Safe recombinant bacillus subtilis for synthesizing lactoyl-N-neotetraose as well as construction method and application of recombinant bacillus subtilis

Abstract

The invention belongs to the technical field of genetic engineering, and discloses a safe recombinant bacillus subtilis for synthesizing lactoyl-N-neotetraose and a construction method and application thereof, and the recombinant bacillus subtilis is obtained by converting a recombinant bacillus subtilis containing beta-1, 3-N-acetyl glucosamino transferase, beta-1, 3-N-acetyl glucosamino transferase, beta-1, 3-N-acetyl glucosamino transferase and beta-1, 3-N-acetyl glucosamino transferase in bacillus subtilis 168. The recombinant plasmid is obtained by plasmids of a 1, 4-galactosyl transferase gene and a lactose permease gene. The invention provides an engineering bacterium for producing lactyl-N-neotetraose and an application of the engineering bacterium to meet the demand of the market on lactyl-N-neotetraose aiming at the huge demand of the market on lactyl-N-neotetraose and insecurity of lactyl-N-neotetraose produced by most of the existing engineering bacteria in the prior art.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a recombinant Bacillus subtilis that safely synthesizes lactoyl-N-neotetraose, and a construction method and application thereof. Background Art

[0002] Human milk is a natural nourisher for infants and young children, with significant benefits for their growth and development, and possesses many beneficial functions that promote healthy development not found in cow's milk. Human milk primarily contains two carbohydrates: lactose and human milk oligosaccharides (HMOs). Lactose is one of the main nutrients in human milk and possesses high nutritional value. HMOs are the third most abundant component of human milk, after lactose and lipids, and are a complex mixture of over 200 non-digestible and non-nutritional carbohydrates. Lactoyl-N-neotetraose is the most abundant representative of the non-fucosylated neutral human milk oligosaccharide class in breast milk. Lactoyl-N-neotetraose plays crucial roles in infant health and development, including as a prebiotic, anti-adhesive antibiotic, antiviral protection, and immunomodulator. Studies of the various compositional differences between human and cow's milk have revealed the presence of HMOs in human milk, which are virtually absent in cow's milk and currently available infant formula. Although non-human milk oligosaccharides, such as galactooligosaccharides (GOS) and fructooligosaccharides (FOS), are added to infant formula as prebiotics, their complexity and specificity cannot match those of human milk oligosaccharides; an example is lacto-N-neotetraose, which is designed for developing infants. Furthermore, the U.S. Food and Drug Administration (FDA) has designated lacto-N-neotetraose as "generally recognized as safe," allowing it to be used as an additive in infant formula. Due to its unique nutritional applications, lacto-N-neotetraose holds considerable economic interest. However, the limited supply of lacto-N-neotetraose isolated from breast milk has hindered its use in food and medical applications. Therefore, the most viable option is to synthesize lacto-N-neotetraose.

[0003] There are four main methods for producing lacto-N-neotetraose: chemical hydrolysis, enzymatic conversion, chemoenzymatic method, and microbial fermentation. Although chemical synthesis has made great progress in the synthesis of lacto-N-neotetraose, factors such as the use of large amounts of organic solvents, harsh reaction conditions, and lengthy reaction orders make its production cost expensive. The presence of toxic reagents also limits the widespread application of lacto-N-neotetraose in the food industry. Although enzymatic synthesis has good product yields, the necessary enzymes are not easy to obtain. Glycosyltransferase catalysis requires sugar nucleotides as receptors, which are expensive and difficult to obtain. In addition, the inherent properties of the enzyme during the enzymatic reaction, such as enzyme stability, catalytic efficiency, and tolerance of substrates and receptors, all affect this method, making it difficult to produce on a large scale. Chemoenzymatic method has good stereoselectivity and regioselectivity, high conversion rate, and is easy to separate and purify, but the enzyme source is insufficient and the substrate adaptability is strict. Compared to the first three methods, microbial fermentation offers numerous advantages, including safety, environmental friendliness, sustainability, high production intensity, short fermentation time, easy operation, low cost, minimal equipment requirements, minimal environmental pollution, unrestricted raw material sources, and easy separation of fermentation products. Therefore, constructing genetically engineered bacteria that efficiently produce lactoyl-N-neotetraose can effectively address many of the challenges associated with traditional production methods and bring significant economic benefits to social production and development. In recent years, with the continuous development of metabolic engineering and synthetic biology, the metabolic pathways of host microorganisms can be artificially designed and modified using engineering techniques. Therefore, obtaining engineered strains with high production intensity, high conversion rate, and high yield for industrial lactoyl-N-neotetraose production through metabolic engineering and synthetic biology holds great promise.

[0004] At present, most of the engineered strains used for the production of lacto-N-neotetraose by microbial fermentation use Escherichia coli. However, Escherichia coli is a non-food safety grade strain, and the endotoxins it secretes make the lacto-N-neotetraose it produces unsafe for use in food, medicine and other fields. Compared with many other microorganisms in nature, Bacillus subtilis 168 has a clear genetic background, mature genetic manipulation tools, no obvious codon preference, and strong extracellular protein secretion ability. Compared with Escherichia coli, it does not secrete endotoxins and has been certified as a safe microorganism (Generally Recognized As Safe, GRAS) by the U.S. Food and Drug Administration. It can be used as a food safety grade strain. Its own metabolic pathway includes the synthesis pathways of uridine diphosphate galactose and uridine diphosphate acetylglucosamine, and these two substances can act as substrates to participate in the synthesis of lacto-N-neotetraose.

[0005] Currently, there is little research on LNnT in Bacillus subtilis and the yield is low. Therefore, how to use Bacillus subtilis to synthesize food-safe grade lactoyl-N-neotetraose through metabolic engineering and fermentation is an urgent problem that technicians in this field need to solve. Summary of the Invention

[0006] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a recombinant Bacillus subtilis that can safely synthesize lactoyl-N-neotetraose, as well as a construction method and application thereof.

[0007] The technical solution adopted by the present invention to solve its technical problem is:

[0008] A recombinant Bacillus subtilis that synthesizes lacto-N-neotetraose safely, wherein the recombinant Bacillus subtilis is obtained by transforming Bacillus subtilis 168 with a plasmid containing β-1,3-N-acetylglucosaminyltransferase, β-1,4-galactosyltransferase, and lactose permease genes;

[0009] The sequence of the β-1,4-galactosyltransferase gene is SEQ ID NO.1, the sequence of the β-1,3-N-acetylglucosaminyltransferase is SEQ ID NO.2, and the sequence of the lactose permease gene is SEQ ID NO.3.

[0010] Further, the plasmid is pHT01;

[0011] Alternatively, the β-1,3-N-acetylglucosaminyltransferase gene is derived from Neisseria meningitidis, the β-1,4-galactosyltransferase gene is derived from A. actinomycetemcomitans NUM4039, and the lactose permease gene is derived from Escherichia coli.

[0012] Furthermore, the recombinant Bacillus subtilis is further produced by using a strong promoter P for glmS encoding glucosamine-6-phosphate synthase in Bacillus subtilis 168. c2up , and introduced the trp terminator to effectively release the feedback inhibition of the glmS ribozyme, and transformed with a plasmid containing β-1,3-N-acetylglucosaminyltransferase, β-1,4-galactosyltransferase and lactose permease genes.

[0013] The method for constructing the recombinant Bacillus subtilis as described above comprises the following steps:

[0014] The recombinant plasmid pHT01-Aa-β-1,4-galT-lgt A-lacY was transformed into Bacillus subtilis 168 using the Bacillus subtilis chemically competent cell preparation and transformation method. The cells were plated on 10 μg / mL chloramphenicol-resistant plates and cultured at 37°C for 12 h. Transformants were picked for colony PCR, and a 3573 bp band appeared, verifying that the recombinant Bacillus subtilis was successfully constructed.

[0015] Furthermore, the construction method of the recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY comprises the following steps:

[0016] Based on the β-1,4-galactosyltransferase gene (BAS48030.1) from A. actinomycetemcomitans NUM4039 published on NCBI, the gene sequence shown in SEQ ID NO. 1 was synthesized after optimization of the codon preference of Bacillus subtilis;

[0017] Using primers Aα-β-1,4-galT-F and Aα-β-1,4-galT-R, the Aα-β-1,4-galT fragment was amplified using the synthesized β-1,4-galactosyltransferase gene of SEQ ID NO. 1 as a template, and the sequence fragment of the gene Aα-β-1,4-galT was cloned into the vector pHT01 to construct the plasmid pHT01-Aα-β-1,4-galT;

[0018] The gene sequence shown in SEQ ID NO. 2 was synthesized based on the β-1,3-N-acetylglucosaminyltransferase gene (Gene ID: 904226) from Neisseria meningitidis MC58 published on NCBI and optimized with codons preferred by Bacillus subtilis.

[0019] Primers lgtA-F and lgtA-R were used to amplify the lgtA fragment using the synthesized β-1,3-N-acetylglucosaminyltransferase gene with the gene sequence of SEQ ID NO. 2 as a template, and the sequence fragment of the gene lgtA was cloned into the vector pHT01-Aα-β-1,4-galT to construct the plasmid pHT01-Aα-β-1,4-galT-lgtA;

[0020] The gene sequence shown in SEQ ID NO. 3 was synthesized based on the lactose permease gene (GeneID: 949083) from Escherichia coli K12 published on NCBI and optimized with codons preferred by Bacillus subtilis.

[0021] Primers lacY-F and lacY-R were used to amplify the lacY fragment using the synthetic lactose permease gene with the gene sequence of SEQ ID NO. 3 as a template. The sequence fragment of the gene lacY was cloned into the vector pHT01-Aα-β-1,4-galT-lgtA to construct the plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY.

[0022] The use of the recombinant Bacillus subtilis as described above in the synthesis of lactoyl-N-neotetraose.

[0023] The method for producing lactoyl-N-neotetraose by fermentation using the recombinant Bacillus subtilis described above comprises the following steps:

[0024] A single colony of the recombinant Bacillus subtilis was picked and inoculated into LB liquid medium at 37°C and 200 r / min for 12 h.

[0025] The bacterial liquid was inoculated into the fermentation medium at an inoculum size of 2-5%, cultured at 37° C. and a rotation speed of 200 r / min for 48 hours, and the yield of lacto-N-neotetraose was detected, and the yield was 2.1 g / L.

