Application of FaHMGR gene in regulation and control of strawberry coloring and aroma or in strawberry breeding

Abstract

The invention relates to the technical field of gene engineering, in particular to application of a FaHMGR gene in regulation and control of strawberry coloring and fragrance or in strawberry breeding. The strawberry HMGR gene is cloned, the expression condition of the strawberry HMGR gene in different tissues and development stages is researched, the influence of FaHMGR on strawberry fruit quality formation is researched through transient expression in combination with transcriptome and metabolome analysis, and the result shows that the HMGR influences the coloring and aroma of strawberry fruits and has important influence on the strawberry quality.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to application of the FaHMGR gene in regulating strawberry coloring and aroma or in strawberry breeding. Background Art

[0002] As the most abundant class of compounds in plant secondary metabolites, terpenoids play an important role in plant growth and development, adaptation to the environment, and fruit quality formation. Strawberry is by far the most popular berry crop in the world, and is valued for its unique flavor and nutritional components. Research on terpenoids in strawberries focuses on aroma research. Terpenoids are important components of volatiles. Nine sesquiterpenes and three triterpenes were found in Falandi strawberries. Although volatile compounds (VOCs) only account for 0.001%-0.01% of the weight of strawberries, they are key elements of strawberry flavor, and small changes can greatly change the flavor. Linalool and nerol are the main aroma components in strawberries. In addition, menthol, α-pinene, β-myrcene, α-terpineol, and β-phellandrene are present in different varieties and development stages of the fruit. There are significant differences in the production of linalool and nerol between wild strawberries and cultivated strawberries. The terpene synthase gene FaNES1 is specifically and highly expressed in cultivated strawberry fruits, converting cytoplasmic geranyl diphosphate (GPP) and farnesyl diphosphate (FPP) into linalool and nerol. Some scholars have used multi-omics to reveal grape flavor genes and their regulatory elements. The results show that the distal region of strawberry Chr 3C is related to a variety of terpenes, and FaNES1 is significantly correlated with the content of linalool, β-myrcene, α-pinenol, (E)-β-farnesene and nerol.

[0003] On the other hand, the focus is on the disease resistance mechanism. Terpenes are one of the three most important metabolites involved in strawberry defense. Linalool and myrtenol in strawberry leaves can effectively inhibit the spore germination and mycelial growth of strawberry Mycosphaeria, and prevent and treat strawberry snake eye disease. Research by some scholars has also confirmed that strawberry leaves produce monoterpenes under the induction of UV-C, which interact synchronously with ABA to resist pathogens. Pinene-4-ol improves the disease resistance of strawberry to gray mold and soft rot by activating the phenylpropanoid metabolic pathway in the fruit. In addition, the accumulation of triterpenoid metabolites causes differences in resistance of different varieties to nanoplastic exposure. In wild strawberry species, there may be a connection between rapidly induced terpenoid metabolism and autoimmunity for potential anthracnose resistance.

[0004] Terpenoids are synthesized in plants mainly through two pathways, the MVA pathway in the cytoplasm and the 2-methylerythritol-4-phosphate pathway (MEP pathway) in the plastid. 3-hydroxy-3-methylglutaryl CoAreductase (HMGR) is the first rate-limiting enzyme in the terpenoid MVA biosynthesis pathway and plays a key role in the biosynthesis of cytoplasmic terpenoids. HMGR is responsible for regulating the production of different terpenoids in almost all plants and occupies a central regulatory position in plants containing terpenoids. HMGR is positively correlated with terpenoid production. Studies have shown that the amplification of HMGR and TPS genes leads to the enrichment of terpenes in roses. HMGR can not only regulate the content of beneficial terpenoids such as sterols, rubber and resin, saponins, and improve the adaptability to adverse environments, but also directly affect the synthesis of sesquiterpenoid and triterpenoid aromas and accelerate the accumulation of carotenoids in Escherichia coli. However, there are limited studies on its association with quality traits such as fruit aroma and color, and it has never been reported in strawberry. Studying the effects of HMGR on quality traits is of great significance to fruit development and ripening. Summary of the invention

[0005] The purpose of the present invention is to provide the application of the FaHMGR gene in regulating strawberry coloring and aroma or in strawberry breeding. The present invention cloned the HMGR gene of strawberry, studied its expression in different tissues and developmental stages, and studied the effect of FaHMGR on the formation of strawberry fruit quality through transient expression.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides application of the FaHMGR gene in regulating strawberry coloring and aroma or in strawberry breeding.

