Anti-PD-L1 nano antibody and application thereof

Abstract

The invention belongs to the technical field of biological medicine, and discloses an anti-PD-L1 nano antibody and application thereof. And the amino acid sequences of CDR1-3 of the PD-L1 nano antibody are respectively shown as SEQ ID NO.2-4. The PD-L1 nano antibody is a PD-L1 antibody. The nano antibody can effectively block the combination of PD1 and PDL1, is high in affinity and strong in specificity, can be used for immunoblotting, enzyme-linked immunosorbent assay kits and flow cytometry counting, can also be used for treating diseases such as tumors, autoimmune diseases and chronic infectious diseases, and has the potential of being developed as an immune checkpoint inhibitor.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an anti-PD-L1 nanobody and its application. Background Technology

[0002] Malignant tumors, also known as cancer, are a serious disease caused by the abnormal division and proliferation of normal cells in the human body. Once cancer develops, the normal tissues and organs surrounding the lesion will be gradually invaded by tumor cells, which can even use the blood or lymphatic system to metastasize to other parts of the body. According to statistics, the number of people dying from cancer worldwide is increasing year by year, and in most countries, cancer ranks second among the causes of death for residents aged 30 to 69.

[0003] Immune checkpoints are a series of molecules expressed on immune cells that regulate the level of immune activation and prevent over-activation of the immune system. Immune checkpoints can initiate signaling pathways that suppress T cell function, while immune checkpoint inhibitors can inhibit this tumor-mediated T cell suppression. Programmed death ligand 1 (PD-L1) is an important target in tumor immune checkpoint blockade therapy, and it is expressed in a variety of cell types. Most solid tumors abnormally activate the immune checkpoint PD-1 through high expression of PD-L1, inducing tumor-specific T lymphocyte apoptosis, allowing tumor cells to evade the surveillance and killing of the immune system. Furthermore, PD-L1 can bind to tumor-infiltrating lymphocytes (TILs) to inhibit the release of various inflammatory factors such as IL-2 and IFN-γ, thereby suppressing the immune-killing activity of TILs and inducing their apoptosis. It also stimulates human peripheral blood T cells to secrete immunosuppressive cytokines such as IL-10 and TGF-β, mediating immunosuppression and enabling tumor cells to escape immunely, proliferate, and metastasize.

[0004] Currently approved by the U.S. Food and Drug Administration (FDA) for various cancers, immunotherapy, as the latest tumor treatment, activates the killing effect of immune cells on cancer cells and has become the most advanced and effective medical oncology treatment method after chemotherapy and targeted therapy in recent years. In particular, immune checkpoint therapies such as PD-1 / PD-L1 inhibitors can lead to long-term remission in about 20% of patients, and even the possibility of tumor cure. Studies have shown that downregulating the expression of PD-L1 mRNA in lung cancer cells can enhance the killing effect of T lymphocytes on A549 cells. Blocking the interaction between PD-1 and PD-L1 can effectively restore the tumor-killing function of T cells. Currently, the industry generally believes that antibodies targeting the PD-L1 pathway will bring breakthrough progress in the treatment of various cancers: since the advent of Opdivo, the world's first PD-1 inhibitor, in 2014, several PD-1 / PD-L1 drugs have been approved for marketing. These are used to treat non-small cell lung cancer, renal cell carcinoma, ovarian cancer, and melanoma.

[0005] PD-L1 is also commonly expressed in activated cells, B cells, macrophages, dendritic cells (DCs), and neutrophils, playing a crucial role in immune homeostasis and inflammation regulation. Autoimmune diseases are a group of diseases caused by autoimmune reactions leading to organic damage and functional impairment of the body's own tissues or organs. PD-1 / PD-L1 axis dysregulation is also widespread in various autoimmune diseases and chronic infectious diseases, including inflammatory bowel disease (OBD), multiple sclerosis (MS), rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), type 2 diabetes mellitus (T2DM), aplastic anemia (AA), oral lichen planus (OLP), Wegener's granulomatosis (WG), and myasthenia gravis (MG). Studies have shown that PD-1 knockout mice exhibit impaired peripheral tolerance and inhibit lymphocyte proliferation, which can induce autoimmune diseases. Furthermore, abnormalities in the PD-1 / PD-L1 signaling pathway may play a significant role in the pathogenesis of rheumatoid arthritis (RA). Matsuda K et al., through detecting the expression of PD-1 / PD-L1 on infiltrating T lymphocytes in the synovial fluid of RA patients and performing immunohistochemical staining on synovial tissue of RA patients, found that PD-1 was highly expressed on infiltrating T lymphocytes in the synovial fluid, while PD-L1 was highly expressed on synovial lining cells, and the expression levels of both were correlated with the severity of RA. Some researchers have also suggested that the PD-1 / PD-L1 pathway may play an important role in diseases such as ischemic stroke and multiple sclerosis.

