Target gene, primer and method for detecting Escherichia fagenii

Abstract

The invention relates to the technical field of Escherichia fagenii detection, in particular to a target gene, a primer and a method for detecting Escherichia fagenii. The invention provides a target gene for detecting Escherichia fagenii. The sequence of the target gene for identifying the Escherichia fagenii is as shown in SEQ ID NO: 1. According to the present invention, through the comparison of the whole genome of 622 Escherichia bacteria, the conserved gene cheV exists in the Escherichia fagenii, and the gene does not exist in other Escherichia bacteria corresponding to the cheV in the whole genome of the known Escherichia fagenii ATCC 35469, such that the nucleotide sequence such as the SEQ ID NO. 1 is adopted as the target gene for detecting the Escherichia fagenii;

Description

Technical Field

[0001] The invention relates to the technical field of Escherichia Ferguson detection, and in particular to a target gene, primer and method for detecting Escherichia Ferguson. Background Art

[0002] Escherichia Fergusonii ( Escherichia fergusonii ) belongs to the genus Escherichia of the family Enterobacteriaceae, and is closely related to Escherichia coli. In 1985, two strains of Escherichia fergusonii were first isolated from clinical blood samples, and by analyzing their biochemical reactions, they were classified as a new species and belonged to the genus Escherichia. The clinical significance of E. fergusonii is still unclear. However, there have been reports that the bacteria can be isolated from human wound infections, gallbladder fluid, and in primates and water. E. fergusonii has a wide range of prevalence, diverse hosts, and can cause human disease.

[0003] Currently, the method for identifying Escherichia Ferguson mainly involves first performing gene sequencing and then performing 16S rDNA comparison. Although this method can identify Escherichia Ferguson, it is costly and time-consuming. In addition, Lindsey et al. compared the genomes of 150 strains of Enterobacteriaceae using the Daydreamer™ platform, including 107 strains of Escherichia coli, 5 strains of Shigella, 21 strains of Escherichia Alberti, 12 strains of Escherichia Ferguson and 5 strains of other species. They then found a palmitoleyl acyl carrier protein-dependent acyltransferase encoding gene in the EFER_0790 Primers were designed on the 575 bp region of the PCR product, and multiplex PCR was used to detect and identify Escherichia fergusonii. EFER_0790 When qPCR is performed based on gene target primers, the results do not have good specificity, which is the same as the situation of matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOFMS) identification method, and it is unable to effectively distinguish Escherichia coli from Escherichia fergusonii. Therefore, the current detection methods of Escherichia fergusonii have disadvantages such as poor sensitivity and specificity to a large extent. Summary of the invention

[0004] Therefore, the technical problem to be solved by the present invention is to overcome the defects of poor sensitivity and specificity of the detection method for identifying Escherichia ferguson in the prior art, thereby providing a target gene, primers and method for detecting Escherichia ferguson.

[0005] On the one hand, the present invention provides a target gene for detecting Escherichia fergusonii, and the sequence of the target gene for detecting Escherichia fergusonii is shown in SEQ ID NO:1.

[0006] On the other hand, the present invention provides a primer for detecting Escherichia fergusonii. The sequences of the primers for detecting Escherichia fergusonii are shown in SEQ ID NO:2 and SEQ ID NO:4.

[0007] Meanwhile, the present invention provides a kit for detecting Escherichia fergusonii, comprising the above-mentioned primers for detecting Escherichia fergusonii.

[0008] Furthermore, the present invention provides a method for detecting Escherichia Fergusonii, comprising the following steps: Extract the DNA of the strain to be tested; construct a PCR reaction system using the extracted DNA of the strain to be tested as a template to perform a PCR reaction, wherein the PCR reaction system includes the above-mentioned primers for detecting Escherichia fergusonii or the above-mentioned kit for detecting Escherichia fergusonii.

[0009] In some embodiments, the PCR reaction system includes 0.8-1.2 μL upstream primer, 0.8-1.2 μL downstream primer, 0.8-1.2 μL DNA template, 8-12 μL premix and the balance is ddH 2 O.

[0010] In some embodiments, the concentration of the upstream primer and / or the downstream primer is 8-10 mmol / L.

[0011] In some embodiments, the concentration of the DNA template is 150-250 ng / μL.