[0008] Preferably, the nucleotide sequence of the FaHMGR gene is as shown in SEQ ID NO:1.

[0009] The present invention also provides an expression vector, comprising an initial vector and the FaHMGR gene.

[0010] Preferably, the initial vector is pCAMBIA1302.

[0011] The present invention also provides a host transformed or transfected with the expression vector; the host is a microorganism.

[0012] The present invention also provides the application of the FaHMGR gene, the expression vector or the host in regulating the coloring and aroma of strawberries or in strawberry breeding.

[0013] The present invention also provides a silencing vector, comprising an original vector and the FaHMGR gene; the nucleotide sequence of the FaHMGR gene is shown in SEQ ID NO:2.

[0014] The present invention also provides a silent recombinant bacterium transformed or transfected with the silent vector.

[0015] The present invention also provides the use of the silencing vector or the silencing recombinant bacteria in regulating strawberry coloring and aroma or in strawberry breeding.

[0016] The raw transcriptome data have been uploaded to the SRA database in NCBI, with the accession number: PRJNA781262.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] HMGR is a key enzyme in the biosynthesis of plant terpenoids and is of great significance to fruit development and quality trait formation. The present invention cloned the HMGR gene of strawberry and studied its expression and its effect on the formation of strawberry fruit quality. The results showed that the expression level of FaHMGR in the fruit was significantly higher than that in other tissues, especially in the fruit during the color change period. The fruit with FaHMGR inhibition promoted strawberry coloring, and the anthocyanin content was 3.33 mg / g higher than the control, and 5 new anthocyanin components such as pelargonidin-3-glucoside appeared. At the same time, the ABA content increased, the expression of MEP pathway genes was upregulated, the aroma increased, especially the increase in terpene species, while the linalool content decreased. The coloring of strawberry fruits with overexpression of FaHMGR was inhibited, the expression of most anthocyanin pathway genes was inhibited, and the content of methyl caproate and linalool also decreased. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 FaHMGR gene expression and hormone levels in different tissues and fruits at different developmental stages.

[0020] Figure 2 (A) Fruit development under transient expression of FaHMGR in strawberry. The pie chart represents the content of chlorophyll and anthocyanin in strawberry (green is chlorophyll; red is anthocyanin).

[0021] Figure 3 Figure 2 shows the anthocyanin composition of strawberry with overexpression and suppression of FaHMGR expression. The data in the table represent peak areas.

[0022] Figure 4 To investigate the effects of overexpression and inhibition of FaHMGR expression on hormone levels.

[0023] Figure 5This is the detection diagram of the aroma components of strawberry fruit by the control group CK. The red arrow indicates linalool, which is reduced after FaHMGR overexpression and inhibition of expression, and the green arrow indicates that the main aroma component methyl hexanoate is also reduced (the same below).

[0024] Figure 6 Effect of FaHMGR overexpression on aroma components of strawberry fruit.

[0025] Figure 7 Effect of suppressed expression of FaHMGR on aroma components of strawberry fruit.

[0026] Figure 8 Effects of transient expression of FaHMGR on gene expression levels of anthocyanin and aroma metabolic pathways.