[0026] The method for constructing the recombinant Bacillus subtilis as described above comprises the following steps:

[0027] Using CRISPR-Cas9 technology, the synthetic sequence of SEQ ID NO.4 strong promoter P was seamlessly knocked in front of the glms site. c2up and the sequence is SEQ ID NO.5trp terminator;

[0028] The upper and lower homology arms were amplified using primers glms-UP-F, glms-UP-R, glms-DN-F, and glms-DN-R with Bacillus subtilis 168 as the template, and P c2up -F, P c2up -R primers amplified the strong promoter P c2up fragment, the upper and lower homology arms, strong promoter P c2up The sequence fragments of the fragments were cloned into the vector pJOE8999 to construct the knock-in plasmid pJOE8999;

[0029] The successfully constructed glms knock-in plasmid was transformed into Bacillus subtilis 168 and plated on LB plates containing 5 μg / mL kanamycin and 0.2% mannose by mass. The cas9 gene was induced under the control of the mannose-inducible promoter P and cultured in a 30°C incubator until a single colony grew. Then, the grown colony was spotted with a toothpick on an LB plate without kana and cultured at 37°C. The next day, the colony was streaked on an LB plate at 42°C to obtain more single colonies. Finally, the colony was spotted with a toothpick on a plate containing 5 μg / mL kana and LB plates without kana, and screened out transformants that grew colonies on LB plates but did not grow colonies on resistance plates; PCR verification was performed using primers glms-F and glms-R, and a 1935bp band appeared, indicating that the glms knock-in strain was successfully constructed; the recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY was transferred into the above-mentioned glms knock-in strain, coated on 10μg / mL chloramphenicol-resistant plates, cultured at 37℃ for 12h, and the transformants were picked and subjected to colony PCR, and a 3573bp band appeared, verifying that the recombinant Bacillus subtilis BA03 was successfully constructed.

[0030] The use of the recombinant Bacillus subtilis as described above in the synthesis of lactoyl-N-neotetraose.

[0031] The method for producing lactoyl-N-neotetraose by fermentation using the recombinant Bacillus subtilis described above comprises the following steps:

[0032] A single colony of the recombinant Bacillus subtilis BA03 was picked and inoculated into LB liquid medium at 37°C and 200 rpm for 12 h.

[0033] The bacterial liquid was inoculated into the fermentation medium at a 2-5% inoculum volume, cultured at 37°C and 200 r / min for 48 h, and the yield of lacto-N-neotetraose was detected to be 3.5 g / L.

[0034] Alternatively, the steps include:

[0035] Batch fermentation of feed was performed in each 5L bioreactor. A single colony of recombinant Bacillus subtilis BA03 was picked and inoculated into LB liquid medium at 37°C and 200 rpm for 12 h. The recombinant strain BA03 was cultured in a 1L shake flask containing 150 mL LB medium at a 10% inoculum size for 8 h. The obtained seed solution was transferred to a bioreactor with a working volume of 3 L. 6 mL of isopropyl-β-D-thiogalactopyranoside (1 M) was added. IPTG was used to induce heterologous gene expression. During the entire culture process, the pH of the fermentation broth was adjusted to 6.8 by automatically adding 28% (v / v) NH4OH. The culture temperature was 37°C, the aeration rate was 6 VVM, and the rotation speed was 400 rpm. 80% glucose was introduced into the bioreactor at a constant rate of 35 mL / h for 12 h, and 80% glucose was introduced into the bioreactor at a constant rate of 15 mL / h for 24 h. 10-20 g / L lactose was also added. Carbon source addition was stopped after 48 h, and fermentation was continued for 72 h to obtain a fermentation broth.

[0036] Isopropyl-β-D-thiogalactoside (1 M IPTG) was prepared as follows: 238.3 g of isopropyl-β-D-thiogalactoside was weighed and dissolved in 1 L. After complete dissolution with distilled water, the solution was filtered into a sterile 2 mL EP tube using a filter in a clean bench and stored in a -20°C refrigerator for later use.

[0037] The advantages and positive effects achieved by the present invention are:

[0038] 1. The present invention aims to meet the huge market demand for lacto-N-neotetraose in the prior art, while the lacto-N-neotetraose produced by most existing engineered bacteria is unsafe. The present invention provides an engineered bacterium for producing lacto-N-neotetraose and its application to meet the market demand for lacto-N-tetraose.

[0039] 2. The present invention conducted fermentation analysis on a strain transformed with a plasmid containing the genes for β-1,3-N-acetylglucosaminyltransferase, β-1,4-galactosyltransferase, and lactose permease. The yield of lacto-N-neotetraose was determined using HPLC-RID-UV in shake flasks, yielding 2.1 g / L. Compared to the Bacillus subtilis strain synthesizing lacto-N-neotetraose, its construction method, and application, as described in patent CN 108410787 A, the yield of LNnT in Bacillus subtilis was doubled.

[0040] 3. The present invention utilizes the strong promoter Pc2up to enhance expression of the gene encoding glmS, which encodes glucosamine-6-phosphate synthase, and introduces the trp terminator to effectively relieve feedback inhibition of the GlmS ribozyme. HPLC-RID-UV assays determined lactoyl-N-neotetraose yields of 3.5 g / L in shake flasks and 9.6 g / L in a 5-L fermentor. This invention significantly improves lactoyl-N-neotetraose production using existing Bacillus subtilis strains.

[0041] 4. The present invention provides a new method for detecting lactoyl-N-neotetraose, which uses a high-performance liquid chromatography (HPLC) with a differential refractive index detector (DID) to detect the yields of lactose, lactoyl-N-triose II, and lactoyl-N-neotetraose. The method adopts the HPLC-RID-UV mode and uses Sugar-D (250×4.6 mm). This method has the advantages of being sensitive and rapid.

[0042] 5. The strain of the present invention is a food safety-grade engineered strain Bacillus subtilis 168 for producing lacto-N-neotetraose. The present invention constructs a combined overexpression plasmid of β-1,3-N-acetylglucosaminyltransferase, β-1,4-galactosyltransferase, and lactose permease. The present invention uses the strong promoter Pc2up to increase the expression of the glmS gene encoding glucosamine-6-phosphate synthase, and introduces the trp terminator to effectively relieve the feedback inhibition of the GlmS ribozyme. The recombinant Bacillus subtilis constructed by the present invention synthesizes lacto-N-neotetraose, and the yield in a shake flask can reach 3.5g / L, and the yield in a 5L fermenter can reach 9.6g / L, which is an improvement over the yield of lacto-N-neotetraose synthesized by existing Bacillus subtilis. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Schematic diagram of the metabolic process of producing lactoyl-N-neotetraose by the recombinant Bacillus subtilis of the present invention;

[0044] Figure 2 This is a map of the recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY constructed in the present invention;

[0045] Figure 3 This is a PCR verification diagram of the recombinant Bacillus subtilis of the present invention; wherein, M: DNA Marker; 1: negative control; 2: positive control recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY, 3573 bp; 3, 4: verification of BA01 and BA03 transformants, 3573 bp;

[0046] Figure 41 is a high performance liquid chromatogram of lactoyl-N-neotetraose synthesized by the recombinant Bacillus subtilis of the present invention; wherein, A: LNnT standard; B: wild type B. subtilis 168; C: recombinant Bacillus subtilis BA03.

[0047] Figure 5 This is a map of the glms knock-in plasmid constructed in the present invention;

[0048] Figure 6 This is a PCR verification diagram of the insertion of the glms knock-in plasmid into Bacillus subtilis 168 in the present invention; wherein, M: DNA Marker; 1: negative control; 2: positive control glms knock-in plasmid, 1935 bp; 3: glms knock-in plasmid inserted into Bacillus subtilis 168, 1935 bp. DETAILED DESCRIPTION

[0049] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive rather than restrictive, and the scope of protection of the present invention cannot be limited by the following embodiments.

[0050] The various experimental operations involved in the specific embodiments are all routine techniques in the field. For parts not specifically annotated in this document, ordinary technicians in this field can refer to various commonly used reference books, scientific literature or related instructions, manuals, etc. before the filing date of this invention to implement them.

[0051] The technical solution adopted by the present invention to solve its technical problem is:

[0052] A recombinant Bacillus subtilis that synthesizes lacto-N-neotetraose safely, wherein the recombinant Bacillus subtilis is obtained by transforming Bacillus subtilis 168 with a plasmid containing β-1,3-N-acetylglucosaminyltransferase, β-1,4-galactosyltransferase, and lactose permease genes;

[0053] The sequence of the β-1,4-galactosyltransferase gene is SEQ ID NO.1, the sequence of the β-1,3-N-acetylglucosaminyltransferase is SEQ ID NO.2, and the sequence of the lactose permease gene is SEQ ID NO.3.

[0054] Preferably, the plasmid is pHT01;

[0055] Alternatively, the β-1,3-N-acetylglucosaminyltransferase gene is derived from Neisseria meningitidis, the β-1,4-galactosyltransferase gene is derived from A. actinomycetemcomitans NUM4039, and the lactose permease gene is derived from Escherichia coli.

[0056] Furthermore, the recombinant Bacillus subtilis is further produced by using a strong promoter P for glmS encoding glucosamine-6-phosphate synthase in Bacillus subtilis 168. c2up , and introduced the trp terminator to effectively release the feedback inhibition of the glmS ribozyme, and transformed with a plasmid containing β-1,3-N-acetylglucosaminyltransferase, β-1,4-galactosyltransferase and lactose permease genes.

[0057] The method for constructing the recombinant Bacillus subtilis as described above comprises the following steps:

[0058] The recombinant plasmid pHT01-Aa-β-1,4-galT-lgt A-lacY was transformed into Bacillus subtilis 168 using the Bacillus subtilis chemically competent cell preparation and transformation method. The cells were plated on 10 μg / mL chloramphenicol-resistant plates and cultured at 37°C for 12 h. Transformants were picked for colony PCR, and a 3573 bp band appeared, verifying that the recombinant Bacillus subtilis was successfully constructed.

[0059] Preferably, the method for constructing the recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY comprises the following steps:

[0060] Based on the β-1,4-galactosyltransferase gene (BAS48030.1) from A. actinomycetemcomitans NUM4039 published on NCBI, the gene sequence shown in SEQ ID NO. 1 was synthesized after optimization of the codon preference of Bacillus subtilis;

[0061] Using primers Aα-β-1,4-galT-F and Aα-β-1,4-galT-R, the Aα-β-1,4-galT fragment was amplified using the synthesized β-1,4-galactosyltransferase gene of SEQ ID NO. 1 as a template, and the sequence fragment of the gene Aα-β-1,4-galT was cloned into the vector pHT01 to construct the plasmid pHT01-Aα-β-1,4-galT;

[0062] The gene sequence shown in SEQ ID NO. 2 was synthesized based on the β-1,3-N-acetylglucosaminyltransferase gene (Gene ID: 904226) from Neisseria meningitidis MC58 published on NCBI and optimized with codons preferred by Bacillus subtilis.

[0063] Primers lgtA-F and lgtA-R were used to amplify the lgtA fragment using the synthesized β-1,3-N-acetylglucosaminyltransferase gene with the gene sequence of SEQ ID NO. 2 as a template, and the sequence fragment of the gene lgtA was cloned into the vector pHT01-Aα-β-1,4-galT to construct the plasmid pHT01-Aα-β-1,4-galT-lgtA;

[0064] The gene sequence shown in SEQ ID NO. 3 was synthesized based on the lactose permease gene (GeneID: 949083) from Escherichia coli K12 published on NCBI and optimized with codons preferred by Bacillus subtilis.

