Bacillus velezensis with saline-alkaline tolerance and growth promoting functions, bio-organic fertilizer and application of bio-organic fertilizer

Abstract

The invention discloses bacillus velezensis with saline-alkaline tolerance and growth promotion functions, a bio-organic fertilizer and application of the bio-organic fertilizer, and relates to the technical field of agricultural microorganisms. The bacillus velezensis is preserved in the Guangdong Microbial Culture Collection Center on November 6, 2024, the preservation address is the 5th floor of the building 59, No.100 Courtyard, Xianlie Middle Road, Guangzhou, and the preservation number is GDMCC (China General Microbiological Culture Collection Center): 65428. The strain has strong saline-alkaline tolerance, can effectively survive in moderate and severe saline-alkaline environments, remarkably improves the germination rate of crops and the content of soluble sugar, proline and antioxidant enzyme, and reduces the content of malondialdehyde. The bio-organic fertilizer produced by using the strain can effectively improve crop yield and soil organic carbon, reduce pH and total salt content, and has a remarkable improvement effect on saline-alkali soil.

Description

Technical Field

[0001] The invention relates to the technical field of agricultural microorganisms, in particular to a strain of Bacillus Velezii with salt-alkali tolerance and growth-promoting functions, a biological organic fertilizer and applications thereof. Background Art

[0002] Salinization is one of the most severe environmental pressures for crop growth and yield imbalance and decline. Every year, about 1-2% of agricultural land becomes unproductive land, resulting in an average crop yield reduction of more than 50%. Although salinity has a negative impact on the activity of soil bacteria through high osmotic intensity and salt toxicity, salt-tolerant bacteria can still survive and reproduce in soil and plant rhizosphere in high saline-alkali environments. Using salt-tolerant microorganisms to regulate crop resistance to salt stress, promote crop growth, maintain soil productivity, and effectively improve the benefits of saline-alkali land. Using bio-organic fertilizers to improve saline-alkali land is a safe and environmentally friendly choice that is more conducive to environmental management and agricultural practice. Bio-organic fertilizers containing salt-tolerant growth-promoting bacteria can better improve the root zone environment in salt-stressed habitats, and play an important role in reducing the application of chemical fertilizers and achieving sustainable agriculture. However, there is a lack of excellent salt-tolerant and drought-resistant growth-promoting strains, and the types of bio-organic fertilizers for saline-alkali land improvement are single and the effects are unstable. It is urgent to screen high-quality salt-tolerant and drought-resistant growth-promoting strains and develop bio-organic fertilizers.

[0003] At present, many salt-tolerant growth-promoting bacteria have been successfully isolated and their growth-promoting properties under salt stress have been identified, such as S. rhizophila e-p10, P. fluorescens SPB2145, P. chlororaphis TSAU 13, P. putida TSAU1, P. extremeorientalis TSAU20 and P. aureofaciens TSAU22, which can tolerate at least 3% NaCl salinity. Salt-tolerant growth-promoting bacteria can survive well in the rhizosphere of saline-alkali crops because they are adapted to saline-alkali soil conditions, are more competitive in obtaining nutrients, and have a greater chance of becoming an important component in regulating crop physiological activities. Therefore, the development of bio-organic fertilizers with salt-tolerant and drought-resistant growth-promoting bacteria as functional bacteria for use in saline-alkali soil agriculture is considered to be an effective method. Crop growth-promoting bacteria can colonize in the rhizosphere / root of crops and promote plant growth through various direct and indirect mechanisms. The use of these microorganisms themselves can reduce agricultural pressure, thus opening up new applications for salt-tolerant microorganisms. Summary of the invention

[0004] The purpose of the present invention is to provide a strain of Bacillus Velezii with salt-alkali tolerance and growth-promoting functions, a biological organic fertilizer and its application, so as to solve the problems existing in the above-mentioned prior art. The Bacillus Velezii has strong salt-alkali tolerance, can effectively survive in moderate and severe saline-alkali environments, and significantly improves the germination rate, soluble sugar, proline and antioxidant enzyme content of crops, and reduces the malondialdehyde content.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a strain of Bacillus velezensis with salt-alkali resistance and growth-promoting functions, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on November 6, 2024, with the deposit address being 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the deposit number being GDMCC No: 65428.