[0027] Fig. 9 For the vector map. DETAILED DESCRIPTION

[0028] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0029] Example 1

[0030] 1. Test materials

[0031] The experiment was conducted at the Yangdu Experimental Vineyard of Zhejiang Academy of Agricultural Sciences (E 12024′, N 3026′). Red-faced strawberry plants were used as experimental materials. Young roots, stems, leaves, petals, pistils and fruits at different developmental stages were collected, immediately frozen in liquid nitrogen, and stored at 80°C to determine the tissue expression of the HMGR gene.

[0032] 2. Hormone content detection

[0033] Enzyme-linked immunosorbent assay (ELISA) was used to determine the content of auxin indole-3-acetic acid (IAA), abscisic acid (ABA), gibberellin (GA3), zeatin riboside (ZR) and BR hormones according to Wang's method (Wang, YJ JoEB Mechanism of phytohormone involvement in feedback regulation of cotton leaf senescenceinduced by potassium deficiency. 63, p. 5887-5901 (2012).). Extraction of hormones in samples: 0.5 g of pulp was taken, 2 ml of sample extract (80% methanol, containing 1 mmol L-1 BHT) was added, and ground in an ice bath. The mortar was cleaned twice, and the mixture was transferred to a 10 ml test tube and shaken well. The mixture was placed in a refrigerator at 4°C for 4 hours, centrifuged at 3500 rpm for 8 minutes, and the supernatant was taken. The sample after column was extracted with C-18 solid phase extraction, and the sample was transferred to a 10 ml centrifuge tube. After freeze-drying, the volume was fixed to 2 ml.

[0034] Results: From Figure 1 -A shows that FaHMGR has a strong tissue expression specificity. The expression levels in different tissues are as follows: fruit, root system, flower, stem, pistil, and leaf. The expression level of FaHMGR in fruit is significantly higher than that in other tissues. Figure 1 -B shows that the expression level of FaHMGR gradually decreases during the fruit expansion period (fruit1-fruit3), and increases during the fruit whitening period (fruit4-fruit6), reaching the highest level at fruit7 when the fruit begins to turn red. The expression level then slowly decreases, reaching the lowest level at the maturity period (fruit10).

[0035] By detecting the contents of six hormones in different tissues and at different developmental stages of fruits, the contents of IAA and ABA were significantly higher than the other four, followed by JA-ME, and BR was the lowest in all tissues and developmental stages. The contents of several hormones were low in the roots, which was the opposite of the expression of the HMGR gene. At the beginning of fruit coloring (fruit7), the contents of GA3, ABA, ZR, JAME and BR increased to varying degrees, and then decreased during the coloring process (fruit8).

[0036] 3. RNA extraction, cDNA synthesis, qRT-PCR

[0037] The total RNA of strawberry was extracted using the FastPure Plant Total RNA Isolation Kit (Vazyme, China). cDNA was synthesized using 1st Strand c DNA Synthesis Super Mix (Yixian, Shanghai, China).

[0038] The quantitative PCR reaction system included 5 μL SYBR Premix Ex Taq TM , 0.3 μL primer (10 μM), 2 μL cDNA and 2.4 μL RNase-free water, the total volume was 10 μL. The PCR reaction conditions were: 95°C for 30 s, 95°C for 5 s (35 cycles), and 58°C for 35 s. The strawberry ACTIN gene was used as the internal reference gene, and 2– △Ct method.

[0039] Results: The specific gene sequence is as follows:

[0040] FaHMGR (as shown in SEQ ID NO: 1):

