An engineered strain producing high levels of echinocandin B, its construction method, and its applications.

Abstract

This invention discloses an engineered strain that produces high levels of echinocandin B, its construction method, and its applications, belonging to the field of genetic engineering technology. This invention modifies wild-type Aspergillus nidulans BGCm5 using CRISPR / nCas9-CBE technology to obtain an NHEJ-deficient strain. NkuA (mutation) and pyridoxine ( PyroA Mutation), riboflavin ( RiboB (Mutant) auxotrophic strains. Subsequently, orthogonal cross-linking was introduced using CRISPR / Cas9. Lox Sites for constructing chassis cells. Through Cre / LoxP and Cre / Lox2272 Reorganize the system, andF , andF 2. andG , andH , andI , andK and odeA Gene overexpression cassettes were integrated into the genome to obtain a series of engineered strains, which significantly improved production efficiency.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to an engineered strain that produces high levels of echinocandin B, its construction method, and its applications. Background Technology

[0002] The statements herein provide only background information in relation to this invention and do not necessarily constitute prior art.

[0003] Echinocandin B (ECB), a six-membered cyclic peptide, is a precursor for the antifungal drug anidulafungin. The production of ECB suffers from low fermentation yields and the accumulation of intermediate impurities, resulting in high raw material production costs and severely restricting clinical accessibility. Overcoming the bottleneck in ECB fermentation production is crucial to resolving the current supply-demand imbalance.

[0004] In the inventor's prior patent CN118853730A, the production strain of echinococin B was described. A. nidulans ATCC58396 utilizes a highly efficient CRISPR-Cas9 base editor to establish a filamentous fungal evolution technology through continuous transformation, used for the inactivation of byproduct gene clusters in this fungus. This evolutionary protocol screened for strains that significantly reduced the types of byproducts while increasing echinomic acid B production by 2.3 times. This creates conditions for efficient echinomic acid B production and simplified purification steps. Further increasing echinomic acid B production would better meet market needs. However, the biosynthetic pathway of echinomic acid B is complex, with numerous genes affecting its synthesis, requiring efficient large-fragment gene editing technology to achieve multi-gene regulation. Although CRISPR-Cas9 gene editing technology has been widely used in filamentous fungi, multi-site, large-fragment genome insertion still faces the problem of low editing efficiency.

[0005] Cre / Lox The recombination system is a system consisting of a cyclization recombination enzyme (Cre) and its recognizable specific DNA sequence (Locus of x (cross)-over, i.e. Lox A two-component gene editing system consisting of two sites. Lox The orientation of the insertion site allows for DNA insertion and integration. Lox (Site orientation). However, in filamentous fungi, orthogonal orientation is utilized. Lox The feasibility and effectiveness of using sequence and Cre recombination to achieve multi-site, large-scale gene insertion have not yet been studied. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the purpose of this invention is to provide an engineered strain that produces high levels of echinocandin B, along with its construction method and applications. This invention utilizes metabolic engineering strategies to systematically enhance the functional and regulatory genes of the echinocandin B synthesis pathway in *Aspergillus nidulans*. aniF , aniF 2. aniG , aniH , aniI , aniJ , aniK ) and linoleic acid precursor synthesis gene ( odeA By utilizing the synergistic expression of multiple genes, the yield of echinocandin B was significantly increased.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] As a first aspect of the present invention, a method for constructing an engineered strain that produces high levels of echinocandin B is provided, wherein Aspergillus nidulans is modified to obtain a strain with non-homologous end-joint defects. NkuA Mutation), pyridoxine malnutrition ( PyroA Mutations), riboflavin deficiency ( RiboB (Mutant) strain B-NPRm; subsequently, orthogonal cross-linking was introduced using CRISPR / Cas9. Lox site LoxP and Lox2272 A chassis cell strain B-NPRm-2Lox was constructed; then Cre / LoxP and Cre / Lox2272 Reorganize the system, respectively aniF , aniF2 , [[ID=(24]]aniG , aniH , aniI , aniK At least one of the genes and aniJ and odeA The gene overexpression cassette was integrated into the genome to obtain an engineered strain that produces high levels of echinocandin B.

[0009] In some embodiments of the present invention, the method for constructing the engineered strain that produces high levels of echinocandin B includes the following steps:

[0010] S1, an engineered strain B-NPRm with non-homologous end junction defects, pyridoxine auxotrophic and riboflavin auxotrophic was constructed based on Aspergillus nidulans;

[0011] S2 will have orthogonal Lox site LoxP and Lox2272The two chromosome landing pads were introduced into the engineered strain B-NPRm obtained in step S1 to obtain the chassis cell strain B-NPRm-2Lox, which can be used for Cre / LoxP and Cre / Lox2272 recombination; and the AniJ overexpression strain CJOE was constructed based on the obtained engineered strain.

[0012] S3, Constructing a Cre recombinase expression vector and its use for overexpressing at least one of the following genes. Cre / LoxP Recombinant donor vector: aniF , aniF 2. aniG , aniH , aniI and aniK ;

[0013] The above vectors were co-transformed into the AniJ overexpression strain CJOE obtained in step S2. LoxP At the locus, engineered strains overexpressing the Ani gene were obtained;

[0014] S4, build Cre / Lox2272 The donor vector required for recombinant-mediated OdeA overexpression was co-transformed with the Cre recombinase expression vector obtained in step S3 into the engineered strain overexpressing the Ani gene obtained in step S3. Lox2272 By identifying the site, an engineered strain that produces high levels of echinocandin B was obtained.

[0015] In step S1, a structure containing filamentous fungal replication elements, hygromycin B resistance genes, bacterial replication elements, ampicillin resistance genes, and Aspergillus nidulans is constructed. tef1 promoter AnP tef1 and Termination Sub [[ID=4(5]]AnT tef1 Driven cytosine editor encoding sequences and targeting NkuA , PyroA , RiboB A bifunctional vector containing the sgRNA of the gene was used and transformed into Aspergillus nidulans strain BGCm5 to obtain engineered strain B-NPRm with non-homologous end junction defects, pyridoxine auxotrophy, and riboflavin auxotrophy.

[0016] In step S2, the CRISPR / Cas9 method is used to generate orthogonal... Lox site LoxP and Lox2272 The two chromosome landing pads were sequentially introduced into the genomic DNA of two different chromosomes of the engineered strain B-NPRm obtained in step S1 to obtain strain B-NPRm-2Lox, which can be used for Cre / LoxP and Cre / Lox2272 Reorganization.

[0017] In step S2, the pathway-specific regulatory factor encoding gene was inserted into the obtained strain B-NPRm-2Lox using the CRISPR / Cas9 gene editing method. aniJ Replace the promoter with a strong promoter Ptef1 To obtain strain CJOE, and achieve aniJ Overexpression.

[0018] In step S2, the LoxP and ​ Site integration is achieved via a homologous recombination donor vector, which contains... ​ or ​ Sequence and homologous arms.

[0019] In step S3, the Cre recombinase expression vector pUC-Cre contains ​ element, ​ Components and a fungicide made of Aspergillus nidus ​ Promoter and terminator-driven Cre recombinase expression cassette.

[0020] Furthermore, in step S3, the engineered strains overexpressing the Ani gene include those expressing... ​ , ​ 2. ​ , ​ , ​ or ​ The strains AniFOE, AniHOE, AniIOE, AniF2OE, AniGOE, or AniKOE, and co-expressed strains ​ , ​ 2. ​ , ​ , ​ , ​ AniJGFKIHF2OE.

[0021] Furthermore, in step S3, ​ The recombinant donor vector was used to overexpress the Lox2272 site of the AniJGFKIHF2OE gene to obtain the engineered strain AniJGFKIHF2OdeAOE.

[0022] In this invention, the ​ , ​ 2. ​ , ​ , ​ The genes encode oxidases in the echinocandy B biosynthesis pathway. ​ It encodes an acyl-AMP ligase.

[0023] In some embodiments of the present invention, a method is provided to enhance the above-mentioned echinocandycin B synthesis gene cluster ( ​The key genes in the gene were used to construct a high-yield echinocin B engineered strain.

