PSR primer, kit and detection method for identifying bacillus subtilis based on specific gene target

Abstract

The invention discloses a PSR primer for identifying bacillus subtilis based on a specific gene target, a kit and a detection method. The specific detection target is obtained through comparative genomics and bioinformatics mining, is selected from a yhjO gene, and has the characteristics of high precision and strong specificity at the same time. A specific primer is designed for a newly excavated specific detection target yhjO gene of the bacillus subtilis, a PSR detection method of the bacillus subtilis is established, and the detection method has the advantages of being high in sensitivity, good in specificity, high in reaction speed, low in cost and easy to operate.

Description

Technical Field

[0001] The present invention relates to the field of detection technology, and in particular to a PSR primer, a kit and a detection method for identifying Bacillus subtilis based on a specific gene target. Background Art

[0002] Bacillus subtilis is a Gram-positive bacterium widely found in soil, plant rhizosphere and various natural environments, and has important industrial application value. Bacillus subtilis can not only be used as a probiotic in agriculture, but is also widely used in food fermentation, environmental remediation and other fields. However, the ability of Bacillus subtilis to survive harsh conditions such as high temperature, high salt, acid and alkali makes it a potential threat to food safety. The spores it forms pose certain safety hazards to the food industry and may cause food contamination or corruption. Although its pathogenicity is low, some strains may cause gastrointestinal diseases, especially for people with low immunity. There is a potential health threat. Therefore, how to quickly and accurately detect Bacillus subtilis, especially in complex food environments, is an urgent problem to be solved.

[0003] At present, the detection methods of Bacillus subtilis mainly include traditional microbial culture methods. The culture method is currently the main method for detecting Bacillus subtilis. Although this method has low equipment requirements, the entire detection cycle is as long as 3-7 days, which cannot meet the needs of rapid detection. In addition, although the biochemical analysis method can provide more accurate identification, the operation steps are cumbersome and easily affected by environmental factors, resulting in decreased sensitivity and specificity.

[0004] In recent years, the development of molecular biology technology has provided new means for pathogen detection, especially PCR technology, which is widely used in microbial detection due to its rapid, simple and sensitive characteristics. However, the PCR targets currently used for Bacillus subtilis detection are mostly concentrated on genes encoding extracellular enzymes and spore-related genes, which may be affected by cross-reactions or nonspecific amplification in different environments.

[0005] As a new type of constant temperature amplification technology, Polymerase Spiral Reaction (PSR) has shown excellent application prospects in the rapid detection of pathogenic microorganisms in recent years. Compared with traditional PCR technology, PSR does not require complex thermal cycling processes, can achieve gene amplification at a constant temperature, is simple to operate, and can significantly improve the sensitivity and specificity of detection. Therefore, the PSR detection method based on specific gene targets can provide a new solution for the rapid and efficient detection of Bacillus subtilis. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a PSR primer for identifying Bacillus subtilis based on a specific gene target.

[0007] Another object of the present invention is to provide a kit for identifying Bacillus subtilis based on specific gene targets.

[0008] Another object of the present invention is to provide a PSR detection method for identifying Bacillus subtilis based on specific gene targets.

[0009] The purpose of the present invention is achieved through the following technical solutions:

[0010] A set of PSR primers for identifying Bacillus subtilis based on specific gene targets, including primers yhjO-Ft and yhjO-Bt, whose nucleotide sequences are shown below:

[0011] yhjO-Ft:

[0012] 5'-CTAGCAACATGTAAGGGCAGCAGACGTTCGGAAGTG-3';

[0013] yhjO-Bt:

[0014] 5'-CGGGAATGTACAACGATCTTTGACCGCATTGCTTCT-3'.

[0015] A detection reagent for identifying Bacillus subtilis based on PSR isothermal amplification technology, comprising the above-mentioned PSR primers for identifying Bacillus subtilis based on specific gene targets.

[0016] In the reagent, the concentrations of yhjO-Ft and yhjO-Bt are both 0.8 μM.