[0041] ATGGACTCTCGCCGTCGGTCCCCCAAACCGCCTCGCCCGACGGCCGTTAACGCTGG

[0042] GACCCACCCTCGAAATGACAAAGCGTCGTCTTCTTCATCAGGAGGAGAAGGACGC

[0043] GGTGGTGGAGCGAAAGCGTCCGACGCGCTGCCGCTGCCTTTTGTATCTGACGAACGC

[0044] CGTGTTCTTTACTCTCTTCTCTCCGTGGCGTACTACCTCCTCCACCGCTGGCGCGAC

[0045] AAGATCCGAACCTCCACGCCGCTCCACGTCGTCAACCTCTCCGAGCTCGCCGCCAT

[0046] TTCCTCCCTCCATCGCCTCCTTCCTACCTCCTCGGCTTCTTCGGCATCGACTTCGTC

[0047] CAGTCCTTCATCTCACGCGCCTCCCACTACGACGACGCCTGGGACGACGACGATGC

[0048] CGACGACGACGTCATCGTTCCGGCGAAATTCGTCGACGCAGACCCGGCATTGTGCT

[0049] CCGAGGAGGACGAGGAGATCATCCAGGCCGTTCTAAACGGCGACGTTCCGTCCTAC

[0050] TCGCTAGAATCGAAGCTCGGCGACTGCAAGAGAGCGGCGGTGATCCGGCGCGAGT

[0051] GGCTCCAGAGAACGACCGGGAGGTCGCTGCAGGGTTTGCCTCTGGAAGGATTCGA

[0052] TTACGGCTCGATTCTAGGGCAGTGCTGCGAGTCGCCGGTCGGATACGTGCAGATTCC

[0053] GGTGGGAATCGCCGGGCCGTTGTTGCTCGACGGGTTCGAGTACATGGTGCCAATGG

[0054] CGACGACGGAGGGGTGCCTTGTGGCGAGCATGAACAGAGGTTGCAAGGCTATTCTC

[0055] CTCTCCGGTGGGGCTGACTCCCGGGTTTATAGGGACGGCATGACCAGAGCTCCGGT

[0056] GGTCAAGTTTGCCTCTGCCGTCAGAGCTTGCGATCTCTTATGCTACTTGGAGAACCG

[0057] TGCCAATTTTGATACTCTCGCCGTCGTTTTCAATAGATCAAGTCGATTTGCGAGGCTA

[0058] CAGAGCATATTTCCTTCTCTTTCTGGGATGACGCTCCACGTAAGATTTAATTGCACCA

[0059] CAGGTGATGCCATGGGGATGAATATGGTCTCCAAAGGGGTTCAGAATGTCCTTGATT

[0060] ATCTGCAAAACGACTTTCCTGATATGGAGGTTATCGGCATATCTGGAAATTTTTGTTC

[0061] GGACAAGAAATCTGCAGCTGTAAACTGGATTCTAGGACGTGGCAAATCAGTTGTTT

[0062] GCGAAGCAGTTATCAAGGAAGAGGTGATCAAAGAAGTGTTGAAAACGAACGTGTC

[0063] TAAGCTGGTACAACTCCAGCAGAATAAGATCTTTGTAGGTACTGCCATGGCCGGAAC

[0064] TGTGGGTGGGTATAATGCCCATGCCAGCAACATTGTATCTGCAATATTTATAGCCACC

[0065] GGCCAAGATCCTGCACAGAATGTTGAGAGTTCTCACTGTCTAACGAATATTGTATCC

[0066] ATCAATGACGGGAAGGACATTCATGCTTCCATCACAATGCCTTGTATCGAGGTTGGT

[0067] ACAATTGGTGGTGGGACTCAACTTGCATCTCAATCTGCTTGCTTGAATATGCTTGGC

[0068] GTAAAAGGTGCAAGCCAAGGGTCCCCTGGATCAAACTCGAGGAGGTTGGCCACCA

[0069] TTATAGCCGGTTCAGTACTGGCCGGAGAACTCAGCCTCCTATCCGCCATGGCTGCTG

[0070] GTGATATGGTCAAGAGTCACATGAAATACAACAGATCCAGCAAAGATATTTCTAATG

[0071] CTGCATCT

[0072] The restriction enzyme sites are: BglII (AGATCT) - SpeI (ACTAGT)

[0073] The primers adding protective bases for the restriction enzyme sites are:

[0074] GAAGATCTATGGACTCTCGCCGTCGGTCCCC

[0075] GGACTAGTAGATGCAGCATTAGAAATATCTT;

[0076] As shown in SEQ ID NO: 3 and 4.