[0006] However, not all cancer patients benefit from this type of treatment. PD-L1 is a key biomarker for determining whether a cancer patient is suitable for immunotherapy. Therefore, selecting appropriate patients based on biomarker detection is a rigid clinical requirement. Assessing PD-L1 expression levels in tumor tissue is currently the most clinically recognized predictive biomarker for the efficacy of PD-1 / PD-L1 inhibitors. Numerous research data show that high PD-L1 expression is detected in most tumor cell lines, including lymphoma, choriocarcinoma, melanoma, and esophageal cancer. Compared to PD-L1-negative patients, PD-L1-positive patients are more likely to benefit from immunotherapy, and the higher the PD-L1 expression level in tumor tissue, the greater the chance of benefiting from PD-1 / PD-L1 inhibitor treatment. Multiple domestic and international clinical guidelines for non-small cell lung cancer (NSCLC) recommend routine PD-L1 testing for patients with Level 1A evidence. Meanwhile, studies have shown that the expression level of PD-L1 in non-muscle-invasive bladder cancer cells is related to tumor pathological progression, and treatment plans can be formulated based on the expression of PD-L1 in patients after drug treatment. The quantification of the degree of PD-L1 expression is usually evaluated by pathologists through direct observation under a microscope, which requires high affinity and specificity of the antibody.

[0007] Nanobodies (VHHs) share the same structural domains as conventional antibodies (VHs), namely four conserved framework regions (FR1 / 2 / 3 / 4) and three complement-determining regions (CDR1 / 2 / 3). Nanobodies have a molecular weight only 10% that of traditional antibodies, retaining the complete antigen-binding capacity of HCAbs, and exhibiting high specificity, good affinity, and high stability. Because nanobodies lack an Fc fragment, they cannot produce ADCC / CDC cytotoxic effects like conventional antibodies. Therefore, VHH antibodies are often fused with an Fc fragment to construct Fc-VHH fusion proteins to increase ADCC (antibody-dependent cell-mediated cytotoxicity) and CDC (complement-dependent cytotoxicity) activities. Compared to conventional antibodies, these forms of nanobodies can be widely used in the treatment of various diseases. Summary of the Invention

[0008] The purpose of this invention is to overcome at least one deficiency of the prior art and provide an anti-PD-L1 nanobody and its application.

[0009] The technical solution adopted in this invention is: A first aspect of the present invention provides: an anti-PD-L1 nanobody, the anti-PD-L1 nanobody comprising a complementarity-determining region (CDR), the CDR comprising a CDR1, a CDR2, and a CDR3, wherein, The amino acid sequence of the complementarity-determining region CDR1 is shown in SEQ ID NO.2; The amino acid sequence of the complementarity-determining region CDR2 is shown in SEQ ID NO.3; The amino acid sequence of the complementarity-determining region CDR3 is shown in SEQ ID NO.4.

[0010] In some instances, the VHH amino acid sequence of the anti-PD-L1 nanobody is as shown in SEQ ID NO.1, or the amino acid sequence shown in SEQ ID NO.1 is modified by substitution, deletion, or addition of one or more amino acids, resulting in an amino acid sequence with the same or similar function. Preferably, the modified amino acid sequence has at least 90%, 95%, 98%, or 99% homology with the amino acid sequence shown in SEQ ID NO.1.

[0011] A second aspect of the present invention provides: a fusion protein comprising a first domain and a second domain, wherein the first domain is the anti-PD-L1 nanobody described in the first aspect of the present invention.

[0012] In some instances, the second domain is used to extend the half-life of the first domain in vivo.

[0013] In some instances, the second domain includes, but is not limited to, serum albumin (such as human HSA) or fragments thereof, a domain that binds to serum albumin (such as anti-serum albumin antibodies, including nanobodies), polyethylene glycol, polyethylene glycol-liposome complexes, or combinations thereof; and / or Molecules that have an affinity for T cell surface molecules and / or are able to bind to surface molecules (such as CD3) present on T cells.

[0014] In some instances, the human immunoglobulin Fc region includes mutations that alter Fc-mediated effector functions, including one or more combinations of CDC activity, ADCC activity, and ADCP activity.

[0015] In some instances, the immunoglobulin is one or more combinations selected from IgG, IgA1, IgA2, IgD, IgE, and IgM.

[0016] In some instances, the IgG is selected from one or more of the IgG1, IgG2, IgG3, or IgG4 subtypes.

[0017] In some instances, the amino acid sequence of the Fc region of the immunoglobulin is as shown in SEQ ID NO.5r; or an amino acid sequence that is functionally identical or similar to the amino acid sequence shown in SEQ ID NO.5 after substitution, deletion or addition of one or more amino acids.