[0017] The reagents also include 2×PSR reaction buffer and Bst enzyme.

[0018] The formula of the 2×PSR reaction buffer is: 40.0 mM Tris-HCl, 20.0 mM ammonium sulfate, 20.0 mM potassium chloride, 16.0 mM magnesium sulfate, 0.2% (v / v) Tween 20, 1.4 M betaine, and 10.0 mM dNTPs.

[0019] A detection kit for identifying Bacillus subtilis based on PSR isothermal amplification technology comprises the above-mentioned PSR primers for identifying Bacillus subtilis based on specific gene targets.

[0020] Application of the above primers or reagents in identifying Bacillus subtilis.

[0021] An experimental research method for non-disease diagnosis of Bacillus subtilis based on the above reagent comprises the following steps:

[0022] (1) Extract bacterial DNA from the sample to be tested as a template and ensure that the OD of the template DNA aqueous solution is 260 / OD 280 The value is in the range of 1.8 to 2.0;

[0023] (2) The mixture was incubated in a 63°C water bath for 60 minutes to perform a polymerase helical amplification reaction; wherein the polymerase helical amplification reaction system was a 25 μL reaction system: 12.5 μL of 2×PSR reaction buffer, 0.8 μM of primers yhjO-Ft and yhjO-Bt, 2 μL of template DNA, 1 μL of Bst enzyme, and 25 μL of water was added to make up the volume;

[0024] (3) Take 5 μL of the PSR reaction product and perform electrophoresis on a 2% agarose gel. If a band appears at 234 bp, it is judged to be positive for Bacillus subtilis.

[0025] Application of gene yhjO as a target for identification of Bacillus subtilis.

[0026] The NCBI database registration number of the nucleotide sequence of the gene yhjO is NP_388939.1_1076.

[0027] Application of the conserved sequence of gene yhjO as a target for identifying Bacillus subtilis.

[0028] The nucleotide sequence of the conservative sequence of the gene yhjO is shown in SEQ ID NO.3.

[0029] Compared with the prior art, the present invention has the following advantages and effects:

[0030] The present invention discloses a specific detection target of Bacillus subtilis, and a corresponding primer for PSR detection and a detection method. The specific detection target is obtained by comparative genomics and bioinformatics mining, and is selected from the yhjO gene. The detection target has the characteristics of high accuracy and strong specificity. The present invention designs specific primers for the newly mined specific detection target yhjO gene of Bacillus subtilis, and establishes a PSR detection method for Bacillus subtilis. The detection method of the present invention has the characteristics of high sensitivity, good specificity, fast reaction speed, low cost and simple operation.

[0031] The present invention provides a PSR detection method for identifying Bacillus subtilis based on specific gene targets, which does not require expensive equipment and professionals, shortens the detection cycle, expands the detection limit, and is more adaptable to the needs of on-site detection. It has important application value in the identification of Bacillus subtilis, food safety risk assessment and pathogen tracing of foodborne diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The electrophoresis detection results of the feasibility of the primers designed for the PSR detection method of Bacillus subtilis based on the specific gene target yhjO in Example 1.

[0033] Figure 2 This is the electrophoresis detection result of the specificity evaluation of the PSR detection method for Bacillus subtilis based on the specific gene target yhjO in Example 2.

[0034] Figure 3 This is the electrophoresis detection result of the sensitivity evaluation of the PSR detection method for Bacillus subtilis based on the specific gene target yhjO in Example 3. DETAILED DESCRIPTION

[0035] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0036] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0037] Example 1 Screening of Highly Specific Targets of Bacillus subtilis

[0038] Download the reference genome ASM904v1 of Bacillus subtilis, 337 Bacillus subtilis genomes, 1664 Bacillus genomes, and Nt database from the NCBI database. Use these as the base database. Use the Blast+ tool for alignment to screen for highly specific targets.