[0077] FaHMGRi (as shown in SEQ ID NO: 2):

[0078] AGATCTCCGTAATCGAATCCTTCCAGAGGCAAACCCTGCAGCGACCTCCCGGTCGT

[0079] TCTCTGGAGCCACTCGCGCCGGATCACCGCCGCTCTCTTGCAGTCGCCGAGCTTCG

[0080] ATTCTAGCGAGTAGGACGGAACGTCGCCGTTTAGAACGGCCTGGATGATCTCCTCGT

[0081] CCTCCTCGGAGCACAATGCCGGGTCTGCGTCGACGAATTTCGCCGGAACGATGACG

[0082] TCGTCGTCGGCATCGTCGTCGTCCCAGGCGTCGTCGTAGTGGGAGGCGCGTGAGAT

[0083] GAAGGACTGGACGAAGTCGATGCCGAAGAAGCCGAGGAGGTAGATGAAGGAGGC

[0084] GATGAGGGAGAGAATGGCGGCGAGCTCGGAGAGGTTGACGACGTGGAGCGGCGT

[0085] GGAGGTTCGGATCTTGTCGCGCCAGCGGTGGAGGAGGTAGTACGCCACGGAGAAG

[0086] AAGAGAGTAAAGAACACGGCGTTCGTCAGATACAAAGGCAGCGGCAGCGCGTCGG

[0087] ACGCTTTCGCTCCACCACCGCGTCCTTCTCCTCCTGATGAAGAAGACGACGCTTTGT

[0088] CATTTCGAGGGTGGGTCCCAGCGTTAACGGCCGTCGGGCGAGGCGGTTTGGGGGA

[0089] CCGACGGCGAGAGTCCATCGGCATCGACTTCGTCCAGTCCTTCATCTCACGCGCCTC

[0090] CCACTACGACGACGCCTGGGACGACGACGATGCCGACGACGACGTCATCGTTCCGG

[0091] CGAAATTCGTCGACGCAGACCCGGCATTGTGCTCCGAGGAGGACGAGGAGATCATC

[0092] CAGGCCGTTCTAAACGGCGACGTTCCGTCCTACTCGCTAGAATCGAAGCTCGGCGA

[0093] CTGCAAGAGAGCGGCGGTGATCCGGCGCGAGTGGCTCCAGAGAACGACCGGGAG

[0094] GTCGCTGCAGGGTTTGCCTCTGGAAGGATTCGATTACGGACTAGT

[0095] Restriction site: BglII (AGATCT)-SpeI (ACTAGT)

[0096] The primers for adding restriction site protection bases are:

[0097] GAAGATCTAGATCTCCGTAATCGAATCCTTC

[0098] GGACTAGTACTAGTCCGTAATCGAATCCTTC;

[0099] As shown in SEQ ID NOs: 5 and 6.

[0100] 4. Transient expression levels of FaHMGR and FaHMGRi in strawberry

[0101] The full-length coding sequences of FaHMGR and FaHMGRi were cloned from the cDNA of Fragaria rubra. The cloned sequences were then transferred to the pCAMBIA1302 vector (abbreviated as p35S) to generate plasmids p35S-FaHMGR-GFP and p35S-FaHMGRi-GFP;

[0102] The constructed expression vector was transformed into Agrobacterium: (1) 10 μL of plasmid was added to 100 μL of EHA105 competent Agrobacterium and the pipette tip was used to pipette evenly; (2) Ice bath for 30 min, and quickly placed in liquid nitrogen for quick freezing for 3 min; (3) After quick freezing, heat shock was performed in a 37°C water bath for 2 min; (4) 800 μL of LB liquid culture medium without any resistance was added; (5) Shake and culture on a shaker at 150 rpm for 4-6 h; (6) Centrifuge at 5000 rpm for 5 min, leave 100 μL of liquid to resuspend the precipitate, and then plate it on LB culture medium containing 50 mg / L rifampicin (Rif) and 50 mg / L kanamycin (Km). After transformation, a single colony was picked for detection; (7) A single colony was picked and shaken in LB liquid culture medium (50 mg / L Rif, 50 mg / L Km), and then PCR identification was performed (the same reaction system and procedure as step 3).

