The functional molecular marker includes a susceptible type and a disease-resistant type. The nucleotide sequence of the susceptible type molecular marker is shown in SEQ ID NO:1, and the nucleotide sequence of the disease-resistant type molecular marker is shown in SEQ ID NO:

2.

2. The reagent according to claim 1, characterized in that The reagent comprises a primer for identifying the functional molecular marker according to claim 1.

3. The reagent according to claim 2, characterized in that The primer consists of a forward primer and a reverse primer, the sequence of the forward primer D1-F is GCAGATCCTCAACATGCTGCTG, and the sequence of the reverse primer D1-R is CAGGACAGTCAAGGACAGTGAG.

4. A kit comprising the reagent described in any one of 1 to 3.

5. Use of the reagent according to any one of claims 1 to 3 or the kit according to claim 4 in rapid identification of individuals resistant to rhabdovirus in largemouth bass.

6. Use of the reagent according to any one of claims 1 to 3 or the kit according to claim 4 in breeding of largemouth bass resistant to rhabdovirus.

7. A method for rapidly identifying individuals of largemouth bass that are resistant to rhabdovirus, characterized in that: The method comprises the following steps: 1) Extraction of DNA from largemouth bass; 2) Using the reagent described in any one of claims 1 to 3 to perform PCR amplification on largemouth bass DNA, and after the PCR amplification is completed, using agarose gel electrophoresis to detect, the individuals with the nucleotide sequence shown in SEQ ID NO: 1 in the amplification product are susceptible individuals, and the individuals with the nucleotide sequence shown in SEQ ID NO: 2 in the amplification product are resistant individuals.

8. The method according to claim 8, characterized in that The PCR reaction system was: 2×Taq PCR mix 10μL; Depc H2O 8μL; DNA template 1μL; forward primer and reverse primer: 0.5μL / 0.5μL.

9. The method according to claim 9, characterized in that: The PCR reaction program was: 95℃- 5 min; 94℃ -30s; 72℃- 90s; 35 cycles; extension at 72℃ for 8 min, and then stored at 4℃.

10. Use of the method according to any one of claims 7 to 9 in breeding of largemouth bass resistant to rhabdovirus.

Images