[0024] In Aspergillus nidus ( ​ )middle, ​ The gene cluster is a known gene cluster responsible for the biosynthesis of echinocandin B. Among them: AniA is a nonribosomal peptide synthase (NRPS) responsible for the assembly of the six-membered cyclic peptide backbone of echinocandin B; AniI is an acyl-AMP ligase responsible for the activation of the echinocandin B precursor linoleic acid; AniF, AniF2, AniG, AniH, and AniK are oxygenases responsible for the hydroxylation of specific amino acid residues in the six-membered cyclic peptide; and AniJ regulates… ​ The gene cluster contains specific transcriptional activators expressed by each gene. Recent studies have shown that insufficient expression levels of these genes during echinocandy B synthesis lead to a shortage of related precursors, which is a key factor limiting its efficient production. However, due to the lack of large-fragment, multi-site genome integration technology, no technical solutions have been reported for simultaneously combining and overexpressing these genes to increase echinocandy B production. Furthermore, since linoleic acid is a precursor of echinocandy B, key enzymes in its synthetic pathway (such as those in the linoleic acid synthesis pathway) are also crucial. ​ 12-Fatty acid desaturase OdeA is also closely related to the biosynthesis of echinocandycin B.

[0025] Furthermore, in step S4, ​ Gene coding ​ 12-Fatty acid desaturase; overexpression of this gene can increase the supply of linoleic acid, the precursor of echinocandycin B.

[0026] Compared to other gene editing systems such as CRISPR / Cas9, the Cre / ​ The system exhibits higher editing efficiency when mediating the insertion and integration of large DNA fragments of tens of kb; furthermore, ​ There are multiple orthogonal mutants at the site (such as...) ​ and ​ (etc.), which can achieve orthogonal, non-cross-reactive genome integration.

[0027] As a second aspect of the present invention, it is provided that the engineered strain obtained by the method for constructing the high-yielding echinocandin B engineered strain described in the first aspect is provided.

[0028] As a third aspect of the invention, the application of the engineered strain described in the third aspect in the fermentation production of echinocandin B is provided.

[0029] As a fourth aspect of the present invention, a method for producing echinocandin B by fermentation is provided, comprising the following steps:

[0030] The spores of the engineered strain that produces high levels of echinocandin B, as described in the first aspect, were inoculated into PDB liquid medium and cultured for 1 to 3 days at 25℃±5℃ and 200~400 rpm. Then, the seed culture was inoculated into the fermentation medium and cultured for another 6 to 12 days at 25℃±5℃ and 200~240 rpm. After fermentation, the mycelium of the fermentation broth was centrifuged, resuspended in an alcohol reagent, extracted, centrifuged, and the supernatant was collected and filtered to obtain the final product.

[0031] The beneficial effects achieved by one or more embodiments of the present invention described above are as follows:

[0032] 1. This invention is the first to establish an orthogonal Cre-based system in echinocandin B producing strains. ​ The system utilizes multi-site, large-fragment DNA genome integration technology; based on this, key genes in the echinocandin B biosynthetic pathway are overexpressed, and finally, a cell factory for the efficient synthesis of echinocandin B is established through metabolic engineering methods.

[0033] 2. The echinocandin B yield of the engineered strain provided by this invention is 9.5-18.6 times that of strain B-NPRm. Based on AniJ overexpression, the echinocandin B yield (880.5 mg / L) of strain AniJGFKIHF2OE, which simultaneously overexpresses AniK, AniG, AniI, AniH, AniF, and AniF2, is significantly increased, reaching 16.6 times that of strain B-NPRm (53.2 mg / L). This discovery of a synergistic enhancement of echinocandin B yield through combined gene overexpression has not been reported in previous studies.

[0034] 3. To improve linoleic acid supply, the AniJGFKIHF2-OdeAOE strain was obtained by further overexpressing OdeA on the AniJGFKIHF2OE strain. This strain produced 972.8 mg / L of echinocandin B after fermentation, which is 18.3 times that of strain B-NPRm. This finding has not been reported in previous studies. These results indicate that simultaneous overexpression of genes related to echinocandin B synthesis can significantly improve its production efficiency and reduce byproducts, thus creating conditions for its industrial production.

[0035] 4. The echinocandin B produced by the engineered strain provided by this invention, during fed-batch fermentation, the optimal strain AniJGFKIHF2-OdeAOE achieved a yield of 2.8 g / L after 12 days of fermentation, which greatly improved production efficiency. Attached Figure Description

[0036] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0037] ​ This diagram illustrates the biosynthetic gene cluster and pathway of echinocandy B. In this diagram, A represents the biosynthetic gene cluster of echinocandy B, and B represents the biosynthetic pathway of echinocandy B.

[0038] ​ To utilize orthogonal ​ and ​ A schematic diagram illustrating the dual-site integration of the Aspergillus nidulans genome.

[0039] ​ In Example 2, the nCas9-CBE cytosine editor was used to... ​ , ​ and ​ The image shows the plasmid used for simultaneous gene editing at the same site, as well as the results of gene editing in five single clones after transformation. In the image, A represents the cytosine editor expression plasmid. ​ The graph shows the sequencing results of genes related to the mutant strain after base editing (B).

[0040] ​ In Example 2, Cas9 gene editing technology was used to edit B-MPRm strains. ​ Genes and ​ Insertion into genes ​ and ​ The sequence serves as a schematic diagram of the landing pad for Cre recombination. Where A represents... ​ Insertion into genes ​ A schematic diagram of the site, where B represents the location. ​ Site insertion ​ A schematic diagram of the site.

[0041] ​ Example 3 uses Cas9 gene editing technology to edit the B-NPRm-2Lox strain. ​ The promoter was replaced with ​ A schematic diagram of a strong promoter used to obtain strain CJOE.

[0042] ​ For the construction of Example 4 for ​ Recombinant donor vector ​ 2 ​ The plasmid contains ​ Filtering markers are integrated into Cre through recombination. ​ Genes ​ The diagram illustrates the process of obtaining strain AniJGFKIHF2OE at the locus.

[0043] ​ In Example 5, a system was constructed for... ​ Recombinant donor vector ​And a schematic diagram of the process of constructing strain AniJGFKIHF2-OdeAOE.

[0044] ​ This is a graph showing the changes in echinocandin B yield and cell dry weight during the fed-batch fermentation of the engineered strains in Example 6. In this graph, A represents the echinocandin yield analysis of AniJGFKIHF2-OdeAOE and CJOE; B represents a comparison of the growth status of the strains.

[0045] ​ The figures show the product analysis and yield comparison of the engineered strain in Example 6. In the figures, A represents the general structural formulas of echinocandin B, echinocandin C, and echinocandin D; B represents the high-resolution mass spectrometry of echinocandin B; C represents the high-resolution mass spectrometry of echinocandin C; D represents the high-resolution mass spectrometry of echinocandin D; and E represents the yield analysis of echinocandin B obtained by the engineered strain obtained in this invention during shake-flask fermentation. Detailed Implementation

[0046] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0047] The present invention will be further described below with reference to the embodiments.

[0048] This invention provides an engineered strain that produces high levels of echinocandin B, its construction method, and its applications. The construction process is as follows: ​ As shown in Figures A and B, the process includes the following:

[0049] In some embodiments of the present invention, the non-homologous end-linking pathway gene of Aspergillus nidulans BGCm5 is analyzed based on the CRISPR / nCas9-CBE method. ​ ) and key genes for pyridoxine synthesis ( ​ ) and key genes for riboflavin synthesis ( ​ Co-inactivation editing was performed to construct an engineered strain B-NPRm with NHEJ deficiency and pyridoxine and riboflavin nutritional deficiencies.

[0050] In some embodiments of the present invention, such as ​ As shown, CRISPR / Cas9-mediated homologous recombination repair will bring... ​ and ​ The chromosome landing pads at the site were sequentially introduced into the genomic DNA of two different chromosomes in the engineered strain B-NPRm to obtain a material usable for Cre / ​ and Cre / ​ Recombinant chassis cell strain B-NPRm-2Lox.

[0051] In some embodiments of the present invention, the pathway-specific regulatory factor encoding gene is inserted into strain B-NPRm-2Lox using the CRISPR / Cas9 gene editing method. ​ Replace the promoter with a strong promoter ​ strain CJOE was obtained.

