A specific molecular marker for identifying the Saet CMS cytoplasmic male sterile line of eggplant and its application

Abstract

This invention discloses a specific molecular marker for identifying eggplant Saet CMS cytoplasmic male sterility lines and its application. The molecular marker, Saet218b, was selected by comparing the mitochondrial genomes of the eggplant Saet CMS cytoplasmic male sterility line and its maintainer line. Through bioinformatics analysis, the candidate specific gene for Saet CMS male sterility, orf218b, was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1. Based on this sequence information, the molecular marker Saet218b for identifying eggplant Saet CMS cytoplasmic male sterility lines was successfully designed. The molecular marker of this invention can be used to identify eggplant Saet CMS cytoplasmic male sterility lines efficiently and with a simple procedure. The results can be used for marker-assisted breeding of eggplant Saet-derived cytoplasmic male sterility lines, improving breeding efficiency. It also provides technical support and theoretical basis for the identification of eggplant specific cytoplasmic germplasm.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, specifically involving a specific molecular marker for identifying the Saet CMS cytoplasmic male sterile line of eggplant and its application. Background Technology

[0002] Eggplant is an important vegetable crop widely cultivated worldwide. It is a cross-pollinated plant exhibiting significant heterosis. Cytoplasmic male sterility, as one of the main methods for utilizing heterosis, has been widely applied in the production of solanaceous vegetables. Using cytoplasmic male sterility for seed production in eggplant breeding not only reduces breeding costs and improves breeding efficiency but also effectively ensures seed purity, thus attracting considerable attention from breeders. Currently reported eggplant cytoplasmic male sterile materials are mostly obtained through interspecific hybridization or somatic cell hybridization, primarily including types with indehiscent anthers and pollen-free varieties.

[0003] The identification of cytoplasmic male sterile (CMS) lines from different cytoplasmic sources in eggplant mainly relies on morphological or cytological characteristics. However, this approach suffers from limitations such as the inability to identify early stages and inaccurate trait assessment. Utilizing specific molecular markers to identify cytoplasmic male sterile lines effectively overcomes these problems, offering advantages such as accuracy, speed, and stability, and can be widely applied to sterility type identification. Currently, with the development of mitochondrial sequencing technology, screening candidate genes for cytoplasmic male sterility based on mitochondrial genome sequence information and developing related markers can not only differentiate eggplant cytoplasmic sterility types and guide the breeding of cytoplasmic male sterile lines and maintainer lines, but also provide the possibility for the efficient and stable identification of Saet CMS sterile lines using molecular marker-assisted techniques. Summary of the Invention

[0004] This invention provides a molecular marker for eggplant Saet CMS cytoplasmic male sterility lines and its application. By comparing mitochondrial genome sequence information of eggplant Saet-derived cytoplasmic male sterility lines and maintainer lines, candidate genes for Saet-derived CMS are screened. Markers are designed based on the sequence characteristics of these candidate genes, and the effectiveness of the markers is verified by testing multiple eggplant cytoplasmic male sterility lines with different genetic backgrounds and types. The development of cytoplasmic male sterility markers enables rapid identification of eggplant SaetCMS, significantly reducing the workload and improving efficiency.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] Based on the sequenced mitochondrial genome information of the Saet CMS cytoplasmic male sterile line, maintainer line, and sterile source, ORFs with more than 100 amino acids in the mitochondrial genome of the Saet CMS sterile line were screened using ORF-Finder, BLASTN, and BLASTX software. Based on the characteristics of known cytoplasmic male sterility genes in other crops, these specific ORFs were analyzed for transmembrane domains, co-transcription and chimerism, and positional structure. Finally, one ORF was selected as a candidate gene for SaetCMS, named orf218b, with its nucleotide sequence shown in SEQ ID NO.1. Specific primers were designed using Primer Premier 5.0 software to amplify this orf218b sequence in sterile lines and maintainer lines of different cytoplasmic types and origins. A 574 bp band was specifically amplified only in the Saet CMS sterile line, while no band was amplified in the corresponding maintainer line or other types of sterile lines. This marker was named Saet218b.

[0007] The molecular marker Saet218b primers are characterized in that: upstream primer 1 is shown in SEQ ID NO: 2, and downstream primer 2 is shown in SEQ ID NO: 3.

[0008] The above-mentioned molecular markers and specific primers for identifying Saet CMS cytoplasmic male sterile lines of eggplant were used in the identification of cytoplasmic male sterile lines of eggplant.

[0009] In practical applications, the identification method includes the following steps:

[0010] 1. Extract genomic DNA from the eggplant sample to be tested;

[0011] 2. The extracted DNA was amplified by PCR using the Saet218b molecular marker to obtain the amplification product.

[0012] 3. The amplification products were detected by agarose gel electrophoresis. If a specific band of 574 bp could be amplified by labeling with Saet218b, then the sample to be tested was an eggplant Saet CMS cytoplasmic male sterile line.

[0013] The present invention has the following beneficial effects:

[0014] 1. The eggplant Saet CMS cytoplasmic sterility-specific molecular marker developed in this invention is a novel marker developed based on the sequenced eggplant mitochondrial genome alignment and the mitochondrial genome of the Saet-derived sterile line. Results show that this marker has advantages such as high efficiency and stability.