[0065] Primers lacY-F and lacY-R were used to amplify the lacY fragment using the synthetic lactose permease gene with the gene sequence of SEQ ID NO. 3 as a template. The sequence fragment of the gene lacY was cloned into the vector pHT01-Aα-β-1,4-galT-lgtA to construct the plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY.

[0066] The use of the recombinant Bacillus subtilis as described above in the synthesis of lactoyl-N-neotetraose.

[0067] The method for producing lactoyl-N-neotetraose by fermentation using the recombinant Bacillus subtilis described above comprises the following steps:

[0068] A single colony of the recombinant Bacillus subtilis was picked and inoculated into LB liquid medium at 37°C and 200 r / min for 12 h.

[0069] The bacterial liquid was inoculated into the fermentation medium at an inoculum size of 2-5%, cultured at 37° C. and a rotation speed of 200 r / min for 48 hours, and the yield of lacto-N-neotetraose was detected, and the yield was 2.1 g / L.

[0070] The method for constructing the recombinant Bacillus subtilis as described above comprises the following steps:

[0071] Using CRISPR-Cas9 technology, the synthetic sequence of SEQ ID NO.4 strong promoter P was seamlessly knocked in front of the glms site. c2up and the sequence is SEQ ID NO.5trp terminator;

[0072] The upper and lower homology arms were amplified using primers glms-UP-F, glms-UP-R, glms-DN-F, and glms-DN-R with Bacillus subtilis 168 as the template, and P c2up -F, P c2up-R primers amplified the strong promoter P c2up fragment, the upper and lower homology arms, strong promoter P c2up The sequence fragments of the fragments were cloned into the vector pJOE8999 to construct the knock-in plasmid pJOE8999;

[0073] The successfully constructed glms knock-in plasmid was transformed into Bacillus subtilis 168 and plated on LB plates containing 5 μg / mL kanamycin and 0.2% mannose by mass. The cas9 gene was induced under the control of the mannose-inducible promoter P and cultured in a 30°C incubator until a single colony grew. Then, the grown colony was spotted with a toothpick on an LB plate without kana and cultured at 37°C. The next day, the colony was streaked on an LB plate at 42°C to obtain more single colonies. Finally, the colony was spotted with a toothpick on a plate containing 5 μg / mL kana and LB plates without kana, and screened out transformants that grew colonies on LB plates but did not grow colonies on resistance plates; PCR verification was performed using primers glms-F and glms-R, and a 1935bp band appeared, indicating that the glms knock-in strain was successfully constructed; the recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY was transferred into the above-mentioned glms knock-in strain, coated on 10μg / mL chloramphenicol-resistant plates, cultured at 37℃ for 12h, and the transformants were picked and subjected to colony PCR, and a 3573bp band appeared, verifying that the recombinant Bacillus subtilis BA03 was successfully constructed.

[0074] The use of the recombinant Bacillus subtilis as described above in the synthesis of lactoyl-N-neotetraose.

[0075] The method for producing lactoyl-N-neotetraose by fermentation using the recombinant Bacillus subtilis described above comprises the following steps:

[0076] A single colony of the recombinant Bacillus subtilis BA03 was picked and inoculated into LB liquid medium at 37°C and 200 rpm for 12 h.

[0077] The bacterial liquid was inoculated into the fermentation medium at a 2-5% inoculum volume, cultured at 37°C and 200 r / min for 48 h, and the yield of lacto-N-neotetraose was detected to be 3.5 g / L.

[0078] Alternatively, the steps include:

[0079] Batch fermentation of feed was performed in each 5L bioreactor. A single colony of recombinant Bacillus subtilis BA03 was picked and inoculated into LB liquid medium at 37°C and 200 rpm for 12 h. The recombinant strain BA03 was cultured in a 1L shake flask containing 150 mL LB medium at a 10% inoculum size for 8 h. The obtained seed solution was transferred to a bioreactor with a working volume of 3 L. 6 mL of isopropyl-β-D-thiogalactopyranoside (1 M) was added. IPTG was used to induce heterologous gene expression. During the entire culture process, the pH of the fermentation broth was adjusted to 6.8 by automatically adding 28% (v / v) NH4OH. The culture temperature was 37°C, the aeration rate was 6 VVM, and the rotation speed was 400 rpm. 80% glucose was introduced into the bioreactor at a constant rate of 35 mL / h for 12 h, and 80% glucose was introduced into the bioreactor at a constant rate of 15 mL / h for 24 h. 10-20 g / L lactose was also added. Carbon source addition was stopped after 48 h, and fermentation was continued for 72 h to obtain a fermentation broth.

[0080] Isopropyl-β-D-thiogalactoside (1 M IPTG) was prepared as follows: 238.3 g of isopropyl-β-D-thiogalactoside was weighed and dissolved in 1 L. After complete dissolution with distilled water, the solution was filtered into a sterile 2 mL EP tube using a filter in a clean bench and stored in a -20°C refrigerator for later use.

[0081] Specifically, the relevant preparation and detection are as follows:

[0082] The invention relates to a recombinant Bacillus subtilis for synthesizing lacto-N-neotetraose. The recombinant Bacillus subtilis is obtained by transforming Bacillus subtilis 168 with a plasmid containing a β-1,3-N-acetylglucosaminyltransferase gene, a β-1,4-galactosyltransferase gene and a lactose permease gene.

[0083] A recombinant Bacillus subtilis with improved lacto-N-neotetraose production, wherein the recombinant Bacillus subtilis is obtained by further expressing glmS encoding glucosamine-6-phosphate synthase in Bacillus subtilis 168 using a strong promoter P c2up The trp terminator was introduced to effectively relieve the feedback inhibition of the glmS ribozyme. The plasmid containing the genes for β-1,3-N-acetylglucosaminyltransferase, β-1,4-galactosyltransferase, and lactose permease was transformed into the ribozyme.

[0084] like Figure 1 Schematic diagram of the metabolic process of recombinant Bacillus subtilis producing lactoyl-N-neotetraose.

[0085] Example 1 Construction of recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY

[0086] The gene sequence shown in SEQ ID NO. 1 was synthesized based on the β-1,4-galactosyltransferase gene (BAS48030.1) from A. actinomycetemcomitans NUM4039 published on NCBI and optimized by codons preferred by Bacillus subtilis;

[0087] Primers Aα-β-1,4-galT-F and Aα-β-1,4-galT-R were used to amplify the Aα-β-1,4-galT fragment using the synthetic β-1,4-galactosyltransferase gene (SEQ ID NO. 1) as a template, and the sequence fragment of the gene Aα-β-1,4-galT was cloned into the vector pHT01 to construct the plasmid pHT01-Aα-β-1,4-galT;

[0088] The gene sequence shown in SEQ ID NO. 2 was synthesized based on the β-1,3-N-acetylglucosaminyltransferase gene (Gene ID: 904226) from Neisseria meningitidis MC58 published on NCBI and optimized with codons preferred by Bacillus subtilis.

[0089] Primers lgtA-F and lgtA-R were used to amplify the lgtA fragment using the synthetic β-1,3-N-acetylglucosaminyltransferase gene (SEQ ID NO. 2) as a template, and the sequence fragment of the gene lgtA was cloned into the vector pHT01-Aα-β-1,4-galT to construct the plasmid pHT01-Aα-β-1,4-galT-lgtA;

[0090] The gene sequence shown in SEQ ID NO. 3 was synthesized based on the lactose permease gene (GeneID: 949083) from Escherichia coli K12 published on NCBI and optimized with codons preferred by Bacillus subtilis.

[0091] Primers lacY-F and lacY-R were designed and used to amplify the lacY fragment using the synthetic lactose permease gene (SEQ ID NO.3) as a template. The sequence fragment of the gene lacY was cloned into the vector pHT01-Aα-β-1,4-galT-lgtA to construct the plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY. Figure 2 The plasmid map of pHT01-Aα-β-1,4-galT-lgtA-lacY is shown.

[0092] Example 2 Construction of recombinant Bacillus subtilis BA01.

[0093] Using the Bacillus subtilis chemical competent cell preparation and transformation method, the recombinant plasmid pHT01-Aα-β-1,4-galT-lg tA-lacY was transformed into Bacillus subtilis 168, coated with 10μg / mL chloramphenicol resistance plates, cultured at 37℃ for 12h, and an appropriate amount of transformants were picked for colony PCR. The appearance of a 3573bp band verified that the recombinant Bacillus subtilis BA01 was successfully constructed. Figure 3 As shown, lane 2 is the positive control of the recombinant plasmid, and lane 3 verifies the BA01 transformant, proving that the recombinant Bacillus subtilis BA01 was successfully constructed.

[0094] Example 3 Production of lactoyl-N-neotetraose by shake flask fermentation with recombinant Bacillus BA01

[0095] The strain was taken out from the -80°C freezer, streaked onto LB solid medium, and cultured at 37°C for 12 h.

[0096] Pick a single colony that has grown and inoculate it into a test tube containing LB liquid culture medium, incubate at 37°C, rotation speed 200r / min, and culture for 12h.

[0097] The bacterial liquid was inoculated into a 250 mL conical flask containing 50 mL of fermentation medium at a 2-5% inoculum volume, and cultured at 37°C and 200 r / min for 48 h.

[0098] The LB medium consisted of 10.0 g / L tryptone, 5.0 g / L yeast extract, and 10.0 g / L NaCl. Dissolved in deionized water, the volume was adjusted to 1.0 L, and the pH was adjusted to 7.0-7.2. Agar powder (1.5% by mass) was added to the solid medium. Sterilized at 121°C for 20 min.

[0099] The fermentation medium is: glucose 20-60 g / L, lactose 5-25 g / L, yeast extract 6-12 g / L, tryptone 3-6 g / L, (NH4)2SO4 3 g / L, K2HPO4 8.5 g / L, KH2PO4 2.5 g / L, MgSO4·7H2O 3 g / L, CaCl2 0.15 g / L, the trace element solution is configured according to the mg / L ratio: MnSO4 1.7 mg / L, FeSO4.7H2O 56 mg / L, ZnCl2 7.0 mg / L, and the solvent is water.

[0100] Example 4 Establishment of a method for detecting lactoyl-N-neotetraose in fermentation broth.

[0101] During the fermentation process, the fermentation broth was centrifuged, boiled for 5 minutes, and centrifuged again to obtain the supernatant. The fermentation broth was then filtered through a 0.22 μm pore size filter membrane into a liquid phase vial. The test solution was filtered twice to obtain the test solution. The contents of lactose, lacto-N-triose II, and lacto-N-neotetraose were determined using a high-performance liquid chromatography (HPLC) differential refractive index detector (RID) detector. The chromatographic conditions were: HPLC-RID-UV mode, a Sugar-D column (250 × 4.6 mm), mobile phase A: 65% acetonitrile, mobile phase B: 35% water, UV 195 nm, flow rate 1 mL / min, sampling volume 10 μL, time 15 minutes, column temperature 25°C, RID 30°C to 35°C.