[0012] In some of the embodiments, the PCR reaction procedure is 90-95°C pre-denaturation for 2-5 min, 1 cycle; 90-95°C denaturation for 30 s, 59-63°C annealing for 30 s, 72°C extension for 30 s, 30-50 cycles; 72°C, extension for 5 min.

[0013] In some of the embodiments, the PCR product has a 192 bp band, indicating that the strain to be tested is Escherichia fergusonii.

[0014] In some of the embodiments, the fluorescent quantitative PCR reaction Ct value is ≤36, and the strain to be tested is detected to be Escherichia fergusonii.

[0015] The technical solution of the present invention has the following advantages: 1. A target gene for detecting Escherichia Ferguson provided by the present invention, the target gene sequence for detecting Escherichia Ferguson is shown in SEQ ID NO: 1. By comparing the whole genomes of 622 strains of Escherichia bacteria, it was found that Escherichia Ferguson has a conserved gene cheV , corresponding to the known Escherichia Ferguson Escherichia fergusonii ATCC 35469 whole genome cheV, this gene does not exist in other Escherichia bacteria, and its nucleotide sequence is shown in SEQ ID NO.1. The nucleotide sequence was uploaded to NCBI for BLASTN comparison, and the match between the Escherichia Ferguson genome and this sequence was more than 98.5%, with a coverage rate of 100%, while the match between other genomes such as Salmonella enterica, Citrobacter freundii, and Citrobacter was less than 75%, with a coverage rate of less than 93%. Therefore, the nucleotide sequence such as SEQ ID NO.1 was used as the target gene for detecting Escherichia Ferguson.

[0016] 2. The present invention provides a primer for detecting Escherichia fergusonii, wherein the primer sequences for detecting Escherichia fergusonii are shown in SEQ ID NO: 2 and SEQ ID NO: 4. The present invention uses a nucleotide sequence such as SEQ ID NO. 1 as a target gene for detecting Escherichia fergusonii, designs a set of primer pairs, and can improve the specificity and sensitivity of detecting Escherichia fergusonii. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 This is the gel electrophoresis diagram of the amplified product of Experimental Example 1 of the present invention; Figure 2 This is the gel electrophoresis diagram of the amplified product of Experimental Example 2 of the present invention; Figure 3 This is the gel electrophoresis diagram of the amplified product of Experimental Example 3 of the present invention; Figure 4 This is a graph showing the Ct results of fluorescent quantitative PCR in Experimental Example 4 of the present invention. DETAILED DESCRIPTION The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0019] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be obtained commercially.

[0020] The present invention compares the nucleotide sequences of 144 strains of Escherichia fergusonii in the gene sequence database of the National Center for Biotechnology Information (NCBI) of the United States with the complete genome sequences of 478 strains of other Escherichia bacteria such as Escherichia albertii, Escherichia coli, and non-decarboxylating Escherichia coli, and screens out multiple candidate genes. Primers are designed with the candidate genes as targets to perform PCR on the DNA of Escherichia fergusonii and Escherichia coli to verify the specificity and conservation of the genes, and it is found that there is a conserved gene sequence corresponding to the known Escherichia fergusonii. Escherichia fergusonii ATCC 35469 complete genome sequence cheV After BLASTN comparison, it was found that the genome of Escherichia Ferguson matched this sequence at more than 98.5%, with a coverage rate of 100%, while the genomes of other species such as Salmonella enterica, Citrobacter freundii, and Citrobacter spp. matched at less than 75%, with a coverage rate of less than 93%. It can be seen that the gene has high sequence homology between different strains of Escherichia Ferguson and has good sequence specificity. cheV The gene (nucleotide sequence is shown in SEQ ID No. 1) is the target gene, and the design is capable of specifically amplifying the cheV The primer pair of the gene can be used to determine whether the test strain belongs to Escherichia ferguson by whether the target product can be amplified.

[0021] Example 1 This embodiment provides a method for detecting Escherichia Fergusonii, and the specific steps and parameters are as follows: (1) Entrust Qingke Biotechnology (Shanghai) Co., Ltd. to synthesize primers. The primer information is shown in Table 1.

[0022] (2) Scrape the hyphae from the culture dish and extract the DNA template using a bacterial genomic DNA extraction kit (Shanghai Jierui Bioengineering Co., Ltd.). The hyphae is Escherichia fergusonii ( Escherichia fergusonii ) ATCC 35469.