[0007] The present invention also provides the use of the above-mentioned Bacillus Velez in the preparation of a biological bacterial agent for enhancing the salt-alkali tolerance of crops.

[0008] The present invention also provides a biological microbial agent for enhancing the salt-alkali tolerance of crops, wherein the active ingredient includes the above-mentioned Bacillus Velezii.

[0009] The present invention also provides the use of the above-mentioned Bacillus Velez or biological bacterial agent in the preparation of biological organic fertilizer for enhancing the salt-alkali tolerance of crops.

[0010] The invention also provides a biological organic fertilizer for enhancing the salt-alkali tolerance of crops, wherein the active ingredient comprises the above-mentioned Bacillus Velezii.

[0011] Furthermore, the biological organic fertilizer comprises the following components in parts by weight: 5-10 parts of the bacterial solution of the above-mentioned Bacillus Velez subtilis and 90-95 parts of a fertilizer carrier.

[0012] Furthermore, the fertilizer carrier includes, by weight, 700-750 parts of decomposed cow dung, 100-150 parts of furfural residue powder, 80-90 parts of phosphogypsum powder and 10-20 parts of potassium humate.

[0013] The present invention also provides the use of the above-mentioned Bacillus Velez, biological bacterial agent or biological organic fertilizer in enhancing the salt-alkali tolerance of crops.

[0014] The present invention also provides a method for enhancing the salt-alkali tolerance of crops, comprising the step of applying the above-mentioned Bacillus Velez, biological bacterial agent or biological organic fertilizer to the crops.

[0015] Furthermore, the salt-alkali tolerance of crops includes the salt-alkali tolerance of crop seeds during the germination stage.

[0016] The present invention discloses the following technical effects:

[0017] The present invention isolates a strain of Bacillus Velezii with salt-alkali resistance and growth-promoting functions from cow dung samples from a dairy farm in Shuangwan Town, Jinchuan District, Jinchang City, Gansu Province. The strain has strong salt-alkali resistance, can effectively survive in moderate and severe saline-alkali environments, and significantly improves the germination rate, soluble sugar, proline and antioxidant enzyme content of crops, and reduces the malondialdehyde content. The biological organic fertilizer produced by the strain can effectively increase crop yield and soil organic carbon, reduce pH and total salt content, and has a significant improvement effect on saline-alkali land. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 is the colony morphology of strain WF1;

[0020] Figure 2 is the microscopic morphology of strain WF1;

[0021] Figure 3 It is the statistical graph of germination rate, fresh weight and dry weight of different treatment groups;

[0022] Figure 4 It is a statistical chart of soluble sugar content in corn seedlings of different treatment groups;

[0023] Figure 5 This is a statistical graph of proline content in corn seedlings of different treatment groups;

[0024] Figure 6 It is a statistical chart of malondialdehyde content in corn seedlings of different treatment groups;

[0025] Figure 7 It is a statistical chart of catalase content in corn seedlings of different treatment groups;

[0026] Figure 8 It is a statistical graph of superoxide dismutase content in corn seedlings of different treatment groups;

[0027] Fig. 9 It is a statistical chart of the peroxidase amount of corn seedlings in different treatment groups;

[0028] Fig.10 It is a statistical chart of corn yield in different treatment groups;

[0029] Fig.11It is a statistical graph of soil organic carbon content in different treatment groups;

[0030] Fig.12 It is the statistical graph of soil pH in different treatment groups;

[0031] Fig.13 Statistical chart of soil total salt content in different treatment groups. DETAILED DESCRIPTION

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0034] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0035] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0036] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0037] Example 1 Strain Isolation, Identification and Preservation

[0038] 1. Strain Isolation

[0039] The present invention isolates a bacterial strain from a cow dung sample from a dairy farm in Shuangwan Town, Jinchuan District, Jinchang City, Gansu Province, and names it WF1.

[0040] 2. Strain Identification

[0041] (1) Morphological identification

[0042] The strain WF1 was cultured on nutrient agar plates at 30°C for 2 days. Figure 1 As shown, the surface of the colony is rough, opaque, and has irregular edges. Figure 2 ) showed that strain WF1 was a Gram-positive bacillus with spores. The spores were oval and subcentral or subterminal.

[0043] (2) Physiological and biochemical identification

[0044] The physicochemical characteristics of strain WF1 are shown in Table 1 below.