[0018] In some instances, the amino acid sequence of the fusion protein is shown in SEQ ID NO.6.

[0019] In some instances, the first and second domains are directly or interconnected via connectors.

[0020] In some instances, the linker is a flexible linker; preferably, the flexible linker is selected from the hinge region of the antibody, YAPVDV, GSAS, or (GGCAGCGCCAGC). n (GGCGGCGGCAGC) n (GGCGGCGGCGGCAGC) n (GGGS) n (GGSG) n (GGGGS) n (G) n At least one of the following, where n is an integer not less than 1, preferably, n is an integer between 1 and 10, or between 1 and 5.

[0021] The above features can be combined arbitrarily as long as they do not conflict with each other.

[0022] A third aspect of the invention provides: a biomaterial selected from any one of a1) to a12): a1) A nucleic acid molecule encoding the anti-PD-L1 nanobody of the first aspect of the present invention or the fusion protein of the second aspect of the present invention; a2) An expression cassette containing the nucleic acid molecule described in a1); a3) A recombinant vector containing the nucleic acid molecules described in a1); a4) A recombinant vector containing the expression cassette described in a2); a5) Recombinant microorganisms containing the nucleic acid molecules described in a1); a6) Recombinant microorganisms containing the expression cassette described in a2); a7) Recombinant microorganisms containing the recombinant vector described in a3); a8) Recombinant microorganisms containing the recombinant vector described in a4); a9) Transgenic cell lines containing the nucleic acid molecules described in a1); a10) Transgenic cell lines containing the expression cassette described in a2); a11) Transgenic cell lines containing the recombinant vector described in a3); a12) Transgenic cell lines containing the recombinant vector described in a4).

[0023] In some instances, the transgenic animal cell lines do not contain reproductive material.

[0024] In some instances, the 5' transcriptional control region contains a promoter (which may be a universal promoter, such as a viral promoter (SV40 promoter) or a mammalian "housekeeper" promoter), a transcription start site, an enhancer, and / or a silencing element.

[0025] In some instances, the 3'UTR may encode AU-rich elements, which, via the 3'-5' exosome pathway, are common regulators of mRNA stability and are typically located in the 3'UTR. AU-rich elements may contain one or more repeats of the sequence AUUUA. It may also contain one or more so-called US2B elements with the sequence AUAUAU.

[0026] In some instances, the vector includes a promoter that is operatively linked to the nucleic acid molecule.

[0027] In some instances, the vector is independently selected from non-pathogenic viral vectors and viral vectors.

[0028] In some instances, the viral vector includes at least one of lentiviral vectors, adenovirus vectors, baculovirus vectors, retroviral vectors, poxvirus vectors, Sendai virus vectors, and herpes simplex virus vectors.

[0029] In some instances, the non-viral vector includes at least one of plasmid vectors, cationic polymer vectors, chitosan, polyethyleneimine, nanoparticle vectors, and liposomes.

[0030] In some instances, the vector is a plasmid vector, phage particle, viral vector, cell vector, bacteriophage, sclerotium, F sclerotium, or artificial chromosome.

[0031] In some instances, the plasmid vector may be an optional plasmid, and the viral vector may be an optional virus.

[0032] In some instances, the recombinant expression vector uses pET-28a(+) as the original expression vector.

[0033] In some instances, the cells include prokaryotic cells and eukaryotic cells; the cells are not new plant or animal species.

[0034] In some instances, the prokaryotic cells include bacteria well-known in the art, such as Escherichia coli, Streptomyces, and Bacillus subtilis, which can be used to express the target protein.

[0035] In some instances, the eukaryotic cells include at least one of yeast cells, mammalian cells, plant cells, and insect cells.

[0036] In some instances, the cells include engineered cell lines such as CHO, CHO-K1, and CHO-GS, and lymphocyte lines such as T cells, NK cells, and CIK cells.

[0037] A fourth aspect of the present invention provides: a biological agent comprising: an anti-PD-L1 nanobody or conjugate thereof according to the first aspect of the present invention, a fusion protein or conjugate thereof according to the second aspect of the present invention, and a biological material according to the third aspect of the present invention.

[0038] In some instances, the conjugates include, but are not limited to, cytotoxins, detectable markers, bioactive proteins, molecules that target tumor surface markers, molecules that inhibit tumors, molecules that target immune cell surface markers, extracellular hinge regions, transmembrane regions, and intracellular signaling regions based on chimeric antigen receptor technology.

[0039] In some instances, the bioactive proteins include molecules that target tumor surface markers, molecules that inhibit tumors, molecules that target surface markers of immune cells, extracellular hinge regions, transmembrane regions and intracellular signaling regions based on chimeric antigen receptor technology, cytokines, antibodies, antibody Fc fragments, and antibody scFv fragments.