[0023] (3) Prepare the reaction solution according to the PCR reaction system provided in Table 2, and perform amplification according to the PCR reaction program provided in Table 3.

[0024] Table 1 Primer information

[0025] Table 2 PCR reaction system

[0026] In Table 1, the concentration of primer-F is 10 mmol / L, the concentration of primer-R is 10 mmol / L, the concentration of DNA template is 200 ng / μL, and the premix is ​​2×TB Green Fast qPCR Mix.

[0027] Table 3 PCR reaction procedure

[0028] Example 2 This embodiment provides a method for detecting Escherichia Fergusonii. The specific steps and parameters are the same as those in Example 1, except that in the PCR reaction procedure, the annealing temperature is 59°C.

[0029] Example 3 This embodiment provides a method for detecting Escherichia Fergusonii. The specific steps and parameters are the same as those in Example 1, except that in the PCR reaction procedure, the annealing temperature is 61°C.

[0030] Example 4 This embodiment provides a method for detecting Escherichia Fergusonii. The specific steps and parameters are the same as those in Example 1, except that in the PCR reaction procedure, the annealing temperature is 62°C.

[0031] Example 5 This embodiment provides a method for detecting Escherichia Fergusonii. The specific steps and parameters are the same as those in Example 1, except that in the PCR reaction procedure, the annealing temperature is 63°C.

[0032] Example 6 This embodiment provides a method for detecting Escherichia Fergusonii, and the specific steps and parameters are as follows: (1) Entrust Qingke Biotechnology (Shanghai) Co., Ltd. to synthesize primer pair q2. The primer information is shown in Table 1.

[0033] (2) Scrape the hyphae from the culture dish and extract the DNA template using a bacterial genomic DNA extraction kit (Shanghai Jierui Bioengineering Co., Ltd.). The hyphae is Escherichia fergusonii ( Escherichia fergusonii ) ATCC 35469.

[0034] (3) Perform PCR reaction on the DNA template. The PCR reaction system consisted of 8 μL of 2×TB Green Fast qPCR Mix, 0.8 μL of 10 mmol / L upstream primer, 0.8 μL of 10 mmol / L downstream primer, 1 μL of 150 ng / μL DNA template, and 9.4 μL of ddHO. 2O, prepare the reaction solution. For primer information, refer to primer pair q2 in Table 1. For specific sequences, refer to SEQ ID NO: 2 and SEQ ID NO: 4.

[0035] The PCR reaction program was 90°C pre-denaturation for 5 min; 90°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 30 s, for a total of 30 cycles; and finally 72°C extension for 5 min.

[0036] Example 7 This embodiment provides a method for detecting Escherichia Fergusonii, and the specific steps and parameters are as follows: (1) Entrust Qingke Biotechnology (Shanghai) Co., Ltd. to synthesize primer pair q2. The primer information is shown in Table 1.

[0037] (2) Scrape the hyphae from the culture dish and extract the DNA template using a bacterial genomic DNA extraction kit (Shanghai Jierui Bioengineering Co., Ltd.). The hyphae is Escherichia fergusonii ( Escherichia fergusonii ) ATCC 35469.

[0038] (3) Perform PCR reaction on the DNA template. The PCR reaction system consisted of 12 μL of 2×TB Green Fast qPCR Mix, 1.2 μL of 8 mmol / L upstream primer, 1.2 μL of 8 mmol / L downstream primer, 1 μL of 250 ng / μL DNA template, and 4.6 μL of ddHO. 2 O, prepare the reaction solution. For primer information, refer to primer pair q2 in Table 1. For specific sequences, refer to SEQ ID NO: 2 and SEQ ID NO: 4.

[0039] The PCR reaction program was pre-denaturation at 95°C for 2 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 50 cycles; and finally extension at 72°C for 5 min.

[0040] Experimental Example 1 The amplified products obtained in Example 1-5 were tested by gel electrophoresis, and the results are shown in Figure 1 It can be seen that the primer pairs with sequence numbers q1-q2 can achieve amplification of the DNA template at an annealing temperature of 59-61°C; the primer pairs with sequence numbers q3-q5 can achieve amplification of the DNA template at an annealing temperature of 59-63°C.