[0039] For the high-specificity targets mined, multiple sequence alignment of the high-specificity targets to the conserved sequences of the high-specificity targets was performed using MEGA software and MEME website. The specific targets obtained are shown in Table 1:

[0040] Table 1

[0041]

[0042] Cv*ide: coverage*identity

[0043] The conserved sequence of the obtained Bacillus subtilis high-specificity target yhjO (234 bp) is:

[0044] GCACAGCGATTTTGACCGCATTGCTCTCTTCAATCAGCGGCAATGACAGGGTTTGTATTTGCTGAGCATGCGTATGTTTTCGCTATTCTCTATGTCATGAATGGCATCGGAAGATCGTTGTACATTCCCGCTTCCCGCGCCCAAATCGCTGAAAGCACGCCGGAAAGCAGACGTTCGGAAGTGTTTGCGGTCATCAATGCGATCTATTCGACGGGTCTGACGGCAGGACCGCTAG;

[0045] Example 2 Design of specific primers for Bacillus subtilis PSR detection

[0046] Primer Premier 5 was used to design three sets of primers for the conservative sequence of the target yhjO, including a forward primer (Ft) and a reverse primer (Bt), which were respectively denoted as yhjO-Ft1, yhjO-Bt1; yhjO-Ft2, yhjO-Bt2; yhjO-Ft3, yhjO-Bt3. The designed primers were compared with the NT database of NCBI using the online tool Primer-BLAST to verify the accuracy of the detection primers of the present invention. The gene fragments of the three sets of primers designed are shown in Table 2

[0047] Table 2

[0048]

[0049]

[0050] Example 3 Establishment of Bacillus subtilis PSR detection method

[0051] The total volume of the PSR reaction system is 25 μL, including 12.5 μL of 2×PSR reaction buffer, 0.8 μM primers Ft and Bt, 2 μL template DNA, 1 μL Bst enzyme, and water to make up to 25 μL.

[0052] 2×PSR reaction buffer: composed of a mixture of 40.0 mM Tris-HCl, 20.0 mM ammonium sulfate, 20.0 mM potassium chloride, 16.0 mM magnesium sulfate, 0.2% (v / v) Tween 20, 1.4 M betaine, and 10.0 mM dNTPs (each).

[0053] A single colony of Bacillus subtilis ATCC6051 was inoculated into 10 mL of TSB liquid culture medium. After the bacteria were enriched at 37°C for 12 h, 1 mL of the bacterial suspension was taken and genomic DNA was extracted using a bacterial DNA extraction kit from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0054] The PSR reaction procedure is as follows: the reaction tube is placed in a 63°C water bath for 60 minutes, and then placed in a 80°C water bath for 2 minutes to terminate the reaction.

[0055] Determination of the test results: Take 5 μL of the PSR reaction product and perform electrophoresis in a 2% agarose gel. If a band appears at 234 bp, it is judged to be positive for Bacillus subtilis. If no band appears at 234 bp, it is judged to be negative for Bacillus subtilis.

[0056] Example 4 Verification of specific primers for Bacillus subtilis PSR detection

[0057] Referring to the method of Example 3, sterile water was used as a negative control to perform PSR reaction on nine primer pairs. The products after the reaction were verified by agarose gel electrophoresis to verify the feasibility of the primers. The electrophoresis diagram is shown in FIG. Figure 1 shown.

[0058] The experimental results show that lane 1 is the PSR result of the second set of primers for target yhjO, and lane 2 is the negative control group. Only the second set of primers designed for target yhjO showed a band, indicating that PSR amplification was successful. Primers yhjO-Ft2 and yhjO-Bt2 were determined to be specific primers, abbreviated as yhjO-Ft and yhjO-Bt, and the sequences are as follows:

[0059] yhjO-Ft (SEQ ID NO.1):

[0060] 5'-CTAGCAACATGTAAGGGCAGCAGACGTTCGGAAGTG-3';

[0061] yhjO-Bt (SEQ ID NO.2):

[0062] 5'-CGGGAATGTACAACGATCTTTGACCGCATTGCTTCT-3'.