[0045] Table 1 Physicochemical characteristics of strain WF1

[0046]

[0047] Note: “+” indicates a positive reaction, and “-” indicates a negative reaction.

[0048] (3) Molecular biological identification

[0049] Molecular identification results of strain WF1: the 16S rRNA gene sequence obtained by sequencing the strain WF1 is 1319bp (SEQID NO.1). The nucleotide homology comparison between the 16SrRNA gene sequence of the strain and the registered sequence in Genebank using the Blast program shows that the homology between the 16SrRNA gene sequence of the strain and that of Bacillus velezensis is 99.92%; the gyrB gene sequence obtained by sequencing is 887bp (SEQ ID NO.2). The nucleotide homology comparison between the 16SrRNA gene sequence of the strain and the registered sequence in Genebank using the Blast program shows that the homology between the gyrB gene sequence of the strain and that of Bacillus velezensis is 98.31%.

[0050] In summary, the identification results showed that strain WF1 belonged to Bacillus velezensis.

[0051] SEQ ID NO.1:

[0052]

[0053] SEQ ID NO.2:

[0054] CGTCCGTCGTAAACGCCTTGTCGACCACTCTTGACGTTACGGTTCATCGTGACGGGAAAATCCACTATCAGGCGTACGAGCGCGGTGTACCTGTGGCTGATCTTGAAGTGATCGGCGAAACTGATAAGACCGGAACGATTACGCACTTCGTTCCGGATCCGGAAATTTTCAAAGAAACAACCGTATATGACTATGATCTGCTTTCAAACCGTGTCCGGGAATTGGCCTTCCTGACAAAAGGCGTAAACATCACGATTGAAGACAAACGTGAAGGACAAGAACGGAAAAACGAGTACCACTACGAAGGCGGAATCAAAAGCTATGTTGAGTACTTAAACCGTTCCAAAGAAGTCGTTCATGAAGAGCCGATTTATATCGAAGGCGAGAAAGACGGCATAACGGTTGAAGTTGCATTGCAATACAACGACAGCTATACAAGCAATATTTATTCTTTCACAAATAATATCAACACATACGAAGGCGGCACGCACGAGGCCGGATTTAAAACCGGTCTGACCCGTGTCATAAACGACTATGCAAGAAGAAAAGGGATTTTCAAAGAAAATGATCCGAATTTAAGCGGGGATGATGTGAGAGAAGGGCTGACTGCCATTATTTCAATTAAGCACCCTGATCCGCAATTCGAAGGGCAGACGAAAACCAAGCTCGGCAACTCCGAAGCGAGAACGATCACTGATACGCTGTTTTCTTCTGCGCTGGAAACATTCCTTCTTGAAAATCCGGACTCAGCCCGCAAAATCGTTGAAAAAGGTTTAATGGCCGCAAGAGCGCGGATGGCGGCGAAAAAAGCCCGGGAATTGACCCGGCGCAAAAGTGCGCTTGAGATTTCCAATCTGCCGGGCAAACTGGGCGGACTGTTCTTCTAA。

[0055] 3. Preservation of bacterial strains

[0056] Bacillus velezensis WF1 was deposited in the Guangdong Provincial Microbiological Culture Collection on November 6, 2024. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences (Guangdong Provincial Microbiological Analysis and Testing Center), and the deposit number is GDMCC No: 65428.

[0057] Example 2

[0058] (1) Evaluation of growth-promoting function

[0059] The growth-promoting function of strain WF1 was evaluated, and the results are shown in Table 2. The results showed that strain WF1 has the ability to produce ACC deaminase activity, nitrogen fixation, phosphate solubilization, siderophore production and IAA production, and has a significant growth-promoting and yield-increasing effect on crops.

[0060] Table 2 Evaluation of the growth-promoting function of strain WF1

[0061]

[0062] Note: NPA stands for the culture medium used to screen inorganic phosphorus bacteria; OPA stands for the culture medium used to screen organophosphorus bacteria; NFb stands for the culture medium used to screen bacteria with nitrogen-fixing activity; "+" indicates positive, and "-" indicates negative.

[0063] (2) Salt and alkaline resistance test of strains

[0064] The strain WF1 can grow normally in LB liquid medium with a NaCl content of 12wt% and a pH of 9.6. The viable bacterial concentration can reach 6.4×10 9 CFU / mL.