[0041] Experimental Example 2 Ten strains of Escherichia Fergusonii ( Escherichia fergusonii ) was used as a positive control, and 10 strains of Escherichia coli ( Escherichia coli ) was used as negative control.

[0042] The DNA templates extracted from the negative control and positive control were amplified using 5 pairs of primers according to the method of Example 1, and the amplified products were displayed by gel electrophoresis. Figure 2 (In the figure, columns 1-10 represent the positive control Escherichia Ferguson, and columns 11-20 represent the negative control Escherichia coli). It can be seen that the primer pairs SEQ ID NO: 2 and SEQ ID NO: 4 provided in the embodiment of the present invention have the best experimental effect of distinguishing Escherichia Ferguson from Escherichia coli, while other primer pairs can also amplify Escherichia Ferguson ( Figure 2 However, when amplifying Escherichia coli, the q1 primer pair and the q3 primer pair amplified bands in some lanes (i.e., columns 11-20), while the q2 primer pair did not amplify any bands of Escherichia coli at all, proving that the primer pair q2 has the best specificity.

[0043] Experimental Example 3 The specificity of the primer pair q2 provided in the embodiment of the present invention was verified.

[0044] The verification method includes the following steps: 1. Scrape the hyphae from the culture dish and extract the DNA template using a bacterial genomic DNA extraction kit (Shanghai Jierui Bioengineering Co., Ltd.). The hyphae are Escherichia Fergusonii ( Escherichia fergusonii )、Escherichia hermannii( Escherichia hermann ii) Escherichia coli Escherichia marmotae )、Escherichia coli( Escherichia vulneris )、Escherichia coli( Escherichia albertii )、Aeromonas hydrophila( Aeromonas hydrophila )、Aeromonas caviae( Aeromonas caviae )、Pseudomonas( Pseudomonas ), Vibrio parahaemolyticus ( Vibrio parahaemolyticus jejuni ( Campylobacter jejuni ),salmonella( Salmonella )、Escherichia coli( Escherichia coli ), Acinetobacter baumannii ( Acinetobacter baumannii ), Enterococcus faecalis ( Enterococcus faecalis )、Lactobacillus plantarum( Lactobacillus plantarum ), the above strains were purchased from American Type Culture Collection (ATCC).

[0045] 2. Prepare the reaction solution according to the PCR reaction system provided in Table 2 of Example 1, and amplify according to the PCR reaction program provided in Table 3. For primer information, refer to primer pair q2 in Table 1. Take the DNA extracted from the hyphae as the positive control, and add an equal volume of ddH2 O is the negative control.

[0046] The amplified products were visualized by gel electrophoresis. Figure 3 It can be seen that the primers provided in the embodiment of the present invention can only identify Escherichia fergusonii (there is an obvious band at 192 bp), which proves that the primers are specific.

[0047] Experimental Example 4 The sensitivity of the primers provided in the embodiments of the present invention was measured.

[0048] The test method is as follows: 1. Scrape the hyphae from the culture dish and extract the DNA template using a bacterial genomic DNA extraction kit (Shanghai Jierui Bioengineering Co., Ltd.). The hyphae is Escherichia Fergusonii ( Escherichia fergusonii ) ATCC 35469.

[0049] 2. Use the specific identification gene cheV of Escherichia Ferguson as a template to construct a recombinant positive plasmid: 2.1. Prepare the reaction solution according to the PCR reaction system provided in Table 2 of Example 1, and amplify according to the PCR reaction program provided in Table 3. The primer sequences are cheV-F: GCGCACATGATCTTCATTCG (see SEQ ID NO.11); cheV-R: GTCCTCACTGCCGATAACTG (see SEQ ID NO.12).

[0050] 2.2. Integrate the product obtained by primer amplification in step 2.1 into plasmid pMD19-T to construct the recombinant positive reference plasmid pMD19-T- cheV : The amplified product was integrated into the plasmid pMD19-T to construct the recombinant positive reference plasmid pMD19-T- cheV The steps are as follows: 2.2.1. Purification of PCR products: The PCR products were transferred into a 1.5 mL centrifuge tube, and then agarose gel electrophoresis, gel cutting, gel recovery and other steps were performed to obtain the purified PCR products; 2.2.2. Connection: Use a commercial seamless cloning kit to seamlessly clone and connect the purified PCR product and plasmid pMD-19T; 2.2.3. Transformation: The obtained seamless cloning product was transformed into Escherichia coli DH5α based on the chemical transformation method; 2.2.4. Plasmid extraction: Use a commercial plasmid extraction kit to extract the recombinant positive plasmid in Escherichia coli DH5α and use it in subsequent experiments.