[0103] Primers for clonal bacterial detection:

[0104] F:GAGGAGGTAGATGAAGGAGG;

[0105] R:ACTCTCGCCGTCGGTCCCCC;

[0106] As shown in SEQ ID NOs: 7 and 8.

[0107] The constructed plasmid vector was transferred to Agrobacterium EHA105 and then used to infect strawberries in the green fruit stage. The empty vector pCAMBIA-1302 was used as a control. The specific steps are as follows: (1) The Agrobacterium plate into which the vector was transferred was streaked and activated. After culturing at 28°C for 2 days, a single colony was picked. After a positive PCR test, LB medium was added and shaken at 28°C for 2 days. The OD was measured. 600 The pH value was about 0.8; (2) centrifuged at 5000 rpm for 8 min, discarded the supernatant, added sterile water to resuspend the bacteria, centrifuged again, discarded the supernatant, and repeated three times; (3) prepared an injection buffer containing 100 mM MgCl2, 100 mM 2-morpholineethanesulfonic acid (MES), and 150 mM acetosyringone (AS); (4) resuspended the bacteria in the injection buffer and allowed to stand at 28°C for 3 h; (5) selected large green fruit strawberries with consistent growth, and injected the bacterial solution into the strawberries from the top of the strawberries using a 1 mL syringe with the needle removed, trying to make the bacterial solution infiltrate the entire fruit; (6) the injected strawberries were cultured in the dark at 25°C for 12 h, and then transferred to a photoperiod of 16 h light / 8 h dark.

[0108] The gene-specific primers listed in Table 1 were then used to detect anthocyanin content, aroma components, and expression levels of related genes (same reaction system and procedure as step 3).

[0109] Table 1 Primer list

[0110]

[0111]

[0112] As shown in SEQ ID NOs: 9-66.

[0113] 5. Determination of anthocyanin and chlorophyll content, and identification of anthocyanin components

[0114] The content of anthocyanins, chlorophyll and carotenoids in Benihope strawberry was determined by spectrophotometry. The anthocyanin components were determined by liquid chromatography-mass spectrometry (μLC-MS). The total anthocyanins were extracted by methanol-HCl method. The sample (0.1 g) was soaked in 5 mL of methanol containing 0.1% (v / v) HCl and incubated overnight at room temperature in the dark. The content of anthocyanins in the sample was determined by pH differential method. The absorbance of the sample extract at 520 and 700 nm was measured using a UV-2550 spectrophotometer (Shimadzu). The content of each component was determined by peak area.

[0115] 6. Determination of aroma components

[0116] The aroma components of strawberry fruits transiently expressed were determined by gas chromatography-mass spectrometry (GC-MS). According to the method of Zheng et al. (Zheng, T., Lv, JH, Sadeghnezhad, E., Cheng, JH, & Jia, HF Transcriptomic and metabolic profiling of strawberry during postharvest cooling and heat storage. Frontiers in Plant Science. 13, (2022)), the sample (3 g) was ground and transferred to a headspace injection vial (20 mL). 3 ml of saturated NaCl solution was added to the sample, and 2 μL of 3-nonanone was added as an internal standard. The samples were analyzed using a gas chromatograph (TRACE 1310, Thermo Scientific) coupled to a triple quadrupole mass spectrometer (TSQ 9000, Thermo Scientific). The column temperature was programmed as follows: the initial temperature was set to 50 °C and maintained for 6 min; then it was increased to 250 °C at 6 °C / min and maintained for 3 min. MS conditions: EI mode: voltage: 70 eV; ion source temperature: 230 °C; scan rate: 2.88 scans S1; mass spectrometry detection range: 29-540 m z -1 ; Carrier gas, helium; Flow rate, 1.0 mL / min.