[0015] 2. The specific molecular marker provided by this invention can be effectively used for eggplant cytoplasmic type identification, breeding of eggplant cytoplasmic male sterile lines and maintainer lines, and screening of sterile lines, thereby improving breeding efficiency. Attached Figure Description

[0016] Figure 1 PCR amplification using Saet CMS-specific primers

[0017] Figure 2 Saet CMS specific primer pairs for PCR amplification of different hymenal sterile line types Detailed Implementation

[0018] To enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments. Unless otherwise specified, the methods used in the following embodiments are conventional methods. The embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

[0019] Example 1: Development and validation of specific molecular markers for cytoplasmic sterility in eggplant Saet CMS:

[0020] 1.1 First, the sequenced mitochondrial genome sequences of the Saet CMS cytoplasmic male sterile line EP28A (GenBank: OR187866), the maintainer line EP28 mitochondrial genome sequence (GenBank: OR187865), and the sterile source mitochondrial genome sequence (GenBank: OR187867) were extracted from the NCBI database. ORFFinder and BLAST software were used to align and analyze these mitochondrial genome sequences, thereby obtaining ORFs specific to the Saet-derived cytoplasmic male sterile line. Based on the sequence characteristics of known sterility-related genes in other crops, transmembrane domain, co-transcription, chimeric genes, and repetitive sequence analyses were performed on the obtained specific ORFs. Ultimately, orf218b was identified as a candidate gene for Saet CMS. This orf is unique only to the sterile line EP28A and is absent in the maintainer line. It also possesses two transmembrane domains and is located 243 bp upstream of the known gene atp1. Based on the sequence information of orf218b, a pair of specific primers, Saet218b-F / R, was designed using Primer Premier 5.0. The nucleotide sequences of the primers are 5′→3′. The Saet218b-F sequence is TTTTGTTTGTCTGGGACTCG (as shown in SEQ ID No. 2), and the Saet218b-R sequence is CCGTAAGGACTTTCTCAATG (as shown in SEQ ID No. 3).

[0021] 1.2 Total DNA was extracted from the selected materials using the CTAB method. Then, PCR amplification was performed on known cytoplasmic male sterile lines and maintainer lines using designed primers for verification. The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 7 min. After amplification, the amplification products were detected by 1.2% agarose gel electrophoresis. The results are shown below. Figure 1 As shown. PCR amplification results showed that when the DNA of Saet male-sterile lines, maintainer lines and inbred lines was amplified using primers (Saet218b-L and Saet218b-R) containing the molecular marker Saet218b, only the eggplant male-sterile line containing Saet CMS-specific cytoplasm was able to amplify the target band, while other materials did not amplify the target band.

[0022] Example 2: Application of the Saet218b molecular marker in identifying cytoplasmic male sterility types in eggplant.

[0023] 1. Using three known eggplant male sterility types EP28A (Saet CMS), EP50A (Sang CMS), and EP52A (Skur CMS) and their corresponding maintainer lines as materials, genomic DNA was extracted from the leaves of all materials using the CTAB method.

[0024] 2. Using extracted leaf genomic DNA as a template, PCR amplification was performed using the molecular marker Saet218b. The PCR reaction system (20 μL) consisted of: 2 μL template DNA (50 ng / μL), 0.5 μL each of forward and reverse primers (10 ng / μL), 10 μL Taq Plus MasterMix II, and 7 μL sterile water. The PCR amplification program was: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; and 72℃ extension for 7 min. The results were detected by 1.2% agarose gel electrophoresis. (See attached table for details.) Figure 2 (From left to right in the image: M: DNA marker (DL2000); EP28A (Saet CMS); EP50A (Sang CMS); EP52A (Skur CMS); EP28; EP50; EP52.) Figure 2 It can be seen that only the Saet CMS male sterile line EP28A was able to amplify the corresponding band, and the size of the band was consistent with the target band. However, the band was not amplified in the other two cytoplasmic male sterile lines, further verifying that the Saet218b molecular marker is specific in identifying eggplant Saet cytoplasmic sterility.

[0025] The above description is only a specific implementation example of the present invention, but any changes or modifications made with reference to the present invention are covered within the scope of the present invention.

Claims

1. The application of a molecular marker Saet218b in identifying Saet CMS cytoplasmic male sterile lines of eggplant, characterized in that, The molecular marker Saet218b is based on the mitochondrial gene associated with cytoplasmic male sterility in eggplant. orf218b The sequence features were designed, and its nucleotide sequence is shown in SEQ NO:1 in the sequence listing.

2. The application according to claim 1, characterized in that, The specific primers for the molecular marker Saet218b are Saet218b-F / R, and their nucleotide sequences are as follows: the upstream primer Saet218b-F is shown in SEQ NO:2, and the downstream primer Saet218b-R is shown in SEQ NO:

3.

3. The application according to claim 1, comprising the following steps: (1) Extract genomic DNA from the leaves of the eggplant to be tested; (2) Using leaf genomic DNA as a template, amplification is performed using the specific primers Saet218b-F / R described in claim 2. The amplification products are detected by 1.2% agarose gel electrophoresis. If a specific band of 574bp is amplified, the eggplant being tested is a Saet CMS cytoplasmic male sterile line.

Images