[0065] Example 3 Seed germination experiment

[0066] (1) Preparation of bacterial solution

[0067] The strain WF1 was inoculated into LB medium and cultured with shaking at 30°C and 150 rpm for 48 h to obtain a WF1 bacterial solution.

[0068] (2) Experimental groups

[0069] CK group: The sterilized corn seeds were placed in sterile LB medium and soaked for 6 hours; the absorbent cotton was spread on the bottom of the culture dish, and sterilized water was poured in to cover the absorbent cotton, and 20 soaked corn seeds were placed in the dish for germination experiment;

[0070] NaCl (9%) group: the sterilized corn seeds were placed in sterile LB medium and soaked for 6 hours; the absorbent cotton was spread on the bottom of the culture dish, and the sterilized 9% sodium chloride solution was poured in to cover the absorbent cotton, and 20 soaked corn seeds were placed in the dish for germination experiment;

[0071] Medium + (9%) group: The sterilized corn seeds were placed in sterile LB medium and soaked for 6 hours; the absorbent cotton was spread on the bottom of the culture dish, and the sterilized LB liquid medium containing 9% sodium chloride was poured in to cover the absorbent cotton, and 20 sterilized corn seeds were placed in the culture dish for germination experiment;

[0072] WF1 bacterial solution + (9%) group: The sterilized corn seeds were placed in WF1 bacterial solution and soaked for 6 hours; the absorbent cotton was spread on the bottom of the culture dish, and the sterilized 9% sodium chloride solution was poured in to cover the absorbent cotton, and 20 corn seeds soaked in WF1 bacterial suspension were placed in the dish for germination experiment.

[0073] The culture dishes of the treatment groups were placed in a light incubator at 25°C for 5 days (the first 2 days were dark cultured; the next 3 days were 12 hours of light culture and 12 hours of dark culture); after the experiment, the germination rate, fresh weight and dry weight of corn seeds were recorded, with 3 replicates for each group.

[0074] (3) Experimental results

[0075] like Figure 3 As shown, the WF1 strain can increase the germination rate of corn at 9% salt concentration by 103.1%, the fresh weight by 86.52%, and the dry weight by 79.84%.

[0076] Example 4 Planting Experiment

[0077] (1) Preparation of bacterial solution

[0078] The strain WF1 was inoculated into LB medium and cultured with shaking at 30°C and 150 rpm for 48 h to obtain a WF1 bacterial solution.

[0079] (2) Experimental groups

[0080] The potting medium was obtained by mixing nutrient soil and coconut bran (volume ratio 4:1), then sterilized at 121°C for 1 hour, and placed in hole pots (length 10 cm × width 10 cm × height 10 cm) after cooling, with 200 g placed in each pot, and then divided into the following four groups for planting experiments:

[0081] CK group: Two corn seeds soaked in sterile LB medium for 6 hours were planted in each pot and watered with sterile water.

[0082] NaCl (9%) group: Two corn seeds soaked in sterile LB medium for 6 hours were planted in each pot, and 9% NaCl solution was irrigated once a week, and sterile water was used for the rest of the time.

[0083] Medium + (9%) group: The soluble salt concentration in the potting medium was adjusted to 9%, and 2 corn seeds soaked in sterile LB medium for 6 hours were planted in each pot. The pots were watered with LB liquid medium containing 9% NaCl once a week and sterile water was used for the rest of the time.

[0084] WF1 bacterial solution + (9%) group: The soluble salt concentration in the potting medium was adjusted to 9%, and 2 corn seeds soaked in WF1 bacterial solution for 6 hours were planted in each pot. The pots were watered with WF1 bacterial solution containing 9% NaCl once a week, and sterile water was used for the rest of the time.

[0085] After the seedlings of each treatment group emerged, the germination rate and emergence rate were calculated, and then one seedling was retained in each pot. After 15 days, growth indicators such as total root length, average root diameter and number of root tips, as well as physiological indicators such as soluble sugar, proline and malondialdehyde content were measured. The weight of the dried corn plants and roots was measured as the seedling dry weight and root dry weight; the root length, average root diameter and number of root tips of corn were measured using a root scanner.