[0052] In some embodiments of the present invention, Cre recombinase expression vectors suitable for filamentous fungi are constructed. ​ And Cre / for overexpressing AniF, AniF2, AniG, AniH, AniI, and AniK alone or in combination. ​ Recombinant donor vector ​ or ​ ​ 2 or ​ or ​ or ​ These plasmids contain ​ Screening marker genes; based on Cre / ​ Recombination-mediated insertion integration involves inserting and integrating the donor vector into the CJOE strain. ​ The site was used to obtain engineered strains AniJGFKIHF2OE, AniKOE, AniHFOE, AniF2OE, AniHOE, AniGOE, and AniIOE, which are collectively referred to as engineered strains overexpressing the Ani gene.

[0053] In some embodiments of the present invention, Cre / is constructed for overexpressing OdeA. ​ Recombinant donor vector ​ The plasmid contains ​ Screening for marker genes. Based on Cre / ​ Recombination-mediated insertion integration involves inserting and integrating the donor vector into the engineered strain AniJGFKIHF2OE. ​ The engineered strain AniJGFKIHF2-OdeAOE was obtained by identifying the site.

[0054] Example 1: Method for constructing chassis cells with defects in non-homologous recombination end joining (NHEJ) and pyridoxine and riboflavin synthesis

[0055] The echinocandin B-producing strain is derived from the evolved strain *Aspergillus nidulans* BGCm5, which is the subject of a patent application ("A Method for Continuous Evolution of Filamentous Fungi Based on a Base Editor and Its Application," application number 202410983217.2). The entire contents of the aforementioned patent are incorporated herein by reference. For this strain, a multi-site cytosine base editor (…) was used… ​ ​The construction method can be found in the published paper (https: / / doi.org / 10.1186 / s12934-024-02577-w). (Plasmid) ​ The vector contains filamentous fungal replication elements ( ​ Hygromycin B resistance gene ( ​ Aspergillus nidus ​ promoter ( ​ tef1 ) and terminator ( ​ tef1 ) driven cytosine editor (hA3A) (Y103F) -nCas9) coding sequence; nCas9 can target the target gene under the guidance of sgRNA and form a DNA single-strand break, cytosine deaminase (hA3A) (Y130F) This vector can achieve the conversion of cytosine C to thymine T at the target editing site; in addition, it contains a tRNA-sgRNA expression array, in which tRNA can act as a promoter to drive the array to express RNA, and under the action of intracellular endonuclease, produce the target RNA. ​ , ​ as well as ​ The sgRNA targeting sequence at the site. Using this plasmid, multiple sgRNAs can be simultaneously expressed, targeting strains that are inactivated in a single dose. ​ (NHEJ key genes) ​ (Key genes for pyridoxine synthesis) and ​ (Key genes for riboflavin synthesis) to construct a dual auxotrophic strain. ​ Basic structure of plasmids as follows ​ As shown in Figure A.

[0056] Transformation of Aspergillus nidulans was used to introduce non-homologous end junction defects as well as pyridoxine and riboflavin nutritional deficiencies.

[0057] plasmid ​ Polyethylene glycol (PEG) conversion was used to transform Aspergillus nidulans BGCm5 protoplasts, and the results were obtained through its... ​ Gene, ​ Genes and ​ A stop codon (TAA, TAG, or TGA) is introduced into the coding sequence of the gene, thereby achieving co-inactivation of three genes. The specific operation method is as follows:

[0058] Transformation of *Aspergillus nidulans*: *Aspergillus nidulans* strain BGCm5, cryopreserved in liquid nitrogen, was plated onto GMM agar plates. After 5 days of culture, spores were scraped from the plates and transferred to 50 mL of GMM liquid medium. The medium was incubated at 37°C and 200 rpm for 12 h. After centrifugation (5,000 g, 10 min, room temperature), the supernatant was discarded, and the mycelium was placed in 30 mL of enzymatic digestion buffer (containing 1.2 g of VinoTaste Pro and 0.09 g of Yatalase) and digested at 30°C and 90 rpm for 3 h. The digestion product was transferred to a 50 mL centrifuge tube, and 15 mL of pre-chilled Trapping Buffer (containing 0.6 M Sorbitol, 0.1 M Tris-HCl, pH 7.0) was slowly added. The tube was then centrifuged (2,430 g, 2 min, 4°C). The protoplasts in the intercalation layer were transferred to a clean 50 mL centrifuge tube using a 1 mL pipette tip, and 3 volumes of pre-chilled STC were added. The protoplasts were resuspended in Buffer (containing 1.2 M Sorbitol, 0.01 M CaCl2, 0.01 M Tris-HCl, pH 7.5), followed by centrifugation (2,800 g, 10 min, 4 °C) and the supernatant was discarded. The protoplasts were resuspended in 0.1–0.5 mL of pre-chilled STC buffer and diluted to 10⁻⁶. 7 CFU / mL; Take 0.05 mL of protoplast suspension and add 5 µ g ​ The plasmid DNA was slowly mixed with a 0.02 mL pipette tip and then placed on ice for 3 h. 0.6 mL of PEG solution (containing 60% PEG4000, 0.05 M CaCl2, 0.05 M Tris-HCl, pH=7.5) was added and gently pipetted to mix. The mixture was then incubated at room temperature for 20 min. The transformation product was plated on GMM selection plates containing pyridoxine (0.5 mg / L), riboflavin (0.12 mg / L), 100 mg / L hygromycin B and 1.2 M sorbitol and incubated upside down at 30 °C for 3-5 days.

[0059] The GMM basal medium formulation is as follows: 10 g / L glucose, 20 mM ammonium nitrate, 0.52 g / L KCl, 0.52 g / L MgSO4•7H2O, 1.52 g / L KH2PO4, 1 mL trace elements, pH=6.5. The trace element composition (per 100 mL) is as follows: 2.20 g ZnSO4•7H2O, 1.10 g H3BO3, 0.50 g MnCl2•4H2O, 0.16 g FeSO4•7H2O, 0.16 g CoCl2•5H2O, 0.16 g CuSO4•5H2O, 0.11 g (NH4)6Mo7O24 • 4H2O, 5.00 g Na4EDTA.

[0060] Transformants were subjected to gene sequence identification and trophic auxotroph verification: Single-clonal transformants were selected, and genome extraction was performed using a rapid fungal genomic DNA extraction kit (Shanghai Sangon Biotech, B518229). Primer pairs SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, and SEQ ID NO.5 and SEQ ID NO.6 were used to sequence the genome. ​ and ​ as well as ​ PCR amplification was performed on the site, and the amplified product was then sequenced for identification.

[0061] Sequencing results show that ( ​ (B) Two strains of the mutant strain (colonies 3 and 5) were found. NkuA and PyroA as well as RiboB Stop codons were introduced in all strains, inactivating the mutant gene. The resulting mutant strain was named *Aspergillus nidulans* B-NPRm (i.e., BGCm5-). NkuA - PyroA - RiboB mutant).

[0062] The plasmid in the positive transformant was removed: the positive transformant strain was cultured and transformed three times on GMM plates containing pyridoxine (0.5 mg / L) and riboflavin (0.12 mg / L) to remove the plasmid, and the strain was preserved in glycerol for later use.

[0063] Example 2: Having LoxP and Lox2272 Methods for constructing chassis cells of dual-site landing pads

[0064] Based on the B-NPRm strain obtained in Example 1, orthogonal gene insertions were performed at different sites in the genome of Aspergillus nidulans B-NPRm strain using CRISPR-Cas9 gene insertion technology. LoxP and Lox2272 The site serves as a landing pad for Cre recombination.

[0065] Step 1: Used for lox Construction of vectors for site insertion into the genome.