[0051] 3. The recombinant positive reference plasmid pMD19-T- cheV Perform serial dilutions until the copy number is 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, and an equal volume of ddHO was used 2 O is the negative control. Fluorescence quantitative PCR was performed on the positive control and negative control with different copy numbers using a fluorescence quantitative PCR instrument (CFX96), where: The qPCR reaction system consisted of 10 μL of 2×TB Green Fast qPCR Mix, 0.8 μL of 10 mmol / L upstream primer, 0.8 μL of 10 mmol / L downstream primer, 1 μL of 200 ng / μL DNA template, and 7.4 μL of ddHO. 2 O, prepare the reaction solution, the primer information refers to the primer pair q2 in Table 1, and the specific sequence refers to SEQ ID NO: 2 and SEQ ID NO: 4; The qPCR reaction program was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 45 cycles; and finally extension at 72°C for 10 min.

[0052] Using ddH 2 O was used as a negative control for qPCR using an alternative DNA template.

[0053] The results of fluorescence quantitative PCR are shown in Figure 4 ( Figure 4 NTC stands for no template control, i.e. negative control in this experimental example) and Table 4.

[0054] Table 4 Fluorescence quantitative PCR results

[0055] It is known that the positive control Ct value of Escherichia Ferguson is 38 or less. According to Table 4 and Figure 4 , we can see that the copy number is 10 1 The Ct values ​​of Escherichia coli DNA with more than 10 copies / μL were all below 36, while the negative control ddH 2 O and 10 0The Ct values ​​of 10 copies / μL of Escherichia Ferguson DNA were all above 37, which proved that the detection limit of the detection method provided by the embodiment of the present invention for Escherichia Ferguson DNA was 10 1 copies / μL.

[0056] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A target gene for detecting Escherichia Fergusonii, characterized in that: The target gene sequence for detecting Escherichia fergusonii is shown in SEQ ID NO:

1.

2. A primer for detecting Escherichia Fergusonii, characterized in that: The primer sequences for detecting Escherichia fergusonii are shown in SEQ ID NO:2 and SEQ ID NO:

4.

3. A kit for detecting Escherichia Ferguson, characterized in that: The invention comprises the primers for detecting Escherichia fergusonii as claimed in claim 2.

4. A method for detecting Escherichia Fergusonii, characterized in that: The following steps are included: Extract DNA of the strain to be tested; A PCR reaction system is constructed using the DNA of the strain to be tested as a template to carry out a PCR reaction. The PCR reaction system comprises the primers for detecting Escherichia fergusonii according to claim 2 or the kit for detecting Escherichia fergusonii according to claim 3.

5. The method for detecting Escherichia Ferguson according to claim 4, characterized in that: Based on a volume of 20 μL, the PCR reaction system includes 0.8-1.2 μL of upstream primer, 0.8-1.2 μL of downstream primer, 0.8-1.2 μL of DNA template, 8-12 μL of premix and the balance is ddH2O.

6. The method for detecting Escherichia Ferguson according to claim 5, characterized in that: The concentration of the upstream primer and / or the downstream primer is 8-10 mmol / L.

7. The method for detecting Escherichia Ferguson according to claim 6, characterized in that: The concentration of DNA template is 150-250 ng / μL.

8. The method for detecting Escherichia Ferguson according to claim 7, characterized in that: The PCR reaction procedure is 90-95°C pre-denaturation for 2-5 minutes, and one cycle; Denaturation at 90-95°C for 30 s, annealing at 59-63°C for 30 s, extension at 72°C for 30 s, cycle 30-50 times; 72°C, extension for 5 min.

9. The method for detecting Escherichia Ferguson according to any one of claims 4 to 8, characterized in that: The PCR product showed a 192 bp band, proving that the strain to be tested was Escherichia fergusonii.

10. The method for detecting Escherichia Ferguson according to any one of claims 4 to 8, characterized in that: The Ct value of the fluorescence quantitative PCR reaction was ≤36, indicating that the test strain was Escherichia fergusonii.

Images