[0102] Example 5 Construction of glms knock-in plasmid

[0103] The present invention uses the promoter Pc2up to enhance the expression of the gene encoding glmS, which encodes glucosamine-6-phosphate synthase. At the same time, in order to prevent overexpression from causing the GlmS ribozyme to feedback inhibit the synthesis of the GlcNAc precursor GlcN6P on glmS activity, the trp terminator is introduced to effectively relieve the feedback inhibition of the GlmS ribozyme.

[0104] The present invention uses CRISPR-Cas9 gene editing technology to insert the trp terminator and Pc2up promoter genes before the glmS gene in Bacillus subtilis 168. The Cas9 endonuclease is targeted to a specific site by a 20-nucleotide guide RNA (gRNA), and homologous recombination using a cloned repair template enables chromosome repair and cell survival. The gRNA and repair template can be introduced together into a single plasmid system, such as plasmid pJOE8999.

[0105] The plasmid used was pJOE8999. The amino acid sequence of glmS was selected and compared to the predicted N20 sequence using the website http: / / chopchop.cbu.uib.no / . The N20 fragment was obtained by denaturing with primers glms(N20-F) and glms(N20-R) at 95°C followed by cooling and continuous annealing. The pJOE8999 plasmid was digested with Bas1, and the N20 fragment was ligated.

[0106] Next, the repair template (upstream homology arm-trp terminator-promoter P) was introduced into the sal1 restriction site on the plasmid connected to the N20 fragment. c2up - downstream homology arm), and when homologous recombination is performed to achieve chromosome repair, the trp terminator and Pc2up promoter gene are inserted in front of the glmS gene of Bacillus subtilis 168. The upper and lower homology arms are obtained by PCR amplification using primers glms-UP-F, glms-UP-R, glms-DN-F, and glms-DN-R with Bacillus subtilis 168 as the template. The strong promoter P c2upThe fragment is P c2up -F, P c2up The trp terminator was obtained by PCR amplification using primers glms-UP-R, P c2up -F amplification. Upstream homology arm-trp terminator-promoter P c2up - downstream homology arm was obtained by overlapping PCR homologous recombination using primers glms-UP-F and glms-DN-R. The plasmid connected to the N20 fragment was digested with sal1 and the upstream homology arm-trp terminator-promoter P was cloned. c2up - The downstream homology arms were connected and the GLMs knock-in plasmid was constructed successfully (e.g. Figure 5 glms knock-in plasmid map shown).

[0107] Example 6 Construction of strain BA03 overexpressing the glms gene.

[0108] The successfully constructed glms knock-in plasmid was transformed into Bacillus subtilis 168. It was spread on an LB plate containing 5 μg / mL kanamycin and 0.2% mannose, and the cas9 gene was induced under the control of the mannose-inducible promoter P. It was cultured in a 30°C incubator until a single colony grew. Then, the grown colonies were spotted with a toothpick on an LB plate without kana and cultured at 37°C; the next day, the colonies were streaked on an LB plate at 37°C to obtain more single colonies. Finally, the colonies were spotted with a toothpick on LB plates containing kana (5 μg / mL) and without kana, and transformants with long colonies on the LB plate and no colonies on the resistance plate were screened. PCR verification was performed using primers glms-F and glms-R, and 1935bp appeared, as shown below. Figure 6 As shown, the glms knock-in strain was successfully constructed. The recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY was transferred into the above glms knock-in strain, coated with 10μg / mL chloramphenicol resistance plates, cultured at 37℃ for 12h, and an appropriate amount of transformants were picked for colony PCR. A 3573bp band appeared, verifying that the recombinant Bacillus subtilis BA03 was successfully constructed. Figure 3 As shown, lane 2 is the positive control of the recombinant plasmid, and lane 4 verifies the BA03 transformant, proving that the recombinant Bacillus subtilis BA03 was successfully constructed.

[0109] Example 7 Production of lactoyl-N-neotetraose by shake flask fermentation of recombinant Bacillus BA03

[0110] The strain was taken out from the -80°C freezer, streaked onto LB solid medium, and cultured at 37°C for 12 h.

[0111] Pick a single colony that has grown and inoculate it into a test tube containing LB liquid culture medium, incubate at 37°C, rotation speed 200r / min, and culture for 12h.

[0112] The bacterial liquid was inoculated into a 250 mL conical flask containing 50 mL of fermentation medium at a 2-5% inoculum volume, and cultured at 37°C and 200 r / min for 48 h.

[0113] The LB medium consisted of 10.0 g / L tryptone, 5.0 g / L yeast extract, and 10.0 g / L NaCl. Dissolved in deionized water, the volume was adjusted to 1.0 L, and the pH was adjusted to 7.0-7.2. Agar powder (1.5% by mass) was added to the solid medium. Sterilized at 121°C for 20 min.

[0114] The fermentation medium is: glucose 20-60 g / L, lactose 5-25 g / L, yeast extract 6-12 g / L, tryptone 3-6 g / L, (NH4)2SO4 3 g / L, K2HPO4 8.5 g / L, KH2PO4 2.5 g / L, MgSO4·7H2O 3 g / L, CaCl2 0.15 g / L, and the trace element solution is configured according to the mg / L ratio: MnSO4 1.7 mg / L, FeSO4.7H2O 56 mg / L, ZnCl2 7.0 mg / L.

[0115] Example 8 Establishment of a method for detecting lactoyl-N-neotetraose in fermentation broth.

[0116] During the fermentation process, the fermentation broth was centrifuged, boiled for 5 minutes, and centrifuged again to obtain the supernatant. The fermentation broth was then filtered through a 0.22 μm pore size filter membrane into a liquid phase vial. The test solution was filtered twice to obtain the test solution. The contents of lactose, lacto-N-triose II, and lacto-N-neotetraose were determined using a high-performance liquid chromatography (HPLC) differential refractive index detector (RID) detector. The chromatographic conditions were: HPLC-RID-UV mode, a Sugar-D column (250 × 4.6 mm), mobile phase A: 65% acetonitrile, mobile phase B: 35% water, UV 195 nm, flow rate 1 mL / min, sampling volume 10 μL, time 15 minutes, column temperature 25°C, RID 30°C to 35°C.

[0117] More specific implementation details are as follows:

[0118] Specific Example 1 Construction of recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY.

[0119] The gene sequence shown in SEQ ID NO. 1 was synthesized based on the β-1,4-galactosyltransferase gene (BAS48030.1) from A. actinomycetemcomitans NUM4039 published on NCBI and optimized by codons preferred by Bacillus subtilis;

[0120] Primers Aα-β-1,4-galT-F and Aα-β-1,4-galT-R were used to amplify the Aα-β-1,4-galT fragment using the synthetic β-1,4-galactosyltransferase gene as a template.

[0121] The sequences of Aα-β-1,4-galT-F and Aα-β-1,4-galT-R are:

[0122] Aα-β-1,4-galT-F: ATTAAAGGAGGAAGGGATCCATGAACAGCACAGAAAC

[0123] Aα-β-1,4-galT-R:GACGTCGACTCTAGATTAGTGTTTTTCTTTTTTCATATTTTAAG

[0124] The PCR reaction system was as follows: 25 μL of 2× Phanta Max Buffer, 1 μL of dNTP Mix (10 mM), 2 μL each of upstream primer Aα-β-1,4-galT-F and downstream primer Aα-β-1,4-galT-R (10 μM), 0.5 μL of template, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and sterile water was added to a final volume of 50 μL.

[0125] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 57°C for 15 s, extension at 72°C for 50 s, 30 cycles, and post-extension at 70°C for 5 min.

[0126] After PCR, the complete nucleotide sequence of the target fragment was obtained. Agarose gel electrophoresis revealed a 772-bp band, which was recovered using an agarose gel electrophoresis recovery kit. Plasmid pHT01 was treated with BamHI and a 7956-bp band was observed using an agarose gel electrophoresis recovery kit. The recovered Aα-β-1,4-galT fragment and the pHT01 fragment were ligated. The ligation product was transformed into competent E. coli JM109 cells and evenly plated onto LB plates containing ampicillin (100 μg / mL) and incubated overnight at 37°C.

[0127] Ligation system: vector 50-200 ng, fragment 10-200 ng, 5×CE II Buffer 4 μL, Exnase II 2 μL, ddH2O to 20 μL.

[0128] Enzyme digestion system: BamHI enzyme 5μL, plasmid 0.5μL, 10× Buffer 10μL, add sterile water to a final volume of 20μL, 37℃ / 30min.

[0129] Thermochemical transformation of E. coli and detection of clones:

[0130] 1) Place competent E. coli stored at -80°C on ice for 5 minutes;

[0131] 2) Add the enzyme-digested ligation product or the recombinant ligation product to the competent cells (20 μL / 100 μL) under sterile conditions and mix well with pipetting;

[0132] 3) Place the mixture on ice for 30 min;

[0133] 4) Heat shock in a 42°C metal bath for 90 seconds, then immediately place on ice for 5 minutes;

[0134] 5) Add 900 μL LB liquid medium and shake at 37°C for 45 minutes to recover;

[0135] 6) Centrifuge at 5000 rpm and 4°C for 5 min. Discard the supernatant and retain approximately 100 μL of the supernatant to resuspend the cells. Spread the resuspended solution evenly on an LB plate containing 100 μg / mL Amp and incubate at 37°C overnight.

[0136] Pick a single clone for colony PCR verification:

[0137] Using pHT01-F and pHT01-R primers, single clones were picked for colony PCR verification.

[0138] The band was observed by agarose gel electrophoresis and was 1159 bp. The plasmid was extracted from the correct colony and the plasmid that was successfully verified by enzyme digestion was sequenced. The successful construction of the recombinant plasmid pHT01-Aα-β-1,4-galT was verified by sequencing.

[0139] The primer sequences of pHT01-F and pHT01-R are:

[0140] pHT01-F:GATGACCTCGTTTCCACC

[0141] pHT01-R:GAGCTTCGTCAAAATATACTG

[0142] Colony PCR verification system: 50 μL of Taq DNA polymerase, 0.5 μL of template, 4 μL each of pHT01-F and pHT01-R, and sterile water to a final volume of 100 μL.

[0143] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 24 s, extension at 72°C for 18 s, 30 cycles, and post-extension at 70°C for 5 min.

[0144] The gene sequence shown in SEQ ID NO. 2 was synthesized based on the β-1,3-N-acetylglucosaminyltransferase gene (Gene ID: 904226) in Neisseria meningitidis MC58 published on NCBI and optimized by codon preference of Bacillus subtilis.

[0145] Primers lgtA-F and lgtA-R were used to amplify the lgtA fragment using the synthetic β-1,3-N-acetylglucosaminyltransferase gene as a template. The band was observed by agarose gel electrophoresis and the size was 1099 bp.