[0066] First, construct the transformation plasmid. pUC-StcA-Target+LoxP-Donor ( Figure 4 (A) is used to... LoxP Insertion site into the genome stcAThe gene (AN7825) locus. This vector contains bacterial replication elements ( Ori ), ampicillin resistance gene ( AmpR ), targeted stcA The sgRNA expression cassette at the gene locus, and a segment used to express... LoxP Site insertion StcA The gene donor fragment; among which, the sgRNA expression cassette consists of tRNA and sgRNA, where tRNA acts as a promoter to drive the expression of the cassette, while sgRNA... tcA The target sequence at the site is 5'-GTGGAACATGACACACTGCC-3' (SEQ ID NO.7). Furthermore, the homologous recombination donor is... stcA upstream / downstream homologous arms of the site ( StcA_Up / StcA_Dn ) and those sandwiched between the two LoxP The site sequence ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO.8) is composed of the following: stcA After the site is cut by Cas9, it is repaired in a targeted manner to ultimately achieve... LoxP Precise import of loci.

[0067] The vector was constructed as follows: the target was synthesized by Genewiz. StcA The sgRNA expression cassette sequence at the site (SEQ ID NO. 9) was used as a template to design primer pairs SEQ ID NO. 10 and SEQ ID NO. 11, and a fragment (0.51 kb) containing the assembly adapter was amplified using SEQ ID NO. 9 as a template. Primer pairs SEQ ID NO. 12 and SEQ ID NO. 13, as well as primer pairs SEQ ID NO. 14 and SEQ ID NO. 15, were designed to amplify fragments containing the corresponding vector assembly adapters from Aspergillus nidulans gDNA. StcA_ Up (0.92 kb) and LoxP+StcA_Dn (0.89 kb) fragment; design primer pairs SEQ ID NO.16 and SEQ ID NO.17 and primer pairs SEQ ID NO.18 and SEQ ID NO.19, and from... pUC19 The vectors were amplified with corresponding vector assembly connectors. AmpR (1.06 kb) and Ori (0.76 kb) element fragments; after recovering the above 5 fragments, fragment assembly was performed using the ClonExpress Ultra One Step Cloning Kit (Nanjing Novizan, C117-02), and the recombinant products were transformed into E. coli and the transformants were identified, finally obtaining pUC-StcA-Target+LoxP-Donor Vector plasmid.

[0068] Then, build pUC-AfoG-Target+Lox2272-Donor vector plasmid ( Figure 4 (B), used for insertion at the AfoG site. Lox2272 Site. This vector contains E. coli replication elements. Ori and resistance markers AmpR It contains an sgRNA expression cassette and a recombinant donor fragment; its sgRNA expression cassette contains a target AfoG The target sequence at the site is 5'-AGCACCGCACTCGCTTCTCC-3' (SEQ ID NO.20); while the recombinant donor is... Lox2272 upstream / downstream homologous arms of the site ( AfoG _Up / AfoG _Dn) and what lies between them Lox2272 The site sequence 5'-ATAACTTCGTATAAAGTATCCTATACGAAGTTAT-3' (SEQ ID NO.21) is present and can be used to... AfoG After the site is cut by Cas9, it is directionally repaired for use Lox2272 Precise import of loci.

[0069] The vector was constructed as follows: the target was synthesized by Genewiz. AfoG The sgRNA expression cassette sequence of the gene locus, containing a 20 bp sequence targeting the AfoG gene (SEQ ID NO. 20), was used as a template to amplify a fragment (0.51 kb) containing the recombination adapter using primer pairs SEQ ID NO. 10 and SEQ ID NO. 11. Primer pairs SEQ ID NO. 22 and SEQ ID NO. 23, and primer pairs SEQ ID NO. 24 and SEQ ID NO. 25 were designed, and fragments containing the corresponding vector assembly adapters were amplified from the gDNA of *Aspergillus nidulans*. AfoG_Up (0.84 kb) and LoxP+AfoG_ Dn (0.87 kb) fragment; using primer pairs SEQ ID NO.16 and SEQ ID NO.17 and primer pairs SEQ ID NO.18 and SEQ ID NO.19, and from... pUC19 The vectors were amplified with corresponding vector assembly connectors. AmpR (1.06 kb) and Ori(0.76 kb) element fragments; after recovering the above 5 fragments, the fragments were assembled into a recombinant vector using the ClonExpress UltraOne Step Cloning Kit (Nanjing Novizan, C117-02), and the recombinant products were transformed into E. coli and the transformants were identified by PCR and sequencing. pUC19-AfoG-Target+Lox2272- Donor Vector plasmid.

[0070] Step 2: Iterative transformation of Aspergillus nidulans to introduce LoxP and Lox2272 Landing pad at the site.

[0071] Based on the CRISPR / Cas9 system, and using polyethylene glycol (PEG) transformation, Aspergillus nidulans B-NPRm was transformed. LoxP and Lox2272 Sequences are replaced and integrated into it respectively StcA Genes and AfoG In the structure of the gene, then introduce substances that can be used for Cre / LoxP Recombination and Cre / Lox2272 Recombinant chromosome landing pad. The specific operating procedure is as follows:

[0072] Transformation of Aspergillus nidulans: Aspergillus nidulans B-NPRm glycerol strain, frozen in liquid nitrogen, was plated on GMM agar plates. After culturing for 5 days, spores were scraped from the plates and transferred to 50 mL of GMM liquid medium. The medium was then incubated at 28°C and 200 rpm for 12 h. Following the protoplast preparation method in Example 1, the protoplasts were diluted to 10⁻¹⁰ with STC Buffer. 7 CFU / mL; 0.05 mL of protoplast suspension was added to the lyophilized plasmid DNA powder and slowly mixed with a 0.02 mL pipette tip, then placed on ice for 3 h; 0.6 mL of PEG solution was added and gently pipetted to mix, then incubated at room temperature for 20 min; the transformation product was plated on GMM (containing 100 mg / L hygromycin B and 1.2 M sorbitol) selection plates and cultured at 30 °C for 5 days. The first round of transformation used the Cas9 expression plasmid. pFC332 (Addgene # 87845) and pUC-StcA-Target+LoxP-Donor The vector plasmid was used to obtain a transformant named B-NPRm-LoxP; then the resulting transformant was subjected to a second round of transformation using... pFC332 vector plasmids and pUC-AfoG-Target+Lox2272-Donor The vector plasmid; the obtained transformant was named B-NPRm-2Lox, and this strain simultaneously contains Loxp and Lox2272 Landing mat, and can be used PyroA and RiboBAs a nutritional screening marker.

[0073] After colony PCR and sequencing identification of the transformants, plasmid removal was performed on the positive transformants: the Aspergillus nidulans B-NPRm-2Lox positive transformant strain was transferred to complete medium more than 3 times. After plasmid removal, the strain was preserved in glycerol for subsequent use.

[0074] Example 3: Overexpression of pathway-specific transcription factor AniJ to activate the expression of the echinocandin B gene cluster

[0075] Based on the auxotrophic strain B-NPRm-2Lox obtained in Example 2, a transformation plasmid was constructed. pUC-sgRNA+ Ptef1-AniJ-Donor ( Figure 5 Using the CRISPR-Cas9 gene editing method, the echinocandin B gene cluster was... aniJ Replace the promoter with a strong promoter Ptef1 ,accomplish aniJ Overexpression.

[0076] pUC-sgRNA+Ptef1-AniJ-Donor The vector construction method is as follows: the target was synthesized by Genewiz. aniJ The sgRNA expression cassette sequence of the gene locus, containing a 20 bp sequence targeting the aniJ promoter (SEQ ID NO. 26), was used as a template to amplify a fragment (0.51 kb) with a recombination adapter using primer pairs SEQ ID NO. 10 and SEQ ID NO. 11. Primers SEQ ID NO. 27 and SEQ ID NO. 28, and primer pairs SEQ ID NO. 29 and SEQ ID NO. 30 were designed to amplify AniJ_UP and AniJ_Dn fragments with corresponding vector assembly adapters from Aspergillus nidulans gDNA. Primers SEQ ID NO. 31 and SEQ ID NO. 32 were used to amplify a strong promoter from Aspergillus nidulans gDNA. Ptef1 Fragments. Using primer pairs SEQ ID NO.16 and SEQ ID NO.17, and primer pairs SEQ ID NO.18 and SEQ ID NO.19, AmpR (1.06 kb) and Ori (0.76 kb) element fragments with corresponding vector assembly adapters were amplified from the pUC19 vector. After recovering the above five fragments, recombinant vectors were assembled using the ClonExpressUltraOneStepCloning Kit (Nanjing Novizan, C117-02). The recombinant products were transformed into E. coli, and the transformants were identified by PCR and sequencing. Finally, the desired results were obtained. pUC-sgRNA+Ptef1-AniJ- Donor .