[0063] Example 5 Specificity evaluation of the Bacillus subtilis PSR detection method of the present invention

[0064] The primers screened in Example 4 were evaluated for specificity using Bacillus subtilis ATCC6051 and 22 strains of non-Bacillus subtilis, including Lactobacillus gasseri Lgas230001, Lactobacillus brevis Lbre200001, Lactobacillus plantarum ATCC8014, Pediococcus acidilactici Paci180001, Lactobacillus crispatus Lcri230001, Lactobacillus iners Line230001, Lactobacillus jenne230001, Corynebacterium glutamicum Cglu230001, Staphylococcus haemolyticus Shae230001, Vibrio parahaemolyticus ATCC17802, Listeria monocytogenes ATCC19115, Listeria monocytogenes ATCC15313, Pseudomonas aeruginosa PAO1, Pseudomonas aeruginosa ATCC27853, Staphylococcus aureus ATCC23235, Staphylococcus aureus ATCC19095, Staphylococcus epidermidis ATCC35984, Escherichia coli ATCC43895, Salmonella Enteritidis ATCC14028, Salmonella Enteritidis ATCC29629, Bacillus cereus ATCC13061, Shigella flexneri 10.

[0065] Among them, Lactobacillus gasseri Lgas230001, Lactobacillus breve Lbre200001, Lactobacillus crispatus Lcri230001, Lactobacillus iners Line230001, Lactobacillus jensenii Ljen230001, Corynebacterium glutamicum Cglu230001, and Staphylococcus haemolyticus Shae230001 were all purchased from Guangzhou Peptide Valley Technology Co., Ltd.; Pediococcus acidilactici Paci180001 has been reported in the literature Zhenbo Xu*, Feifeng Zhong, Aijuan Xu, Yuting Luo, ThanapopSoteyome, Gamini Seneviratne, Lei Yuan, Junyan Liu*. Development, evaluation and application of propidium monoazide (PMA) based methodologies on viable cell quantification of Pediococcus acidilactici in rice noodles products.FoodControl.2025,168:110889. and preserved in the laboratory of Zhongkai University of Agriculture and Engineering; the remaining strains were purchased from public channels.

[0066] Bacillus subtilis ATCC6051 and 24 strains of non-Bacillus subtilis were inoculated into 10 mL of TSB liquid culture medium, respectively. After the bacteria were enriched at 37°C for 12 h, 1 mL of the bacterial suspension was taken and genomic DNA was extracted using a bacterial DNA extraction kit from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0067] Referring to the method of Example 3, 2 μL of the extracted genomic DNA was taken and PSR detection was performed using primers yhjO-Ft2 and yhjO-Bt2.

[0068] The results of PSR product electrophoresis are shown in Table 3 and Figure 2 shown. Figure 2 In the figure, M represents the DNA Marker of DL 2000, lane 1 is Bacillus subtilis, lanes 2-24 are non-Bacillus subtilis, and the specific species and strain names are shown in Table 3. The experimental results show (Table 3) that Bacillus subtilis is correctly detected as positive, with high sensitivity. For 24 non-Bacillus subtilis strains, this method detects them as negative, so this pair of primers has strong specificity.

[0069] Table 3

[0070]

[0071]

[0072] Note: + indicates a positive test result; - indicates a negative test result.

[0073] Example 5 Determination of the detection limit of the Bacillus subtilis PSR detection method

[0074] The genomic DNA of Bacillus subtilis was prepared according to the method of Example 3, and the DNA concentration of Bacillus subtilis was measured by ultra-micro UV spectrophotometer, and the initial concentration was 1530.75 ng / μL. The genomic DNA was diluted 6 times in a 10-fold concentration gradient with denuclease-free water, and amplified according to the established and optimized PSR reaction system. The amplified product was detected by agarose gel electrophoresis to determine whether the amplification was successful. Take 1 μL of DNA from each dilution gradient as a template and add it to the PSR reaction system (25 μL).