[0117] 7. Data Statistical Analysis

[0118] All data (at least 3 replicates, N = 3) are presented as mean values ​​with standard errors (SEMs). The mean SEM values ​​for each treatment were calculated using Microsoft Excel. Analysis of variance (ANOVA) was performed using SPSS 17.0 software, Duncan multiple range test, P < 0.05. Figures were generated using OriginPro 9.

[0119] result:

[0120] (1) Effects of transient expression of FaHMGR on coloration and aroma of strawberry

[0121] from Figures 2 to 4 It can be seen that HMGR overexpressed strawberries inhibited coloring and had the lowest anthocyanin content. Inhibited expression strawberries promoted coloring, and the anthocyanin content was 3.33 mg / g higher than the control. Through the analysis of anthocyanin components, it was found that Cyanidin 3-O-(6”-malonyl-3”-glucosyl-glucoside), Cyanidin 3-O-glucoside, Cyanidin3-O-rutinoside, Cyanidin 3-O-sophoroside, and Delphinidin 3-O-rutinoside appeared in FaHMGRi-expressing strawberries, while these components were not found in the control and FaHMGR-expressing strawberries. In addition to the newly appeared components, the content of other components in FaHMGRi far exceeded that of the control and FaHMGR-expressing strawberries. However, cyanidin 3-O-(6"p-acylglucoside) appeared in the strawberries expressing FaHMGR, but not in the control and FaHMGRi. The ABA content in the strawberries expressing FaHMGRi was significantly higher than that in the strawberries overexpressing FaHMGR and the control, and the BR, ZR and GA3 contents in the strawberries overexpressing FaHMGR were significantly higher than those in the strawberries expressing FaHMGRi.

[0122] from Figures 5 to 7It can be seen that the type and content of aroma determine the flavor and variety typicality of the fruit. In this study, 93, 84, and 120 substances were detected in strawberries expressed by CK, FaHMGR, and FaHMGRi, respectively, including esters, ketones, aldehydes, alcohols, terpenes, and a small amount of furans, phenols, and acids. Among them, esters are the main aroma components of strawberries, especially methyl hexanoate, which is 18.96% in the control and decreased in strawberries expressed by FaHMGR and FaHMGRi. Another main component, 2-Hexen-1-ol, acetate, decreased in strawberries expressed by FaHMGRi, but basically did not change in strawberries expressed by FaHMGR. HMGR is a gene for the terpene metabolic pathway, and the monoterpene linalool is the main terpene aroma substance in strawberries. The content of linalool in CK is 0.62%, and it has decreased in strawberries expressed by FaHMGR and FaHMGRi, to 0.13% and 0.37%, respectively. At the same time, we also detected other terpenes in strawberries expressing CK and FaHMGRi, including limonene (0.16%) in CK, and α-pinene (0.03%), β-pinene (0.05%), terpineol (0.01%), and caryophyllene (0.01%) in FaHMGRi.

[0123] from Figure 8 It can be seen that the expression levels of anthocyanin and aroma formation-related genes in strawberries expressed by CK, FaHMGR, and FaHMGRi were detected. The results showed that the expression levels of anthocyanin pathway genes FaC4H, FaCHI, FaCHS, FaF3H, FaANS, FaUFGT, FaMYB10, FabHLH143, FaWD40, and FaPAL2 were the lowest in strawberry fruits expressed by FaHMGR, which means that the expression of FaHMGR inhibited the expression of most anthocyanin pathway genes, and the expression levels of Fa4CL, Fa4CL2, and FaDFR increased in strawberry fruits expressed by FaHMGR. In strawberries expressed by FaHMGRi, the expression levels of FaC4H, FaCHS, FaANS, FaUFGT, FaMYB10, FabHLH143, FaWD40, and FaPAL2 were higher than those expressed by CK and FaHMGR.