[0077] Using the protoplast preparation and PEG-mediated transformation described in Example 1, pUC-sgRNA+Ptef1-AniJ-Donor with Cas9 The expression plasmid was transformed into Aspergillus nidulans B-NPRm-2Lox. After colony PCR verification, the positive transformant was named CJOE.

[0078] Example 4: Based on Cre / LoxP Build reinforcement ani High-yield echinocandin B engineered strains of key genes in gene cluster

[0079] This embodiment provides a method for enhancing the synthesis of gene clusters by echinocandin B (… ani The key genes in the gene were used to construct a high-yield echinocandin B engineered strain. Based on the AniJ overexpression strain (CJOE) obtained in Example 3, and using Cre / LoxP Recombination-mediated insertion integration was constructed, and Aspergillus nidulans and Aspergillus oryzae were introduced. Aspergillus oryzae ) and Aspergillus niger ( Aspergillus niger This study utilizes an expression cassette driven by a strong promoter to overexpress key genes in the echinocandin B synthesis pathway; specifically, it enhances the production of echinocandin B by strengthening the five oxygenases (AniF, AniF2, AniG, AniH, AniK) and the acyl-AMP ligase (AniI) required for its synthesis. First, a Cre recombinase expression vector suitable for filamentous fungi is constructed using Gibson assembly. pUC-Cre Subsequently, fusion PCR was used to assemble each strong promoter with key genomes of the echinocandin B synthesis pathway into complete expression cassettes, and yeast assembly was used to connect each expression cassette with… LoxP The necessary vector elements, such as sequences and RiboB screening markers, are assembled into a single unit that can be used in Cre / LoxP Recombinant donor vector; finally, using Cre / LoxP The recombination method involves inserting and integrating the donor vector into Aspergillus nidulans CJOE. LoxP To obtain strains that produce high levels of echinocandin B, the following methods are used:

[0080] Step 1: Construct a vector for expressing Cre recombinase in Aspergillus nidulans.

[0081] Construct a 4.18 kb file. pUC-Cre The basic structure of the vector plasmid is as follows: Figure 6 As shown: This vector contains substances that enable the plasmid to replicate autonomously in bacteria. Ori Components, and the ability to confer ampicillin resistance to bacteria. AmpR Components; simultaneously, the carrier also contains a component of Aspergillus nidulans. tef1Promoter and terminator driven Cre recombinase expression cassette ( AnP tef1 -Cre-AnT tef1 The carrier is constructed as follows:

[0082] Primer design and gene amplification: Primer pairs SEQ ID NO. 33 and SEQ ID NO. 34 were designed, and the insert fragment (1.05 kb) with the assembly adapter was amplified using the plasmid pBF3060 (Addgene #26853) containing the Cre gene as a template; primer pairs SEQ ID NO. 35 and SEQ ID NO. 36 and primer pairs SEQ ID NO. 37 and SEQ ID NO. 38 were designed, and the amplification was carried out using... pFC332 Using the (Addgene # 87845) vector as a template, gene sequences with corresponding assembly adapters were amplified. AnP tef1 and AnT tef1 Insert fragments (0.92 kb and 0.51 kb); use primer pair SEQ ID NO.39 and SEQ ID NO.40 from pUC19 Amplification of vector containing Ori , AmpR The vector backbone (1.79 kb) included components and assembly adapters. The above PCR amplification reaction was performed using 2×PhantaUniFi Master Mix (Nanjing Novizan, P526-03), and the samples were purified by gel extraction. PCR reactions were performed according to the manufacturer's instructions.

[0083] pUC-Cre Vector assembly and E. coli transformation: Homologous recombination (i.e., vector assembly) was performed on the three gel-purified insert fragments and vector backbone using the ClonExpress UltraOne Step Cloning Kit (Nanjing Novizan, C117-02). The assembled products were then transformed into E. coli using Trelief 5α competent cells (Beijing Qingke, TSC-C01). After transformation, the E. coli suspension was plated on LB agar plates containing carbenicillin sodium (100 mg / L) and incubated upside down at 37°C for 16 h. Homologous recombination and E. coli transformation conditions were as per the manufacturer's instructions (hereinafter the same).

[0084] Identification of the E. coli vector and plasmid: Single-clone transformants were selected and identified by colony PCR. Plasmids were extracted from the transformants identified by sequencing, and finally obtained... pUC-Cre Vector plasmid.

[0085] Step 2: Constructing a system containing... LoxPPlasmids for overexpressing the genes AniF, AniF2, AniG, AniH, AniI, and AniK at specific sites and combinations.

[0086] Constructing a combination of overexpression of AniF, AniF2, AniG, AniH, AniI, and AniK pytR-LoxP-AniK-AniF- AniF 2 -AniI-AniH-AniG The basic structure of the vector plasmid is as follows: Figure 6 As shown: This carrier contains LoxP Site sequence, riboflavin selection marker element ( AfRiboB ), bacterial replication elements ( p15A ), ampicillin resistance gene ( AmpR ), yeast replication element ( CEN6 ), uracil synthesis gene ( URA3 );in, LoxP This allows the vector plasmid to be inserted and integrated into a space containing Cre recombinase under the mediation of Cre recombinase. LoxP On the chromosome landing pad at the locus, Aspergillus fumigatus ( Aspergillus fumigatus (Source) AfRiboB It can endow filamentous fungi with the ability to synthesize riboflavin; in addition, the vector also carries Aspergillus nidulans. h3h4 Bidirectional promoter-driven bidirectional expression cassette of oxygenases AniH and AniG ( T AniH -AniH-AnP h3h4 -AniG-T AniG ), by Aspergillus oryzae gpdA1 Promoter-driven acyl-AMP ligase AniI expression cassette AoP gpdA1 -AniI-T AniI ), by Aspergillus oryzae h3h4 Bidirectional promoter-driven bidirectional expression cassette of oxygenases AniK and AniF ( T AniK -AniK-AoP h3h4 -AniF-T AniF ), and Aspergillus niger gpdA Promoter-driven oxygenase AniF2 expression cassette AgP gpdA -AniF 2 -T AniF2 This vector can achieve overexpression of the aforementioned protein-coding genes. The method for constructing this vector is as follows:

[0087] Primer design and gene amplification: Primers containing [missing information - likely a specific compound or ingredient] were synthesized by Genewiz. LoxP - AmpR - p15A -CEN6-URA3 Based on the vector backbone coding sequence (SEQ ID NO. 41), primer pairs SEQ ID NO. 42 and SEQ ID NO. 43 were designed, and the vector with assembly adapters was amplified using SEQ ID NO. 41 as a template. LoxP - AmpR - p15A - CEN6-URA3 Vector backbone fragment (4.13 kb); primer pairs SEQ ID NO. 44 and SEQ ID NO. 45 were designed, and the riboflavin synthesis gene with assembly adapter was amplified from plasmid pCRI006 (Addgene #140199). AfRiboB Using SEQ ID NO. 46 and SEQ ID NO. 47 as screening markers, primer pairs were designed, and using Aspergillus nidulans BGCm5 gDNA as a template, primers with corresponding assembly adapters were amplified. AnP h3h4 Promoter fragment (0.83 kb); primer pairs SEQ ID NO. 48 and SEQ ID NO. 49 and primer pairs SEQ ID NO. 50 and SEQ ID NO. 51 were designed, and using Aspergillus oryzae RIB40 gDNA as a template, the corresponding assembly adapters were amplified. AoP gpdA1 as well as AoP h3h4 Promoter fragments (1.07 kb, 0.87 kb); primer pairs SEQ ID NO. 52 and SEQ ID NO. 53 were designed, and using the gDNA of Aspergillus niger ATCC16888 as a template, the corresponding assembly adapters were amplified. ​ gpdA Promoter fragment (0.93 kb); primer pairs SEQ ID NO. 54 and SEQ ID NO. 55, SEQ ID NO. 56 and SEQ ID NO. 57, SEQ ID NO. 58 and SEQ ID NO. 59, SEQ ID NO. 60 and SEQ ID NO. 61, SEQ ID NO. 62 and SEQ ID NO. 63, and SEQ ID NO. 64 and SEQ ID NO. 65 were designed, and primers were obtained from Aspergillus nidulans strain BGCm5. ​ Genes containing terminators and corresponding assembly adapters were amplified from the gene cluster (GenBank: KT806042.1). ​ AniK , AniF-T AniF , AniF 2 -TAniF2 , AniI-T AniI , AniH-T AniH as well as AniG-T AniG Excerpt.