[0146] After treating the plasmid pHT01-Aα-β-1,4-galT with XbaI, a band of 8592 bp was observed by agarose gel electrophoresis. The fragment was recovered using an agarose gel electrophoresis recovery kit. The recovered lgtA fragment was ligated with the pHT01-Aα-β-1,4-galT vector. The ligation product was transformed into competent E. coli JM109 cells and evenly plated on LB plates containing ampicillin (100 μg / mL). The cells were cultured overnight at 37°C.

[0147] The sequences of the lgtA-F and lgtA-R primers are:

[0148] lgtA-F: CTGTGGAGAAAATAATCTAGAGGAGGTATTAATA ATGCCGTCAGAAGCAT TTAG

[0149] lgtA-R:CCCGGGGACGTCGAC TTATCTATTTTTCAGCAGTCTATGCAG

[0150] The PCR reaction system was as follows: 25 μL of 2×PhantaMax Buffer, 1 μL of dNTP Mix (10 mM), 2 μL each of upstream primer lgtA-F and downstream primer lgtA-R (10 μM), 0.5 μL of template, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and sterile water was added to a final volume of 50 μL.

[0151] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 57°C for 15 s, extension at 72°C for 50 s, 30 cycles, and post-extension at 70°C for 5 min.

[0152] Ligation system: vector 50-200 ng, fragment 10-200 ng, 5×CE II Buffer 4 μL, Exnase II 2 μL, ddH2O to 20 μL.

[0153] Enzyme digestion system: XbaI enzyme 5μL, plasmid 0.5μL, 10× Buffer 10μL, add sterile water to a final volume of 20μL, 37℃ / 30min.

[0154] Thermochemical transformation of Escherichia coli and detection of clones

[0155] 1) Place competent E. coli stored at -80°C on ice for 5 minutes;

[0156] 2) Add the enzyme-digested ligation product or the recombinant ligation product to the competent cells (20 μL / 100 μL) under sterile conditions and mix well with pipetting;

[0157] 3) Place the mixture on ice for 30 min;

[0158] 4) Heat shock in a 42°C metal bath for 90 seconds, then immediately place on ice for 5 minutes;

[0159] 5) Add 900 μL LB liquid medium and shake at 37°C for 45 minutes to recover;

[0160] 6) Centrifuge at 5000 rpm and 4°C for 5 min. Discard the supernatant and retain approximately 100 μL of the supernatant to resuspend the cells. Spread the resuspended solution evenly on an LB plate containing 100 μg / mL Amp and incubate at 37°C overnight.

[0161] Pick single clones for colony PCR verification

[0162] Using pHT01-F and pHT01-R primers, single clones were picked for colony PCR verification.

[0163] The band was observed by agarose gel electrophoresis and was 2222bp. The plasmid was extracted from the correct colony and the plasmid that was successfully verified by enzyme digestion was sequenced. The sequencing verified that the recombinant plasmid pHT01-Aα-β-1,4-galT--lgtA was successfully constructed.

[0164] The primer sequences of pHT01-F and pHT01-R are:

[0165] pHT01-F:GATGACCTCGTTTCCACC

[0166] pHT01-R:GAGCTTCGTCAAAATATACTG

[0167] Colony PCR verification system: 50 μL of Taq DNA polymerase, 0.5 μL of template, 4 μL each of pHT01-F and pHT01-R, and sterile water to a final volume of 100 μL.

[0168] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 24 s, extension at 72°C for 18 s, 30 cycles, and post-extension at 70°C for 5 min.

[0169] The gene sequence shown in SEQ ID NO. 3 was synthesized based on the lactose permease gene (GeneID: 949083) in Escherichia coli K12 published on NCBI and optimized by codon preference of Bacillus subtilis.

[0170] The above primers lacY-F and lacY-R were used to amplify the lacY fragment with a size of 1324 bp using the synthetic lactose permease gene as a template.

[0171] The plasmid pHT01-Aα-β-1,4-galT-lgtA was treated with SmaI enzyme, and a band of 9751 bp was observed by agarose gel electrophoresis.

[0172] The lacY-F and lacY-R primer sequences are

[0173] lacY-F:AAAATAGATAAGTCGACGTCACTAGTAGAAGGAGGATTATTA ATGTATTA TCTGAAAAATACAAATTTTTGG

[0174] lacY-R: CCGCTCATTAGGCGGGCTGCCCCGGGGA TTATGCAACTTCATTAACTTGTC TTC

[0175] The PCR reaction system was as follows: 25 μL of 2×Phanta Max Buffer, 1 μL of dNTP Mix (10 mM), 2 μL each of upstream primer lacY-F and downstream primer lacY-R (10 μM), 0.5 μL of template, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and sterile water was added to a final volume of 50 μL.

[0176] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 57°C for 15 s, extension at 72°C for 50 s, 30 cycles, and post-extension at 70°C for 5 min.

[0177] Recover the fragment and digest the vector using an agarose gel electrophoresis recovery kit. Ligate the recovered lacY fragment and the pHT01-Aα-β-1,4-galT-lgtA fragment. Transform the ligation product into competent E. coli JM109 cells, spread the product evenly on LB plates containing ampicillin (100 μg / mL), and incubate at 37°C overnight.

[0178] Ligation system: vector 50-200 ng, fragment 10-200 ng, 5×CE II Buffer 4 μL, Exnase II 2 μL, ddH2O to 20 μL.

[0179] Enzyme digestion system: 5 μL SmaI enzyme, 0.5 μL plasmid, 10 μL 10× Buffer, add sterile water to a final volume of 20 μL, incubate at 37°C for 30 min.

[0180] Thermochemical transformation of E. coli and detection of clones:

[0181] 1) Place competent E. coli stored at -80°C on ice for 5 minutes;

[0182] 2) Add the enzyme-digested ligation product or the recombinant ligation product to the competent cells (20 μL / 100 μL) under sterile conditions and mix well with pipetting;

[0183] 3) Place the mixture on ice for 30 min;

[0184] 4) Heat shock in a 42°C metal bath for 90 seconds, then immediately place on ice for 5 minutes;

[0185] 5) Add 900 μL LB liquid medium and shake at 37°C for 45 minutes to recover;

[0186] 6) Centrifuge at 5000 rpm and 4°C for 5 min. Discard the supernatant and retain approximately 100 μL of the supernatant to resuspend the cells. Spread the resuspended solution evenly on an LB plate containing 100 μg / mL Amp and incubate at 37°C overnight.

[0187] Pick a single clone for colony PCR verification:

[0188] Using pHT01-F and pHT01-R primers, single clones were picked for colony PCR verification.

[0189] The transformants were verified using primers pHT01-F and pHT01-R, and the size was 3500bp. Sequencing confirmed that the recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY was successfully constructed. Figure 2 The plasmid map of pHT01-Aα-β-1,4-galT-lgtA-lacY is shown.

[0190] The primer sequences of pHT01-F and pHT01-R are:

[0191] pHT01-F:GATGACCTCGTTTCCACC

[0192] pHT01-R:GAGCTTCGTCAAAATATACTG

[0193] Colony PCR verification system: 50 μL of Taq DNA polymerase, 0.5 μL of template, 4 μL each of pHT01-F and pHT01-R, and sterile water to a final volume of 100 μL.

[0194] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 24 s, extension at 72°C for 18 s, 30 cycles, and post-extension at 70°C for 5 min.

[0195] Specific Example 2 Construction of recombinant Bacillus subtilis BA01.

[0196] The recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY was transformed into Bacillus subtilis 168. The specific preparation and transformation methods of Bacillus subtilis chemically competent cells are as follows:

[0197] (1) Streak Bacillus subtilis 168 onto LB plates and culture overnight at 37°C;

[0198] (2) Add 4 mL of LB to a sterilized test tube, pick a single colony, and culture overnight at 37°C and 200 rpm in a shaking incubator.

[0199] (3) Add 2.5 mL of SPI medium to the test tube, transfer 100 μL of the above bacterial solution to the test tube, and incubate at 37°C for 2.5 h. Measure the OD600 to be 1.1-1.3;

[0200] (4) Add 2 mL of SPII medium to the test tube, transfer 200 μL of bacterial solution to the test tube, and incubate at 37°C for 1.5 h;

[0201] (5) Add 20 μL of 10 mM EGTA and incubate at 37°C in a shaker at 100 rpm for 1.5 h.

[0202] (6) Add the plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY and culture at 37°C in a shaking incubator at 100 rpm for 1 h.

[0203] (7) Adjust the speed to 220 r / min and incubate for 1.5 h;

[0204] (8) Take 100 μL of bacterial solution and spread it on an LB plate containing chloramphenicol resistance (10 μg / mL);

[0205] (9) Place the plate in a 37°C incubator and culture overnight.

[0206] An appropriate amount of transformants were selected for colony PCR verification using primers pHT01-F and pHT01-R. The correct transformant band was 3500 bp, verifying that the recombinant Bacillus subtilis BA01 was successfully constructed. Figure 3 As shown, lane 2 is the positive control of the recombinant plasmid, and lane 3 verifies the BA01 transformant, proving that the recombinant Bacillus subtilis BA01 was successfully constructed.

[0207] Sp medium: Weigh 18.34 g / L K₂HPO₄, 6 g / L KH₂PO₄, 2 g / L (NH₄)₂SO₄, 0.2 g / L MgSO₄·7H₂O, and 1 g / L sodium citrate in water. Sterilize at 121°C for 20 min.

[0208] Prepare a separate solution containing 50 g / L casein hydrolysate, 100 g / L yeast extract, 500 g / L glucose, 106.2 g / L MgCl₂·6H₂O, and 147 g / L CaCl₂ in water. Sterilize at 121°C for 20 min. Used for subsequent experiments.

[0209] SpI medium: Under aseptic conditions in a clean bench, aspirate 2.4 mL of 100 mL of Sp medium and add 400 μL of casein hydrolysate, 1 mL of yeast extract, and 1 mL of glucose.

[0210] SpII medium: Aseptically remove 1 mL of SpI medium from 100 mL under a clean bench and add 500 μL of MgCl2·6H2O and 500 μL of CaCl2. After preparation, store both SpI and SpII media at 4°C until needed.

[0211] Ethylene glycol ditetraacetic acid (EGTA solution): Weigh 3.80 g and dissolve it in 1 L. After it is completely dissolved with distilled water, adjust the pH to 8.0 with NaOH. Filter it into a sterile 2 mL EP tube using a filter in a clean bench and store it in a -20°C refrigerator until used.

[0212] Specific Example 3: Fermentation and production of lactoyl-N-tetraose by recombinant Bacillus BA01.