[0086] (3) Experimental results

[0087] like Figure 4-Figure 6 As shown in the figure, the soluble sugar and proline contents of corn seedlings in the WF1 bacterial solution + (9%) group increased by 357.74% and 352.11% respectively, and the malondialdehyde content decreased by 51.70%. Figure 7-Figure 9 As shown, the catalase (CAT), superoxide dismutase (SOD) and peroxidase (POD) contents of corn seedlings in the WF1 bacterial solution + (9%) group increased by 100.71%, 26.21% and 15.04%, respectively. It can be concluded that the content of antioxidant enzymes in corn seedlings treated with strain WF1 increased significantly, enabling corn to better cope with salt stress and benefiting corn growth.

[0088] Example 5

[0089] A biological organic fertilizer, the preparation method is as follows:

[0090] 700g of decomposed cow dung, 150g of furfural slag powder, 80g of phosphogypsum powder and 20g of potassium humate are mixed evenly to prepare a fertilizer carrier. The decomposed cow dung is a powder passing through a 200-mesh sieve, with a moisture content of <25wt.%, the furfural slag powder is a powder passing through a 120-mesh sieve, with a moisture content of <25wt.%, the phosphogypsum powder is a powder passing through an 80-mesh sieve, with a moisture content of <25wt.%, and the potassium humate has a humic acid mass fraction of ≥50%, a total nitrogen mass fraction of ≥3.0%, a total phosphorus mass fraction of ≥0.4%, a total potassium mass fraction of ≥11.7%, and an organic matter mass fraction of ≥50% on a dry basis.

[0091] The strain WF1 was inoculated into LB liquid medium and the spore count reached 2×10 9 cfu / mL, 100 mL of the fermentation broth was centrifuged at 10000 r / min, the supernatant was poured out, and 20 mL of sterile water was added to obtain a concentrated bacterial solution.

[0092] The concentrated bacterial liquid and the fertilizer carrier are evenly mixed in a mass ratio of 10:90, sealed and placed in an incubator at 25° C. for culturing for 120 hours to obtain a biological organic fertilizer.

[0093] The biological organic fertilizer prepared in this embodiment has an organic matter content of ≥50%, a pH of 6.0-6.5, and an effective viable bacterial count of ≥2.0×10 8 cfu / g, the quality inspection results are shown in Table 3.

[0094] Table 3 Test results of improved biological organic fertilizers for saline-alkali land

[0095]

[0096]

[0097] Example 6

[0098] A biological organic fertilizer, the preparation method is as follows:

[0099] 725g of decomposed cow dung, 125g of furfural slag powder, 85g of phosphogypsum powder and 15g of potassium humate are mixed evenly to prepare a fertilizer carrier. The decomposed cow dung is a powder passing through a 200-mesh sieve, with a moisture content of <25wt.%, the furfural slag powder is a powder passing through a 120-mesh sieve, with a moisture content of <25wt.%, the phosphogypsum powder is a powder passing through an 80-mesh sieve, with a moisture content of <25wt.%, and the potassium humate has a humic acid mass fraction of ≥50%, a total nitrogen mass fraction of ≥3.0%, a total phosphorus mass fraction of ≥0.4%, a total potassium mass fraction of ≥11.7%, and an organic matter mass fraction of ≥50% on a dry basis.

[0100] The strain WF1 was inoculated into LB liquid medium and the spore count reached 2×10 9cfu / mL, 100 mL of the fermentation broth was centrifuged at 10000 r / min, the supernatant was poured out, and 20 mL of sterile water was added to obtain a concentrated bacterial solution.

[0101] The concentrated bacterial liquid and the fertilizer carrier were mixed evenly in a mass ratio of 8:92, sealed and placed in an incubator at 25°C for 120 hours to obtain a biological organic fertilizer with an effective live bacterial count of ≥2.0×10 8 cfu / g.

[0102] Example 7

[0103] A biological organic fertilizer, the preparation method is as follows:

[0104] 750g of decomposed cow dung, 100g of furfural slag powder, 90g of phosphogypsum powder and 10g of potassium humate are mixed evenly to prepare a fertilizer carrier. The decomposed cow dung is a powder passing through a 200-mesh sieve, with a moisture content of <25wt.%, the furfural slag powder is a powder passing through a 120-mesh sieve, with a moisture content of <25wt.%, the phosphogypsum powder is a powder passing through an 80-mesh sieve, with a moisture content of <25wt.%, and the potassium humate has a humic acid mass fraction of ≥50%, a total nitrogen mass fraction of ≥3.0%, a total phosphorus mass fraction of ≥0.4%, a total potassium mass fraction of ≥11.7%, and an organic matter mass fraction of ≥50% on a dry basis.