[0088] Fusion PCR for gene expression cassette assembly: Promoter and functional gene fragment (0.1 pmol each) were placed in a 20°C container. μ The L PCR system was used, and 11 cycles of fusion PCR amplification were performed. Subsequently, primer pairs were used to amplify the gene expression cassette fragment containing the vector assembly adapter from the fusion product. Following this method, [the following steps were performed]... AniK-T AniK and AoP h3h4 and AniF-T AniF Fragments AoP gpdA1 and AniI-T AniI Fragments AnP tef1 and AniF 2 -T AniF2 Fragments, and AniH-T AniH and AnP h3h4 and AniG-T AniG The fragments were fused and amplified by PCR to obtain T AniK -AniK-AoP h3h4 -AniF-T AniF , AgP gpdA -AniF 2 - T AniF2 , AoP gpdA1 -AniI-T AniI as well as T AniH -AniH-AnP h3h4 -AniG-T AniG Expression box.

[0089] Yeast assembly and transformation of the vector: the vector backbone fragment LoxP - AmpR - p15A - CEN6-URA3 , AfRiboBThe screening marker gene and four expression cassette fragments (600 ng each) constructed by fusion PCR were co-transformed into Saccharomyces cerevisiae BY4741 competent cells (Beijing Cooler Master, CC301). After transformation, the Saccharomyces cerevisiae suspension was plated on SD / -Ura agar plates (Beijing Cooler Master, PM2272) and incubated upside down at 30°C for 48 h. The transformation conditions for Saccharomyces cerevisiae were as per the manufacturer's instructions.

[0090] Yeast identification and plasmid extraction of the vector: A portion of the cells of the single-clone yeast transformant were picked and lysed using yeast lysis buffer (Beijing Cooler Master, SK2420-A) and colony PCR was performed for identification. The yeast transformants identified by colony PCR were amplified and plasmids were extracted using SD / -Ura liquid medium (Beijing Cooler Master, PM2271) and a yeast plasmid extraction kit (Shanghai Sangon Biotech, B511245), respectively.

[0091] Transformation and identification of the plasmid in *E. coli*: *E. coli* were transformed with Trelief 5α competent cells (Beijing Qingke, TSC-C01). After transformation, the *E. coli* suspension was plated on LB agar plates containing carbenicillin sodium (100 mg / L) and incubated upside down at 37°C for 16 h. Single-clone *E. coli* transformants were picked, plasmids were extracted, and NGS sequencing was performed to verify the plasmids. pytR-LoxP-AniK-AniF-AniF 2 -AniI-AniH-AniG Donor vector plasmid.

[0092] Step 3: Constructing a system containing... LoxP Plasmids expressing AniF, AniF2, AniG, AniH, AniI, and AniK separately at specific sites.

[0093] by pytR-LoxP-AniK-AniF-AniF 2 -AniI-AniH-AniG Using the plasmid as a template, primer pairs SEQ ID NO. 43 and SEQ ID NO. 44 were used to amplify the vector backbone. LoxP - AmpR - p15A - CEN6-URA3 - AfRiboB Excerpt.

[0094] Amplification was performed using primer pairs SEQ ID NO. 66 and SEQ ID NO. 67. AoP h4 -AniK-T AniK Expression cassette; amplification using primer pairs SEQ ID NO. 68 and SEQ ID NO. 69. AoP h3 -AniF-T AniFExpression cassette; amplification using primer pairs SEQ ID NO. 70 and SEQ ID NO. 71. AgP gpdA -AniF 2 -T AniF2 Expression cassette; amplification using primer pairs SEQ ID NO. 72 and SEQ ID NO. 73. AoP gpdA1 -AniI-T AniI Expression cassette; amplification using primer pairs SEQ ID NO. 74 and SEQ ID NO. 75. AnP h3 -AniH-T AniH Expression cassette; amplification using primer pairs SEQ ID NO. 76 and SEQ ID NO. 77. AnP h4 - AniG-T AniG Expression boxes. The expression boxes described above are respectively connected to the carrier skeleton. LoxP - AmpR - p15A - CEN6-URA3 - AfRiboB The fragments were assembled using Gibson to obtain plasmids. pytR-LoxP-AniG, pytR-LoxP-AniH, pytR- LoxP-AniF, pytR-LoxP-AniF 2 , pytR-LoxP-AniI, pytR-LoxP-AniK It is used for single gene overexpression.

[0095] Step 4: Transform Aspergillus nidulans CJOE to achieve individual and combined overexpression of AniF, AniF2, AniG, AniH, AniI and AniK.

[0096] Based on Cre / LoxP The system was used to transform Aspergillus nidulans CJOE using polyethylene glycol (PEG) conversion, through its chromosome landing pad. LoxP Donor vectors containing strong promoters driving the expression cassettes of AniF, AniF2, AniG, AniH, AniI, and AniK were inserted at the target site to achieve co-expression of their coding genes. The specific procedure is as follows:

[0097] Transformation of Aspergillus nidulans: Mycelia of Aspergillus nidulans CJOE were cultured and protoplasts were prepared using the method in Example 1. The protoplasts were then diluted to 10 with STC Buffer. 7 CFU / mL; Take 0.05 mL of protoplast suspension and add 5 u g pUC-Cre plasmids and 5 u g pytR-LoxP-AniK-AniF-AniF 2 -AniH-AniG-AniIor pytR-LoxP- AniK or pytR-LoxP-AniF or pytR-LoxP-AniF 2 or pytR-LoxP-AniH or pytR-LoxP-AniG or pytR-LoxP-AniI .

[0098] Stir slowly with a 0.02 mL pipette tip and then place on ice for 3 h; add 0.6 mL of PEG solution and gently pipette to mix, then let stand at room temperature for 20 min; plate the transformation product on GMM (1.2 M sorbitol) screening plates that lack riboflavin but have added pyridoxine (0.5 mg / L) and incubate at 30 °C for 4-5 days.

[0099] Transformant identification: Single-clonal transformants were selected, and total genome extraction was performed using a fungal genomic DNA rapid extraction kit (Shanghai Sangon Biotech, B518229). After verification by colony PCR, the strains that simultaneously overexpressed AniF / F2 / G / H / I / K were named *Aspergillus nidus* AniJGFKIHF2OE; the strain overexpressing AniF was named *Aspergillus nidus* AniFOE; the strain overexpressing AniF2 was named *Aspergillus nidus* AniF2OE; the strain overexpressing AniH was named *Aspergillus nidus* AniHOE; the strain overexpressing AniK was named *Aspergillus nidus* AniKOE; the strain overexpressing AniG was named *Aspergillus nidus* AniGOE; and the strain overexpressing AniI was named *Aspergillus nidus* AniIOE.

[0100] Example 5: In Lox2272 Site insertion overexpression OdeA The gene expression cassette enhances the supply of linoleic acid required for the synthesis of echinocandin B.

[0101] This embodiment improves... ani Based on the expression of key genes in the gene cluster, a method for constructing a high-yield engineered strain by enhancing the synthesis of linoleic acid, the precursor of echinocandin B, is further provided. This strain is derived from the engineered strain AniJGFKIHF2OE obtained in Example 4. Lox2272 Recombination site inserted into the OdeA gene (encoding Δ 12-Fatty acid desaturase overexpression cassette, the structure of which is as follows: Figure 7 As shown.