[0213] The overnight seed solution from Specific Example 2 was inoculated at a 2-5% inoculum into a 250 mL Erlenmeyer flask containing 50 mL of fermentation medium. The culture was incubated at 37°C, 200 rpm, and after 3.5 hours, 100 μL of isopropyl-β-D-thiogalactopyranoside (1 M IPTG) was added to induce heterologous gene expression. The culture was continued for 48 hours. 2 mL of the fermentation broth was collected every 12 hours to measure the cell density and yield. Each aliquot of the fermentation broth was centrifuged at 12,000 rpm for 10 minutes at 4°C. The supernatant was collected and stored in a refrigerator at -20°C. The cell density was expressed as absorbance at 600 nm. The sample was diluted, and the absorbance of the dilution was controlled between 0.2 and 0.8. The strain yield was determined by high-performance liquid chromatography (HPLC) with a differential refractive index detector. The recombinant Bacillus subtilis BA01 produced 2.1 g / L of lactoyl-N-neotetraose.

[0214] Preparation of isopropyl-β-D-thiogalactoside (1 M IPTG): Weigh 238.3 g of isopropyl-β-D-thiogalactoside and dissolve it in 1 L. After it is completely dissolved with distilled water, filter it into a sterile 2 mL EP tube using a filter in a clean bench and store it in a refrigerator at -20°C until use.

[0215] Specific Example 4: Detection method of lactoyl-N-neotetraose in fermentation broth.

[0216] During the fermentation process, the fermentation broth was centrifuged, boiled for 5 minutes, and centrifuged again to obtain the supernatant. The fermentation broth was then filtered through a 0.22 μm pore size filter membrane into a liquid phase vial. The test solution was filtered twice to obtain the test solution. The contents of lactose, lacto-N-triose II, and lacto-N-neotetraose were determined using a high-performance liquid chromatography (HPLC) with a differential refractive index detector (RID) detector. The chromatographic conditions were: HPLC-RID-UV mode, a Sugar-D column (250 × 4.6 mm), mobile phase A: 65% acetonitrile, mobile phase B: 35% water, UV 195 nm, flow rate 1 mL / min, sampling volume 10 μL, time 15 minutes, column temperature 25°C, RID 30°C to 35°C.

[0217] Specific Example 5 Construction of knock-in plasmid pJOE8999

[0218] The present invention uses the promoter Pc2up to enhance the expression of the gene encoding glmS, which encodes glucosamine-6-phosphate synthase. At the same time, in order to prevent overexpression from causing the GlmS ribozyme to feedback inhibit the synthesis of the GlcNAc precursor GlcN6P on glmS activity, the trp terminator is introduced to effectively relieve the feedback inhibition of the GlmS ribozyme.

[0219] The present invention uses CRISPR-Cas9 gene editing technology to insert the trp terminator and Pc2up promoter genes before the glmS gene of Bacillus subtilis 168 (the sequence is a gene of Bacillus subtilis 168 itself, which is well-known in the art). The Cas9 endonuclease is targeted to a specific site by a 20-nucleotide guide RNA (gRNA), and homologous recombination using a cloned repair template can achieve chromosome repair and cell survival. The gRNA and repair template can be introduced together into a single plasmid system, such as plasmid pJOE8999.

[0220] The plasmid used was pJOE8999. The amino acid sequence of glmS was selected and compared to the predicted N20 sequence using the website http: / / chopchop.cbu.uib.no / . The N20 fragment (the sequence is known in the art and available online; it is underlined in the primers) was obtained using primers glms(N20-F) and glms(N20-R) by denaturing at 95°C followed by cooling and continuous annealing. The pJOE8999 plasmid was digested with Bas1, and the N20 fragment was ligated.

[0221] Next, the repair template (upstream homology arm-trp terminator-promoter P) was introduced into the sal1 restriction site on the plasmid connected to the N20 fragment. c2up - downstream homology arm), and when homologous recombination is performed to achieve chromosome repair, the trp terminator (sequence is SEQ ID NO.5) and Pc2up (sequence is SEQ ID NO.4) promoter gene are inserted in front of the glmS gene of Bacillus subtilis 168. The upper and lower homology arms are obtained by PCR amplification technology using primers glms-UP-F, glms-UP-R, glms-DN-F, and glms-DN-R with Bacillus subtilis 168 as the template. The strong promoter P c2up The fragment (commissioned company synthesis) is P c2up -F, P c2up The trp terminator was obtained by PCR amplification using primers glms-UP-R, P c2up -F amplification (trp terminator is a base of a terminator with two primers. According to the primers, the upstream homology arm and P c2up This fragment is obtained when connecting, and the method is well known in the art. c2up The gene was synthesized by a commissioned company and then amplified using primers. Upstream homology arm-trp terminator-promoter P c2up - downstream homology arm was obtained by overlapping PCR homologous recombination using primers glms-UP-F and glms-DN-R. The plasmid connected to the N20 fragment was digested with sal1 and the upstream homology arm-trp terminator-promoter P was cloned. c2up- The downstream homology arms were connected and the GLMs knock-in plasmid was constructed successfully (e.g. Figure 5 glms knock-in plasmid map shown).

[0222] Among them glms(N20-F) and glms(N20-R), glms-UP-F, glms-UP-R, glms-DN-F, glms-DN-R, P c2up -F, P c2up -R primer sequence is:

[0223] glms(N20-F):TACG TCTCCTTTTACAATCTTAGG

[0224] glms(N20-R):AAAC CCTAAGATTGTAAAAGGAGA

[0225] glms-UP-F: TAATACGACTCACTATAGGGTCGACGAAGTTGAAAAAGAAATGAACG G

[0226] glms-UP-R: AAAGCTGCCAATGACGGCAGCTTTTTTCCACT AAGATTGTAAAAGGA GACGAAG

[0227] glms-DN-F:AACATGTTATACTATAATAGAGGAGGAAGAAAAATATGTGTG

[0228] glms-DN-R: GGCCCGGGCCTCGTTGGCCGTCGACCCATTTCTTTATCCATCAGCTC

[0229] P c2up -F: AGCTGCCGTCATTGGCAGCTTTTTTTATATCCT TGAGAATTCCTAACAACTAA ATCAC

[0230] P c2up -R:ACACATATTTTTCTTCCTCCTCTATTATAGTATAACATGTTAAACGATAG

[0231] The PCR reaction system was as follows: 25 μL of 2×Phanta Max Buffer, 1 μL of dNTP Mix (10 mM), 2 μL each of upstream primer and downstream primer (10 μM), 0.5 μL of template, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and sterile water was added to a final volume of 50 μL.

[0232] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 50 s, 30 cycles, and post-extension at 70°C for 5 min.

[0233] After PCR, the complete nucleotide sequence of the target fragment was obtained, and the bands were observed by agarose gel electrophoresis, and the upstream and downstream homology arms, P c2up The fragment lengths were 638 bp, 694 bp, and 162 bp, respectively, and the fragments were recovered by agarose gel electrophoresis recovery box. c2up The downstream homology arm was obtained by overlapping PCR using primers glms-UP-F and glms-DN-R. After PCR, the complete nucleotide sequence of the target fragment was obtained. The band was observed by agarose gel electrophoresis and the length was 1431 bp. The fragment was recovered using an agarose gel electrophoresis recovery kit. After the plasmid pJOE8999 was treated with SalI enzyme, the band was observed by agarose gel electrophoresis and the length was 7405 bp. The fragment was recovered using an agarose gel electrophoresis recovery kit. The recovered upstream homology arm-trp terminator-promoter P c2up The downstream homology arm fragment and the pJOE8999 vector were ligated, and the ligation product was transformed into Escherichia coli JM109 competent cells and evenly spread on LB plates with kanamycin resistance (5 μg / mL), and cultured at 37°C overnight.

[0234] Ligation system: vector 50-200 ng, fragment 10-200 ng, 5×CE II Buffer 4 μL, Exnase II 2 μL, ddH2O to 20 μL.

[0235] Enzyme digestion system: SalI enzyme 5μL, plasmid 0.5μL, 10× Buffer 10μL, add sterile water to a final volume of 20μL, 37℃ / 30min.

[0236] Thermochemical transformation of Escherichia coli and detection of clones

[0237] 1) Place competent E. coli stored at -80°C on ice for 5 minutes;

[0238] 2) Add the enzyme-digested ligation product or the recombinant ligation product to the competent cells (20 μL / 100 μL) under sterile conditions and mix well with pipetting;

[0239] 3) Place the mixture on ice for 30 min;

[0240] 4) Heat shock in a 42°C metal bath for 90 seconds, then immediately place on ice for 5 minutes;

[0241] 5) Add 900 μL LB liquid medium and shake at 37°C for 45 minutes to recover;

[0242] 6) Centrifuge at 5000 rpm and 4°C for 5 min. Discard the supernatant and retain approximately 100 μL of the supernatant to resuspend the cells. Spread the resuspended solution evenly on an LB plate containing kanamycin resistance (5 μg / mL) and incubate at 37°C overnight.

[0243] Pick a single clone for colony PCR verification:

[0244] Using PJF and PJR primers, single clones were picked for colony PCR verification;

[0245] The band was observed by agarose gel electrophoresis and was 1878 bp. The plasmid was extracted from the correct colony and the plasmid that was successfully verified by enzyme digestion was sequenced. The successful construction of the knock-in plasmid pJOE8999 was verified by sequencing.

[0246] The sequences of the PJF and PJR primers are:

[0247] PJF:CCCCTATGTTTTCTCCCC

[0248] PJR: CTGGTCTTTATGAAACACGC

[0249] Colony PCR verification system: 50 μL of Taq DNA polymerase, 0.5 μL of template, 4 μL each of PJF and PJR, and sterile water to a final volume of 100 μL.

[0250] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 24 s, extension at 72°C for 18 s, 30 cycles, and post-extension at 70°C for 5 min.

[0251] Specific Example 6 Construction of strain BA03 overexpressing the glms gene.

[0252] The successfully constructed glms knock-in plasmid was transformed into Bacillus subtilis 168, and plated on an LB plate containing 5 μg / mL kanamycin and 0.2% mannose by mass. The cas9 gene was induced under the control of the mannose-inducible promoter P, and cultured in a 30°C incubator until a single colony grew. Then, the grown colonies were spotted with a toothpick on an LB plate without kana and cultured at 37°C; the next day, the colonies were streaked on an LB plate at 42°C to obtain more single colonies. Finally, the colonies were spotted with a toothpick on LB plates containing kana (5 μg / mL) and without kana, and transformants with long colonies on the LB plate and no colonies on the resistance plate were screened. PCR verification was performed using primers glms-F and glms-R, and 1935bp appeared, as shown below. Figure 6 As shown, the glms knock-in strain was successfully constructed. The recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY was transferred into the above glms knock-in strain, coated with 10μg / mL chloramphenicol resistance plates, cultured at 37℃ for 12h, and an appropriate amount of transformants were picked for colony PCR. A 3573bp band appeared, verifying that the recombinant Bacillus subtilis BA03 was successfully constructed. Figure 3 As shown, lane 2 is the positive control of the recombinant plasmid, and lane 4 verifies the BA03 transformant, proving that the recombinant Bacillus subtilis BA03 was successfully constructed.