[0124] Among the genes related to aroma synthesis, FaCNL, FaPIN, and FaNCED3 were expressed at the highest levels in strawberry fruits expressing FaHMGR, while FaDAHPS1, FaDAHPS2, FaNES1, FaOMT, FaCHP1, FaAAT, FaQR, and FaNCED1 were expressed at the lowest levels in strawberry fruits expressing FaHMGR. After inhibiting the expression of FaHMGR, the expression levels of FaNES1, FaOMT, FaCHP1, FaAAT, FaQR, and FaNCED1 increased significantly.

[0125] (2) The expression level of HMGR affects strawberry fruit quality

[0126] There are few studies on the effects of HMGR on fruit quality changes related to terpenoids. The effects of HMGR on fruit quality mainly involve coloring and aroma. The MVA pathway is not absolutely separate from the MEP pathway, because unknown transporters exchange across the plasma membrane, establishing the so-called "metabolic crosstalk". HMGR regulates color formation by affecting the MEP pathway and the synthesis of anthocyanins. HMGR can encode functional proteins that accelerate the biosynthesis of carotenoids. Some scholars have also found that the expression level of VvHMGRs in yellow varieties is generally higher than that in red varieties. HMGR can positively regulate the metabolism of terpenoids, thereby affecting hormone synthesis and indirectly regulating the accumulation of anthocyanins; the truncated form of HMGR (tHMG) can cause a 37-fold increase in endogenous sesquiterpenoid levels and a 100-fold increase in phytoene levels. HMGR may also affect the synthesis of anthocyanins by interacting with PIF3 and being negatively regulated by phyB and HY5.

[0127] In the present invention, the coloring of strawberry fruits with overexpression of HMGR was inhibited, the expression of most anthocyanin pathway genes was inhibited, and the fruit with suppressed expression of HMGR promoted the coloring of strawberries, and the anthocyanin content was 3.33 mg / g higher than that of the control.

[0128] Strawberry aroma is beneficial to the quality of fruits and their derived foods and the health of consumers. Strawberry aroma is one of the most complex and richest fruit aromas, and more than 350 volatile compounds have been identified (Oh Y2021). Strawberries release a wealth of aroma substances, mainly including esters, terpenes, alkanes, alcohols, acids, aldehydes and ketones. Among them, terpenes are the main source of floral aroma (Peng 2019). The terpenes related to strawberry aroma mainly include monoterpenes (C10), sesquiterpenes (C15), triterpenes (C30), etc., and all those detected in this study are monoterpenes. The most types of terpenes, especially monoterpenes, were detected in strawberries expressing FaHMGRi, indicating that the expression of the HMGR gene was inhibited to promote the expression of the monoterpene synthesis pathway MEP. Studies in grapes have shown that the expression of HMGR is positively correlated with the accumulation of monoterpenes and the aroma intensity of rose-scented grapes, which may be related to species differences.

[0129] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of FaHMGR gene in regulating strawberry coloring and aroma or in strawberry breeding.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the FaHMGR gene is shown in SEQ ID NO:

1.

3. An expression vector, characterized in that: It comprises an initial vector and the FaHMGR gene as claimed in claim 1 or 2.

4. The expression vector according to claim 3, characterized in that The original vector was pCAMBIA1302.

5. A host, characterized in that The host is transformed or transfected with the expression vector according to claim 3 or 4; the host is a microorganism.

6. Use of the expression vector according to claim 3 or 4 or the host according to claim 5 in regulating strawberry coloring, aroma or in strawberry breeding.

7. A silencing vector, characterized in that: It comprises an original vector and the FaHMGR gene according to claim 1; the nucleotide sequence of the FaHMGR gene is shown in SEQ ID NO:

2.

8. A silent recombinant bacterium transformed or transfected with the silencing vector according to claim 6.

9. Use of the silencing vector according to claim 7 or the silencing recombinant bacteria according to claim 8 in regulating strawberry coloring and aroma or in strawberry breeding.

Images