[0102] First, the strong promoter was introduced using fusion PCR. AgP tef1 and odeA Genes were fused into a complete expression cassette, and the expression cassette was then assembled with Gibson DNA. Lox2272 Sequences and filter tags PyroA Genome loaded into donor vector pytP- Lox2272-OdeA In the middle; finally, using Cre / LoxD2 The recombination method involves inserting and integrating the donor vector into the Aspergillus nidulans strain AniJGFKIHF2OE. Lox2272 To obtain high-yield engineered strains, the following steps are taken:

[0103] Step 1: Construct Cre / overexpressing OdeA ​ The basic structure of the recombinant donor vector is as follows: ​ As shown: This carrier contains ​ Site sequence, pyridoxine screening marker element ( ​ ), bacterial replication elements ( ​ ), ampicillin resistance gene ( ​ ); among them, Aspergillus fumigatus ( ​ (Source) ​ This vector can confer the ability of filamentous fungi to synthesize pyridoxine; it also carries a vector derived from Aspergillus niger. ​ Startup driver ​ 12-Fatty Acid Desaturase OdeA Expression Kit ( ​ tef1 ​ OdeA This allows for the overexpression of its encoding gene. The vector construction method is as follows:

[0104] Primer design and gene amplification: Primers containing [missing information - likely a specific compound or ingredient] were synthesized by Genewiz. ​ - ​ - ​ - ​ The vector backbone encodes a DNA sequence that is similar to the vector backbone sequence SEQ ID NO.41, except that... ​ site was ​ Site substitution. Primers SEQ ID NO. 78 and SEQ ID NO. 79 were designed and... ​ - ​ - ​ - ​ Using plasmid pYFAC-pyroA (Addgene #168976) as a template, a vector backbone with an assembly adapter was amplified; primer pairs SEQ ID NO. 80 and SEQ ID NO. 81 were designed, and pyridoxine elements with assembly adapters were amplified using plasmid pYFAC-pyroA (Addgene #168976) as a template. ​ The inserted fragment (2.23 kb) was obtained; primer pairs SEQ ID NO. 82 and SEQ ID NO. 83 were designed, and the gDNA of Aspergillus niger ATCC16888 was used as a template to amplify the fragment containing the assembly adapter. ​ tef1Promoter fragment (0.92 kb); primer pairs SEQ ID NO. 84 and SEQ ID NO. 85 were designed, and using Aspergillus nidulans BGCm5 gDNA as a template, the promoter fragment containing the terminator and the corresponding assembly adapter was amplified. ​ OdeA Fragment (1.83 kb).

[0105] Expression cassette assembly (fusion PCR amplification): The above-amplified... ​ tef1 and ​ OdeA Fragments (0.1 pmol each) were placed at 20°C. ​ The L PCR system was used, and 11 cycles of fusion PCR amplification were performed. Subsequently, primer pairs SEQ ID NO. 82 and SEQ ID NO. 85 were used to amplify the vector assembly adapter from the fusion product. ​ tef1 ​ OdeA Expression box insertion fragment (2.71 kb).

[0106] Vector assembly and E. coli transformation: The pyridoxine auxotroph gene element insert fragment purified by gel extraction was processed using the ClonExpress Ultra One Step Cloning Kit (Nanjing Novizan, C117-02). ​ ), ​ tef1 ​ OdeA Expression box insertion fragments and carrier skeleton ( ​ - ​ - ​ The cells were recombinantly assembled, and the assembled product was then transformed into *E. coli* using Trelief 5α competent cells (Beijing Qingke, TSC-C01). After transformation, the *E. coli* suspension was plated on LB agar plates containing carbenicillin sodium (100 mg / L) and incubated upside down at 37°C for 16 h. Homologous recombination and *E. coli* transformation conditions were as per the manufacturer's instructions.

[0107] Identification of the vector's *E. coli* and plasmid: Single-clone transformants were selected for colony PCR identification; the transformant cultures that passed colony PCR identification were sent to Sangon Biotech Co., Ltd. for sequencing identification, and plasmids were extracted from the sequenced transformants, ultimately yielding a full-length 8.99 kb vector. ​ Vector plasmid.

[0108] Step 2: Transform Aspergillus nidulans to achieve OdeA overexpression.

[0109] Based on Cre / ​ The system was used to transform the Aspergillus nidus strain AniJGFKIHF2OE obtained in Example 3 using polyethylene glycol (PEG) transformation, and the chromosome landing pads were transformed. ​ A donor vector with a strong promoter-driven OdeA expression cassette is inserted at the target site to achieve overexpression of the encoding gene. The specific procedure is as follows:

[0110] Transformation of Aspergillus nidulans: Mycelia of Aspergillus nidulans AniJGFKIHF2-OE were cultured and prepared according to the fungal protoplast preparation method in Example 1. The protoplasts were then diluted to 10 with STC Buffer. 7 CFU / mL; Take 0.05 mL of protoplast suspension and add 5 u g ​ plasmid (constructed in Example 3) and 5 u g ​ The plasmid was mixed by slowly rinsing with a 0.02 mL pipette tip and then placed on ice for 2 h. 0.6 mL of PEG solution was added and gently mixed by pipetting, and then allowed to stand at room temperature for 20 min. The transformation product was plated on GMM (1.2 M sorbitol) screening plates and cultured at 30 °C for 4 days.

[0111] Transformant identification: Single-clone transformants were picked and inoculated into fresh GMM liquid medium and cultured at 28°C and 200 rpm for 2 days; mycelia were collected by centrifugation (10,000 g, 10 min, room temperature), and total DNA was extracted using a fungal genomic DNA rapid extraction kit (Shanghai Sangon Biotech, B518229); colony PCR was then performed for verification. The correctly verified strain was named *Aspergillus nidulans* AniJGFKIHF2-OdeAOE.

[0112] Example 6: Fermentation verification of changes in echinocandin B production by engineered strains

[0113] The strain CJOE obtained in Example 3, AniJGFKIHF2-OE, AniFOE, AniHOE, AniF2OE, AniIOE, AniGOE, and AniKOE obtained in Example 4, and the engineered strain AniJGFKIHF2-OdeAOE obtained in Example 5 were fermented and cultured, with strain B-NPRm used as a control.

[0114] For shake-flask fermentation, spores of the above-mentioned strain were inoculated into 30 mL of PDB liquid medium (Solepro, P9240) and cultured for 2 days at 25°C and 220 rpm. Then, 3 mL of the seed culture was inoculated into 50 mL of fermentation medium and cultured for another 7 days at 25°C and 220 rpm. The fermentation medium consisted of: methyl oleate 100 g / L, vermiculite particles (100 mesh) 10 g / L, glycerol 10 g / L, peptone 40 g / L, K2HPO4·3H2O 8 g / L, MgSO4·7H2O 0.5 g / L, MnSO4·H2O 0.2 g / L, FeSO4·7H2O 0.05 g / L, CaCl2 0.5 g / L, CuSO4·5H2O 0.6 g / L, pH 7.0.

[0115] For fed-batch fermentation in a 5 L tank, the strain spores were inoculated into 300 mL of the aforementioned PDB medium and cultured for 2 days at 25°C and 220 rpm. Then, 300 mL of the seed culture was inoculated into 3 L of fermentation medium and cultured at 25°C for an additional 2 days; the composition of the fermentation medium was the same as that for shake-flask fermentation. The fermenter was rotated at 200-400 rpm with an aeration rate of 1-2 vvm to maintain dissolved oxygen above 20%. On days 3, 4, and 5 of fermentation, 100 g of methyl oleate was added to the feed. Fermentation was completed after 12 days.

[0116] Cell collection and product extraction: 10 mL of fermentation broth mycelium was collected by centrifugation (10,000 g, 10 min, room temperature), resuspended in 20 mL of pure methanol, extracted overnight, and then centrifuged (15,000 g, 10 min, 4℃) to collect the supernatant. 0.22 ​ After filtration by the m filter, it is used for HPLC analysis.

[0117] (2) HPLC quantitative analysis.