[0075] The amplification results are shown in Table 4 and Attached Figure 3 As shown; among them, Figure 3The first column is DL 2000DNA Marker. The DNA concentrations in the PSR system corresponding to lanes 1 to 7 are 61.23ng / μL, 6.13ng / μL, 612.25pg / μL, 61.225pg / μL, 6.1225pg / μL, 612.25fg / μL, and 61.225fg / μL, respectively. When the concentration of Bacillus subtilis genomic DNA is between 612.25pg / μL and 61.225pg / μL, the PSR reaction system can amplify positive results. When the DNA concentration drops to 6.1225pg / μL, the reaction system cannot amplify the band and is judged as negative. Therefore, the detection limit of this reaction system for Bacillus subtilis genomic DNA is 61.225pg / μL. Therefore, the PSR detection method for Bacillus subtilis based on specific gene targets provided by the present invention has high sensitivity for the detection of Bacillus subtilis genomic DNA.

[0076] Table 4 Detection results of Bacillus subtilis DNA at different gradient concentrations

[0077]

[0078]

[0079] Note: + indicates a positive test result; - indicates a negative test result.

[0080] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A set of PSR primers for identifying Bacillus subtilis based on specific gene targets, characterized in that: The PSR primers for identifying Bacillus subtilis based on specific gene targets include primers yhjO-Ft and yhjO-Bt, and their nucleotide sequences are shown below: yhjO-Ft: 5'-CTAGCAACATGTAAGGGCAGCAGACGTTCGGAAGTG-3'; yhjO-Bt: 5'-CGGGAATGTACAACGATCTTTGACCGCATTGCTTCT-3'.

2. A detection reagent for identifying Bacillus subtilis based on PSR isothermal amplification technology, characterized in that: The invention comprises the PSR primer for identifying Bacillus subtilis based on specific gene target as described in claim 1.

3. The detection reagent for identifying Bacillus subtilis based on PSR isothermal amplification technology according to claim 2, characterized in that: In the reagent, the concentrations of yhjO-Ft and yhjO-Bt were both 0.8 μM; The reagents also include 2×PSR reaction buffer and Bst enzyme; The formula of the 2×PSR reaction buffer is: 40.0 mM Tris-HCl, 20.0 mM ammonium sulfate, 20.0 mM potassium chloride, 16.0 mM magnesium sulfate, 0.2% (v / v) Tween 20, 1.4 M betaine, and 10.0 mM dNTPs.

4. Use of the primers according to claim 1 in identifying Bacillus subtilis.

5. Use of the detection reagent according to any one of claims 2 to 3 in identifying Bacillus subtilis.

6. An experimental research method for non-disease diagnosis of Bacillus subtilis by using the detection reagent according to any one of claims 2 to 3, comprising the following steps: (1) Extract bacterial DNA from the sample to be tested as a template and ensure that the OD of the template DNA aqueous solution is 260 / OD 280 The value is in the range of 1.8 to 2.0; (2) incubating in a 63°C water bath for 60 minutes to perform a polymerase helical amplification reaction; wherein, The polymerase helical amplification reaction system was a 25 μL reaction system: 12.5 μL of 2×PSR reaction buffer, 0.8 μM each of primers yhjO-Ft and yhjO-Bt, 2 μL of template DNA, 1 μL of Bst enzyme, and water was added to make up to 25 μL; (3) Take 5 μL of the PSR reaction product and perform electrophoresis on a 2% agarose gel. If a band appears at 234 bp, it is judged to be positive for Bacillus subtilis.

7. Application of gene yhjO as a target for identification of Bacillus subtilis.

8. The use according to claim 7, characterized in that: The NCBI database registration number of the nucleotide sequence of the gene yhjO is NP_388939.1_1076.

9. Application of the conserved sequence of gene yhjO as a target for identifying Bacillus subtilis.

10. The use according to claim 9, characterized in that: The nucleotide sequence of the conservative sequence of the gene yhjO is shown in SEQ ID NO.3.

Images