[0105] The strain WF1 was inoculated into LB liquid medium and the spore count reached 2×10 9 cfu / mL, 100 mL of the fermentation broth was centrifuged at 10000 r / min, the supernatant was poured out, and 20 mL of sterile water was added to obtain a concentrated bacterial solution.

[0106] The concentrated bacterial liquid and the fertilizer carrier were mixed evenly at a mass ratio of 5:95, sealed and placed in an incubator at 25°C for 120 hours to obtain a biological organic fertilizer with an effective live bacterial count of ≥2.0×10 8 cfu / g.

[0107] Example 8

[0108] Taking the bio-organic fertilizer prepared in Example 5 as an example, the salt-alkali tolerance and growth-promoting function of the bio-organic fertilizer prepared in the present invention was verified. A corn planting experiment was conducted in a saline-alkali field in Jingyuan, Gansu, where the pH of the saline-alkali field was 9.6 and the salt content was 0.65%. The experimental groups were as follows:

[0109] Functional bacterial agent group: 20 kg / mu of concentrated bacterial solution prepared in Example 5 was applied;

[0110] Organic fertilizer treatment group: 180 kg / mu of the fertilizer carrier prepared in Example 5 was applied;

[0111] Bio-organic fertilizer group: 200 kg / mu of bio-organic fertilizer prepared in Example 5 was applied;

[0112] Conventional fertilization: According to local conventional management, apply 200kg / mu of nitrogen, phosphorus and potassium compound fertilizer;

[0113] No fertilizer group: No fertilizer was applied.

[0114] The results show that the application of the bio-organic fertilizer of the present invention can effectively increase corn yield and soil organic carbon, while reducing pH and total salt content. Figure 10-13 As shown, compared with the group without fertilization, the yield and organic carbon content of the bio-organic fertilizer treatment group were increased, and the pH and total salt content were decreased.

[0115] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A strain of Bacillus velezensis having salt-alkali tolerance and growth-promoting function, characterized in that: It was deposited in the Guangdong Provincial Microbiological Culture Collection Center on November 6, 2024, with the deposit address at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the deposit number is GDMCC No: 65428.

2. Use of the Bacillus Velezii as claimed in claim 1 in the preparation of a biological agent for enhancing the salt-alkali tolerance of crops.

3. A biological agent for enhancing the salt-alkali tolerance of crops, characterized in that: The active ingredient comprises the Bacillus Velezii described in claim 1.

4. Use of the Bacillus Velezii according to claim 1 or the biological agent according to claim 3 in the preparation of a biological organic fertilizer for enhancing the salt-alkali tolerance of crops.

5. A bio-organic fertilizer for enhancing the salt-alkali tolerance of crops, characterized in that: The active ingredient comprises the Bacillus Velezii described in claim 1.

6. The bio-organic fertilizer according to claim 5, characterized in that The biological organic fertilizer comprises the following components by weight: 5-10 parts of the bacterial solution of Bacillus Velez subtilis according to claim 1 and 90-95 parts of a fertilizer carrier.

7. The bio-organic fertilizer according to claim 6, characterized in that In parts by weight, the fertilizer carrier includes 700-750 parts of decomposed cow dung, 100-150 parts of furfural residue powder, 80-90 parts of phosphogypsum powder and 10-20 parts of potassium humate.

8. Use of the Bacillus Velezii according to claim 1, the biological agent according to claim 3, or the biological organic fertilizer according to any one of claims 5 to 7 in enhancing the salt-alkali tolerance of crops.

9. A method for enhancing the salt-alkali tolerance of crops, characterized in that: The method comprises the step of applying the Bacillus Velez subtilis according to claim 1, the biological agent according to claim 3 or the biological organic fertilizer according to any one of claims 5-7 to the crops.

10. The method according to claim 9, characterized in that The salt-alkali tolerance of crops includes the salt-alkali tolerance of crops in the germination stage of seeds.

Images