[0118] Echinocandin B was quantitatively analyzed using high performance liquid chromatography (HPLC), with an injection volume of 10 μL. ​L. The sample was eluted using a binary gradient elution system consisting of (A) methanol and (B) water (containing 0.1% formic acid, v / v). The elution gradient was: 0–5 min, 5% A; 5–20 min, 5%–95% A; 20–25 min, 95% A; 25–30 min, 5% A; with a flow rate of 1.0 mL / min. Metabolites were separated using a Shim-pack GIST C18 column (Shimadzu, Japan, 227-30017-07) at 30 °C, with a detection wavelength of 210 nm. Echinocandin B standard (Santa Cruz Biotechnology) was used as a standard reference, and quantification was performed based on peak area.

[0119] (3) High-resolution mass spectrometry analysis of echinococin.

[0120] High-resolution HPLC-MS (HRMS) analysis was performed using a Q Exactive Plus quadrupole mass spectrometer system. Metabolites were separated using an Agilent Poroshell 120 EC-C18 column (3.0 × 150 mm) at 30 °C, eluted with 85% acetonitrile (containing 0.1% formic acid) at a flow rate of 0.2 mL / min. Mass spectrometry was performed in positive ion mode, with a molecular weight detection range of 500.0–1500.0 Da. Metabolic extracts from the AniIOE strain were analyzed using 0.22... µ The sample was analyzed after being filtered through a membrane.

[0121] The general structural formulas and mass spectra of echinocandin B, echinocandin C, and echinocandin D are as follows: ​ As shown in A, B, C, and D.

[0122] Fermentation results ( ​The results (E) showed that single overexpression of AniJ in strain CJOE resulted in an echinocandin B yield of 507.3 mg / L, which was 9.5 times that of strain B-NPRm (53.2 mg / L). Based on strain CJOE, individual overexpression of AniG, AniH, AniK, AniF2, AniF, and AniI yielded 567.3 mg / L (strain AniGOE), 568.2 mg / L (strain AniKOE), 595.1 mg / L (strain AniFOE), 515.9 mg / L (strain AniF2), 517.1 mg / L (strain AniH), and 624.4 mg / L (strain AniI), respectively. This indicates that further overexpression of AniK, AniF2, AniF, and AniI on top of AniJ overexpression can further increase the yield, with AniIOE showing the most significant improvement. In addition, echinocandin C (ECC) and echinocandin D (ECD) were also accumulated in the AniIOE strain, with yields of 35.8 mg / L and 37.3 mg / L, respectively.

[0123] Based on AniJ overexpression, the strain AniJGFKIHF2OE, which simultaneously overexpresses AniK, AniG, AniI, AniH, AniF, and AniF2, showed a significantly increased echinocandin B yield (880.5 mg / L), 16.6 times that of strain B-NPRm (53.2 mg / L). This discovery of a synergistic enhancement of echinocandin B yield through combined gene overexpression has not been reported in previous studies. Furthermore, the simultaneous overexpression of the P450 enzymes AniH and AniF2 prevented the accumulation of incompletely oxidized intermediates echinocandin C (ECC) and echinocandin D (ECD).

[0124] To improve linoleic acid supply, the AniJGFKIHF2OE strain was further overexpressed with OdeA to obtain the AniJGFKIHF2OdeAOE strain. This strain produced 972.8 mg / L of echinocandin B after fermentation, which is 8.1 times that of the starting strain BGCm5 (120 mg / L) and 18.3 times that of strain B-NPRm. Furthermore, the accumulation of intermediates echinocandin C and echinocandin D was significantly reduced. This finding has not been reported in previous studies.

[0125] During fed fermentation, such as ​ As shown in Figures A and B, the production status of the strains is not significantly different. The optimal strain, AniJGFKIHF2OdeAOE, achieved a yield of 2.8 g / L after 12 days of fermentation, which greatly improved the production efficiency and represents the highest level reported in fermenter culture to date.

[0126] The above results indicate that simultaneous overexpression of genes related to the synthesis of echinocandy B can significantly improve its production efficiency, which creates conditions for its industrial production.

[0127] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for constructing an engineered strain that produces high levels of echinocandin B, characterized in that, Aspergillus nidulans was modified to obtain strain B-NPRm, which exhibited non-homologous end junction defects, pyridoxine auxotrophicity, and riboflavin auxotrophicity. Subsequently, orthogonal cross-linking was introduced using CRISPR / Cas9. Lox site LoxP and Lox2272 Construct the chassis cell strain B-NPRm-2Lox; Then through Cre / LoxP and Cre / Lox2272 Reorganize the system, respectively aniF , aniF2 , aniG , aniH , aniI , aniK Genes and aniJ and odeA The gene overexpression cassette was integrated into the genome to obtain an engineered strain that produces high levels of echinocandin B. The method for constructing the engineered strain that produces high levels of echinocandin B includes the following steps: S1, an engineered strain B-NPRm with non-homologous end junction defects, pyridoxine auxotrophic and riboflavin auxotrophic was constructed based on Aspergillus nidulans; S2 will have orthogonal Lox site LoxP and Lox2272 The two chromosome landing pads were sequentially introduced into the engineered strain B-NPRm obtained in step S1; and the AniJ overexpression strain CJOE was constructed based on the obtained engineered strain. S3, construct the Cre recombinase expression vector pUC-Cre and its application for overexpressing the following genes. Cre / LoxP Recombinant donor vector: aniF , aniF 2. aniG , aniH , aniI , aniK ; The above vectors were co-transformed into the AniJ overexpression strain CJOE obtained in step S2. LoxP At the locus, engineered strains overexpressing the Ani gene were obtained; S4, build Cre / Lox2272 The donor vector required for recombinant-mediated OdeA overexpression was combined with the Cre recombinase expression vector obtained in S3. pUC-Cre The engineered strains overexpressing the Ani gene obtained in step S3 were co-transfected. Lox2272 By identifying the site, an engineered strain that produces high levels of echinocandin B was obtained; In step S1, a structure containing filamentous fungal replication elements, hygromycin B resistance genes, bacterial replication elements, ampicillin resistance genes, and Aspergillus nidulans is constructed. tef1 promoter AnP tef1 and Termination Sub AnT tef1 Driven cytosine editor encoding sequences and targeting NkuA , PyroA , RiboB A bifunctional vector of the gene's sgRNA was transformed into Aspergillus nidulans strain BGCm5 to obtain engineered strain B-NPRm with non-homologous end joining defects, pyridoxine auxotrophic and riboflavin auxotrophic. In step S2, the CRISPR / Cas9 method is used to process the orthogonal... Lox site LoxP and Lox2272 Two chromosome landing pads were sequentially introduced into the genomic DNA of two different chromosomes of the engineered strain B-NPRm obtained in step S1 to obtain the Aspergillus nidulans strain B-NPRm-2Lox, which can be used for Cre / LoxP and Cre / Lox2272 Reorganization; In step S2, the pathway-specific regulatory factor encoding gene was inserted into the obtained strain B-NPRm-2Lox using the CRISPR / Cas9 gene editing method. aniJ Replace the promoter with a strong promoter Ptef1 To obtain strain CJOE, and achieve aniJ Overexpression; In step S2, the LoxP and Lox2272 Site integration is achieved via a homologous recombination donor vector, which contains... LoxP or Lox2272 Sequence and homologous arms; In step S3, the Cre recombinase expression vector pUC-Cre contains Ori element, AmpR Components and a fungicide made of Aspergillus nidus tef1 Promoter and terminator-driven Cre recombinase expression cassette.

2. The engineered strain obtained by the method for constructing the high-yielding echinocandin B engineered strain according to claim 1.

3. The application of the engineered strain obtained by the method for constructing the high-yield echinocandin B engineered strain according to claim 1 in the fermentation production of echinocandin B.

4. A method for producing echinocandin B by fermentation, characterized in that, The procedure includes the following steps: inoculating the spores of the engineered strain described in claim 2 into PDB liquid medium and culturing them for 1 to 3 days at 25℃±5℃ and 200~400 rpm; then, inoculating the seed culture into the fermentation medium and continuing to culture it for 6 to 12 days at 25℃±5℃ and 200~240 rpm; after fermentation, centrifuging to collect the mycelium of the fermentation broth, resuspending it in an alcohol reagent, extracting it, centrifuging it, collecting the supernatant, and filtering it to obtain the final product.

Images