[0253] The sequences of glms-F and glms-R primers are:

[0254] glms-F:CTACAATGGGGACTTCCC

[0255] glms-R: CATGTAGTGAGGGTACGTG

[0256] Specific Example 7: Production of lactoyl-N-tetraose by shake flask fermentation using recombinant Bacillus BA03.

[0257] The seed liquid cultured overnight was inoculated into a 250mL conical flask containing 50mL fermentation medium at an inoculum size of 2-5%. After culturing at 37°C and a rotation speed of 200r / min for 3.5h, 100μL of isopropyl-β-D-thiogalactoside (1MIPTG) was added to induce the expression of the heterologous gene. Culture was continued for 48h. 2mL of fermentation liquid was taken every 12h to measure the cell density and yield of the bacteria. Each time the fermentation liquid was taken, it was centrifuged at 4°C, 12000r / min, and centrifuged for 10min. The supernatant was taken and kept in a -20°C refrigerator. The cell density of the bacteria is expressed by its absorbance at a wavelength of 600nm. The sample was diluted and the absorbance value of the dilution was controlled between 0.2 and 0.8. The yield of the strain was detected by a high performance liquid chromatograph with a differential refractive index detector (such as Figure 4 According to the test results, it was calculated that the recombinant Bacillus subtilis BA03 produced 3.5 g / L of lacto-N-neotetraose, which was 66.7% higher than that of the recombinant Bacillus subtilis BA01, and exceeded the highest shake flask yield of lacto-N-neotetraose reported so far.

[0258] Preparation of isopropyl-β-D-thiogalactoside (1 M IPTG): Weigh 238.3 g of isopropyl-β-D-thiogalactoside and dissolve it in 1 L. After it is completely dissolved with distilled water, filter it into a sterile 2 mL EP tube using a filter in a clean bench and store it in a refrigerator at -20°C until use.

[0259] Specific Example 8: Production of lactoyl-N-neotetraose by L-tank fed-batch fermentation of recombinant Bacillus BA035.

[0260] Batch fermentation of feed was performed in a 5L bioreactor. A single colony of recombinant Bacillus subtilis was inoculated into LB liquid medium and cultured at 37°C, 200 rpm, for 12 hours. Recombinant strain BA03 was cultured at a 10% inoculum size in a 1L shake flask containing 150mL of LB medium for 8 hours. The resulting seed solution was transferred to a 3L bioreactor. Heterologous gene expression was induced by the addition of 6mL of 1M IPTG. Throughout the culture process, the pH of the fermentation broth was adjusted to 6.8 by the automated addition of NH3·H2O. The culture temperature was maintained at 37°C, the aeration rate was 6 VVM, and the rotational speed was 400 rpm. 80% glucose was fed into the bioreactor at a constant rate of 35 mL / h for 12 h, and 80% glucose was fed into the bioreactor at a constant rate of 15 mL / h for 24 h, and 10-20 g / L lactose was added. After 48 h, the addition of carbon source was stopped, and the fermentation liquid was obtained after 72 h of fermentation.

[0261] Specific Example 9: Detection method of lactoyl-N-neotetraose in fermentation broth.

[0262] During the fermentation process, the fermentation broth was centrifuged, boiled for 5 minutes, and centrifuged again to obtain the supernatant. The fermentation broth was filtered through a 0.22 μm pore size filter membrane into a liquid phase vial. The test solution was filtered twice to obtain the test solution. The content of lactose, lacto-N-triose II, and lacto-N-neotetraose was determined using a high-performance liquid chromatography (HPLC) differential refractive index detector (RID) detector. The chromatographic conditions were: HPLC-RID-UV mode, using a Sugar-D column (250 × 4.6 mm), mobile phase A: 65% acetonitrile, mobile phase B: 35% water, UV 195 nm, flow rate 1 mL / min, sample volume 10 μL, time 15 minutes, column temperature 25°C, RID 30°C–35°C.

[0263] According to the test results, it was calculated that the 5 L fermentation tank of recombinant Bacillus subtilis BA03 produced 9.6 g / L of lacto-N-neotetraose, which has exceeded the highest yield of lacto-N-neotetraose synthesized by Bacillus subtilis fermentation tank reported so far.

[0264] At present, the majority of engineered strains used for the production of lacto-N-neotetraose by microbial fermentation use Escherichia coli. However, Escherichia coli is a non-food safety grade strain, and the endotoxins secreted by it cause the lacto-N-tetraose produced by it to be used in the fields of food, medicine, and the like, which are unsafe. The present invention realizes the production of lacto-N-neotetraose in Bacillus subtilis 168 and increases its yield. The advantage is that its own metabolic pathway contains the synthesis pathways of uridine diphosphate galactose and uridine diphosphate acetylglucosamine, and these two substances can be used as substrates to participate in the synthesis of lacto-N-neotetraose. At the same time, Bacillus subtilis 168 does not secrete endotoxins and has been certified by the U.S. Food and Drug Administration (FDA) as a safe microorganism (Generally Recognized as Safe, GRAS). It can be used as a food safety grade strain to synthesize food safety grade lacto-N-neotetraose through metabolic engineering and fermentation. The present invention carried out fermentation analysis on strain BA01 transformed with a plasmid containing β-1,3-N-acetylglucosaminyltransferase, β-1,4-galactosyltransferase and lactose permease genes, and measured the yield of lacto-N-neotetraose, which was 2.1 g / L. c2up The expression of the glmS gene, encoding glucosamine-6-phosphate synthase, was increased, and the trp terminator was introduced to effectively relieve feedback inhibition of the GlmS ribozyme. Lactoyl-N-neotetraose yield was measured by HPLC-RID-UV, yielding 3.5 g / L in shake flasks, a 66.7% increase compared to lactoyl-N-neotetraose levels. A 5-L fermentor yield of 9.6 g / L was achieved, exceeding the highest reported lactoyl-N-neotetraose yield for Bacillus subtilis.

[0265] The sequences used in the present invention are as follows:

[0266] SEQ ID NO.1 Aα-β-1,4-galT

[0267] ATGAACAGCACAGAAAACAAAAACTTTGTCATTTCAATAAGCACTGCTGAACAACG

[0268] CCGTAATCATATTATTGAACAGTTCACCCATCAAAATATTCCATTTGAATTTTTTGATGCTT

[0269] TTACACCCTCAGATAAATTAACTGACCACTTGCAGCGTTATCTGCCGAATGTTGCAAACG

[0270] CTGCACAGCTGACGATGGGGGAGAAAGGCTGTCTGATGTCTCATTTATGCTTTGGAAG

[0271] AAATGCATAGATGAAAATCTCGACTATATTACACTCTTCGAGGATGATATTTTGCTGGGAG

[0272] AAAACGCGAATAAATTTTTGGCAGAAGGCGATTGGCTTAAAGTGAGGTTCAATTTTCAA

[0273] GAAATTTTCGTTCTCCGACTTGAAACGTTTTTAATGCCGGTTCAGCTTGAGAAGCAAAC

[0274] GCAAATTCCGCCTTTTCAGCAAAGAGACATCGATATCCTAACCAGTAAGCATTTCGGAAC

[0275] AGCCGGTTACGTCATCTCTCAAGGCGCCGCAAATACCTGATAGCTTTGTTTGAAAAGCT

[0276] GACAACAGAAGAAATCAAACCGATTGACGAGATCATGTTTAACCAGCAGATCAATGCCA

[0277] CGGATTATCGCGTGTATCAATTAAATCCTGCGATTTGCGTACAAGAGCTTCAGCTGAATC

[0278] AAGAAGCGTCGCTTCTTGTATCCAATTTAGAGCAGGAGCGGAAGATCAACTTAAAATAT

[0279] GAAAAAAGAAACACTAA

[0280] SEQ ID NO.2 lgtA

[0281] ATGCCGTCAGAAGCATTTAGAAGACATAGAGCATATAGAGAAAATAAACTGCAACC

[0282] GCTGGTTTCAGTTCTGATTTGCGCATATAATGTTGAAAAATTTTTGCACAATCACTGGCA

[0283] GCAGTTGTTAATCAAACATGGAGAAATCTGGATATTCTGATTGTTGATGATGGCTCAACA

[0284] GATGGCACACTGGCAATTGCACAAAGATTTCAAGAACAAGATGGAAGAATTAGAATTCT

[0285] GGCACAACCGAGAAATAGCGGCCTGATTCCGTCACTGAATATTGGCCTGGATGAACTGG

[0286] CAAAAAGCGGCGGAGGCGGCGAATATATTGCAAGAACAGATGCAGATGATATTGCAGCA

[0287] CCGGATTGGATTGAAAAAATTGTTGGCGAAATGGAAAAAGATAGATCAATTATTGCAATG

[0288] GGCGCGTGGCTGGAGGTTCTGTCAGAAGAAAAAGATGGCAATAGACTGGCAAGACATC

[0289] ATGAACATGGCAAAATTTGGAAAAAACCGACAAGACATGAAGATATTGCAGATTTTTTT

[0290] CCGTTTGGCAATCCGATTCATAATAATACAATGATTATGAGAAGATCAGTTATTGATGGCG

[0291] GCCTGAGATATAATACAGAAAGAGATTGGGCAGAAGATTATCAATTTTGGTATGATGTTT

[0292] CAAAACTGGGCAGACTGGCATATTATCCGGAAGCACTGGTTAAATACAGACTGCATGCA

[0293] AATCAAGTTTCAAGCAAATATAGCATTAGACAACATGAAATTGCACAAGGCATTCAAAA

[0294] AACAGCAAGAAATGATTTTCTGCAATCAATGGGCTTTAAAACAAGATTTGATTCACTGG

[0295] AATATAGACAAATTAAAGCAGTTGCATATGAACTGCTGGAAAAACATCTGCCGGAAGAA

[0296] GATTTTGAAAGAGCAAGAAGATTTCTGTATCAATGCTTTAAAAGAACAGATACACTGCC

[0297] GGCGGGCGCATGGCTGGACTTCGCAGCAGACGGCAGAATGAGAAGACTGTTTACACTG

[0298] AGACAATATTTTGGCATTCTGCATAGACTGCTGAAAAATAGATAA

[0299] SEQ ID NO.3lacY

[0300] ATGTATTATCTGAAAAATACAAATTTTTGGATGTTTGGCCTGTTTTTTTTCTTCTATTTT

[0301] TTCATTATGGGCGCATATTTTCCGTTTTTTCCGATTTGGCTGCATGATATTAATCATATTTCA

[0302] AAATCAGATACGGGCATTATTTTTGCAGCAATTTCACTGTTTTCACTGCTGTTTCAACCGC

[0303] TGTTTGGCCTGCTGTCAGATAAACTGGGCCTGAGAAAATATCTGCTGTGGATTATTACGG

[0304] GCATGCTGGTTATGTTTGCACCGTTTTTCATTTTTATTTTTGGCCCGCTGCTGCAATATAAT

[0305] ATTCTGGTTGGCTCAATCGTTGGCGGAATTTATCTGGGCTTTTGCTTTAATGCGGGCGCA

[0306] CCGGCAGTTGAAGCATTTATTGAAAAAGTTTCAAGAAGATCAAATTTTGAATTTGGCAG

[0307] AGCAAGAATGTTTGGCTGCGTTGGCTGGGCACTGTGCGCATCAATTGTTGGAATTATGTT

[0308] TACAATTAATAATCAATTTGTTTTTTGGCTGGGCAGCGGCTGCGCACTGATTCTGGCAGT

[0309] TCTGCTGTTTTTTGCAAAAACAGATGCACCGTCATCAGCAACAGTTGCAAATGCAGTTG

[0310] GCGCAAATCATTCAGCATTTTCACTGAAACTGGCACTGGAACTGTTTAGACAACCGAAA

[0311] CTGTGGTTTCTGTCACTGTATGTTATTGGCGTTTCATGCACATATGATGTTTTTGATCAAC

[0312] AATTTGCAAATTTTTTTACATCATTTTTTGCAACGGGCGAACAAGGCACAAGAGTTTTTG

[0313] GCTATGTTACAACAATGGGCGAACTGCTGAATGCATCAATTATGTTTTTTGCACCGCTGAT

[0314] TATTAATAGAATTGGCGGCAAAAATGCACTGCTTCTGGCGGGCACAATTATGTCAGTTAG

[0315] AATTATTGGCTCATCATTTGCAACATCAGCACTGGAAGTTGTTATTCTGAAAACACTGCAT

[0316] ATGTTTGAAGTTCCGTTTCTGCTGGTTGGCTGCTTTAAATATATTACATCACAATTTGAAG

[0317] TTAGATTTTCAGCAACAATTTATCTGGTTTGCTTTTGCTTTTTTAAACAACTGGCAATGAT

[0318] TTTTATGTCAGTTCTGGCGGGCAATATGTATGAATCAATTGGCTTTCAAGGCGCATATCTG

[0319] GTTCTGGGCCTGGTTGCACTGGGCTTTACACTGATTTCAGTTTTTACACTGAGCGGCCCG

[0320] GGCCCGCTGTCACTGCTGAGAAGACAAGTTAATGAAGTTGCATAA

[0321] SEQ ID NO.4P c2up

[0322] TGAGAATTCCTAACAACTAAATCACGACTATATACCTATACTATTTATTATCATCAATT TGTCGAAAAGGGTAGACAAACTATCGTTTAACATGTTATACTATAATAG

[0323] SEQ ID NO.5 trp terminator

[0324] AGTGGAAAAAAAGCTGCCGTCATTGGCAGCTTTTTTTATATCCT

[0325] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A recombinant Bacillus subtilis for synthesizing lactoyl-N-neotetraose safely, characterized in that: The recombinant Bacillus subtilis is obtained by transforming a plasmid containing β-1,3-N-acetylglucosaminyltransferase, β-1,4-galactosyltransferase and lactose permease genes into Bacillus subtilis 168; Among them, the sequence of the β-1,4-galactosyltransferase gene is SEQ ID NO.1, the sequence of the β-1,3-N-acetylglucosaminyltransferase is SEQ ID NO.2, and the sequence of the lactose permease gene is SEQ ID NO.

3.

2. The recombinant Bacillus subtilis according to claim 1, characterized in that: The plasmid is pHT01; Alternatively, the β-1,3-N-acetylglucosaminyltransferase gene is derived from Neisseria meningitidis, the β-1,4-galactosyltransferase gene is derived from A. actinomycetemcomitans NUM4039, and the lactose permease gene is derived from Escherichia coli.

3. The recombinant Bacillus subtilis according to claim 1 or 2, characterized in that: The recombinant Bacillus subtilis is further prepared by using a strong promoter P to encode glucosamine-6-phosphate synthase in Bacillus subtilis 168. c2up , and the trp terminator was introduced to effectively release the feedback inhibition of the glmS ribozyme, and the plasmid containing β-1,3-N-acetylglucosaminyltransferase, β-1,4-galactosyltransferase and lactose permease genes was transformed.

4. The method for constructing a recombinant Bacillus subtilis according to any one of claims 1 to 3, characterized in that: The steps include: The recombinant plasmid pHT01-Aa-β-1,4-galT-lgt A-lacY was transferred into Bacillus subtilis 168 using the Bacillus subtilis chemical competent cell preparation and transformation method. The plates were coated with 10 μg / mL chloramphenicol resistance and cultured at 37°C for 12 h. The transformants were picked for colony PCR, and a 3573 bp band appeared, verifying that the recombinant Bacillus subtilis was successfully constructed.

5. The construction method according to claim 4, characterized in that: The recombinant plasmid The construction method of pHT01-Aα-β-1,4-galT-lgtA-lacY comprises the following steps: According to the β-1,4-galactosyltransferase gene (BAS48030.1) in A. actinomycetemcomitans NUM4039 published on NCBI, the gene sequence shown in SEQ ID NO.1 was synthesized after optimizing the preferred codons of Bacillus subtilis; Using primers Aα-β-1,4-galT-F and Aα-β-1,4-galT-R, the Aα-β-1,4-galT fragment was amplified with the synthesized β-1,4-galactosyltransferase gene of SEQ ID NO.1 as a template, and the sequence fragment of the gene Aα-β-1,4-galT was cloned into the vector pHT01 to construct the plasmid pHT01-Aα-β-1,4-galT; According to the β-1,3-N-acetylglucosaminyltransferase gene (Gene ID: 904226) in Neisseria meningitidis MC58 published on NCBI, the gene sequence shown in SEQ ID NO.2 was synthesized after optimizing the codons preferred by Bacillus subtilis; Using primers lgtA-F and lgtA-R, the lgtA fragment was amplified with the synthesized gene sequence of SEQ ID NO.2 as a template, and the sequence fragment of the gene lgtA was cloned into the vector pHT01-Aα-β-1,4-galT to construct the plasmid pHT01-Aα-β-1,4-galT-lgtA; According to the lactose permease gene (Gene ID: 949083) in Escherichia coli K12 published on NCBI, after optimizing the codons preferred by Bacillus subtilis, the gene sequence shown in SEQ ID NO.3 was synthesized; Primers lacY-F and lacY-R were used to amplify the lacY fragment with the synthetic gene sequence of SEQ ID NO.3 as a template, and the sequence fragment of the gene lacY was cloned into the vector pHT01-Aα-β-1,4-galT-lgtA to construct the plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY.

6. Use of the recombinant Bacillus subtilis according to any one of claims 1 to 3 in the synthesis of lactoyl-N-neotetraose.

7. A method for producing lactoyl-N-neotetraose by fermentation using the recombinant Bacillus subtilis according to any one of claims 1 to 3, characterized in that: The steps include: Pick out a single colony of the recombinant Bacillus subtilis and inoculate it into LB liquid medium at 37°C and 200 r / min for 12 h. The bacterial liquid was inoculated into the fermentation medium at an inoculation rate of 2-5%, cultured at 37°C and a rotation speed of 200 r / min for 48 hours, and the yield of lactoyl-N-neotetraose was detected, and the yield was 2.1 g / L.

8. The method for constructing a recombinant Bacillus subtilis according to any one of claims 1 to 3, characterized in that: The steps include: Using CRISPR-Cas9 technology, the synthetic sequence of SEQ ID NO.4 strong promoter P was seamlessly knocked in front of the glms site. c2up and the sequence is SEQ ID NO.5trp terminator; The upper and lower homology arms were amplified using primers glms-UP-F, glms-UP-R, glms-DN-F, and glms-DN-R with Bacillus subtilis 168 as template, and P c2up -F, P c2up -R primers amplified the strong promoter P c2up fragment, the upper and lower homology arms, strong promoter P c2up The sequence fragments of the fragments were cloned into the vector pJOE8999 to construct the knock-in plasmid pJOE8999; The successfully constructed glms knock-in plasmid was transformed into Bacillus subtilis 168, and plated on an LB plate containing 5 μg / mL kanamycin and 0.2% mannose by mass. The cas9 gene was induced under the control of the mannose-inducible promoter P, and cultured in a 30°C incubator until a single colony grew. Then, the grown colony was spotted with a toothpick on an LB plate without kana and cultured at 37°C. The next day, the colony was streaked on an LB plate at 42°C to obtain more single colonies. Finally, the colony was spotted with a toothpick on an LB plate containing 5 μg / mL kana and LB plates without kana, and screened out transformants that grew colonies on LB plates but not on resistance plates; used primers glms-F and glms-R for PCR verification, and 1935bp appeared, indicating that the glms knock-in strain was successfully constructed; the recombinant plasmid pHT01-Aα-β-1,4-galT-lgtA-lacY was transferred into the above-mentioned glms knock-in strain, coated on 10μg / mL chloramphenicol resistance plates, cultured at 37℃ for 12h, picked and transformed for colony PCR, and a 3573bp band appeared, verifying that the recombinant Bacillus subtilis BA03 was successfully constructed.

9. Use of the recombinant Bacillus subtilis as claimed in claim 8 in the synthesis of lactoyl-N-neotetraose.

10. A method for producing lactoyl-N-neotetraose by fermentation using the recombinant Bacillus subtilis as claimed in claim 8, characterized in that: The steps include: A single colony of the recombinant Bacillus subtilis BA03 was picked and inoculated into LB liquid medium at 37°C and 200 r / min for 12 h. The bacterial liquid was inoculated into the fermentation medium at an inoculum of 2-5%, cultured at 37°C, 200 r / min, for 48 h, and lactoyl-N-neotetraose was detected, the yield of which was 3.5 g / L; Alternatively, the steps include: In each 5L bioreactor, feed batch fermentation was carried out, and a single colony of recombinant Bacillus subtilis BA03 was picked and inoculated into LB liquid culture medium, and cultured at 37°C, 200r / min, for 12h; the recombinant strain BA03 was cultured in a 1L shake flask containing 150mL LB culture medium at a 10% inoculation rate for 8h, and the seed liquid was transferred to a bioreactor with a working volume of 3L; 6mL of isopropyl-β-D-thiogalactopyranoside (1M IPTG was used to induce the expression of heterologous genes; during the entire culture process, the pH value of the fermentation liquid was adjusted to 6.8 by automatically adding 28% (v / v, volume percentage) NH40H, the culture temperature was 37°C, the ventilation rate was 6VVM, and the rotation speed was 400rpm; 80% glucose was flowed into the bioreactor at a constant rate of 35mL / h for 12h, and 80% glucose was flowed into the bioreactor at a constant rate of 15mL / h for 24h, and 10-20g / L lactose was added, and the addition of carbon source was stopped after 48h, and the fermentation liquid was obtained after fermentation for 72h; Among them, the preparation of isopropyl-β-D-thiogalactoside (1M IPTG) is as follows: weigh 238.3g of isopropyl-β-D-thiogalactoside, dissolve it into 1L, and after it is completely dissolved with distilled water, filter it into a sterile 2mL EP tube with a filter on a clean bench, and store it in a -20℃ refrigerator for later use.

Images