[0040] In some instances, the transmembrane region includes, but is not limited to, the transmembrane region of CD8 or CD28.

[0041] In some instances, the intracellular signaling region includes, but is not limited to, the intracellular signaling regions of the CD3ζ chain, the FcεRIγ tyrosine activation motif, and co-stimulatory signaling molecules such as CD27, CD28, CD137, CD134, MyD88, and CD40.

[0042] In some instances, the molecules that target tumor surface markers are antibodies or ligands that bind to tumor surface markers.

[0043] In some instances, the tumor-inhibiting molecules are anti-tumor cytokines or anti-tumor toxins. Preferably, the anti-tumor cytokines include, but are not limited to, IL-12, IL-15, IFN-beta, and TNFalpha.

[0044] In some instances, the detectable markers include, but are not limited to, radioactive isotopes, fluorescent substances, chemiluminescent substances, colored substances, and nanoparticles.

[0045] In some instances, the detectable markers include, but are not limited to, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents or enzymes capable of producing detectable products.

[0046] In some instances, the nanoparticles include, but are not limited to, gold nanoparticles / nanorods, magnetic nanoparticles, liposomes, viral particles, and pseudovirus particles.

[0047] In some instances, the biological agent further includes acceptable excipients. Preferably, the excipients include, but are not limited to, fillers, disintegrants, diluents, dispersants, excipients, stabilizers, lubricants, binders, humectants, flavoring agents, solubilizers, suspending agents, solvents, sustained-release agents, emulsifiers, absorption enhancers, surfactants, preservatives, colorants, fragrances, and solvents.

[0048] In some instances, the biological agent also includes combination drugs, including but not limited to immune effector molecules, cells, cytotoxic substances, and multi-kinase inhibitors.

[0049] These features can be combined arbitrarily as long as they do not conflict with each other.

[0050] A fifth aspect of the present invention provides the use of the anti-PD-L1 nanobody described in the first aspect of the present invention, the fusion protein described in the second aspect of the present invention, the biomaterial described in the third aspect of the present invention, or the biological agent described in the fourth aspect of the present invention in the preparation of a formulation, kit, or drug for the diagnosis, treatment, or prevention of cancer.

[0051] In some instances, the cancers include lung cancer, melanoma, stomach cancer, ovarian cancer, colon cancer, liver cancer, kidney cancer, bladder cancer, breast cancer, head and neck cancer, or nasopharyngeal cancer.

[0052] The beneficial effects of this invention are: This invention relates to an anti-PD-L1 nanobody obtained by immunizing alpacas. This nanobody can effectively block the binding of PD1 and PDL1, and has high affinity and strong specificity. It can be used for immunoblotting, enzyme-linked immunosorbent assay kits, flow cytometry detection and counting, and can also be used for the treatment of diseases such as tumors, autoimmune diseases and chronic infections. It has the potential to be developed as an immune checkpoint inhibitor. Attached Figure Description

[0053] Figure 1 Flow cytometry report for specific detection of 25Ab-PD-L1 antibody.

[0054] Figures 2-4 Flow cytometry plot of the blocking ability of 25Ab-PD-L1 antibody.

[0055] Figure 5 The results of statistical analysis of the blocking ability of 25Ab-PD-L1 antibody are presented.

[0056] Figure 6 The images show the Western blot (WB) results of the purified 25Ab-PD-L1 antibody fusion antibody, with loading amounts of 10 μg, 5 μg, 3 μg, and 1 μg, respectively. Detailed Implementation

[0057] The present invention will be further described in detail below through specific embodiments.

[0058] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0059] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0060] The features and performance of the present invention will be further described in detail below with reference to embodiments. Example 1: Plasmid construction (including mutation of the target fragment)

[0061] Multiple candidate nanobody sequences were obtained by immunizing alpacas with antigens, and clones 3, 10, 12, and 25 with relatively superior performance were selected. Among them, the VHH amino acid sequence of clone 25 (25Ab-PD-L1), which showed the best performance, is shown in SEQ ID NO.1, and the amino acid sequences of its complementarity-determining regions CDR1 to CDR3 are shown in SEQ ID NO.2 to 4, respectively.

[0062] The VHH region nucleic acid sequence of the nanobody was ligated with the human IgG Fc nucleic acid sequence (amino acid sequence shown in SEQ ID NO. 5) using multi-fragment homologous recombination technology. The ligation region was hinge. The plasmid after homologous recombination was identified by enzyme digestion and then sequenced. The amino acid sequence of 25Ab-PD-L1-Fc is shown in SEQ ID NO. 6.

[0063] (1) Preparation and procedure of single-fragment amplification reaction system Prepare the single-fragment amplification reaction system as shown in Table 1, and carry out the reaction according to the reaction procedure shown in Table 2.

[0064] PCR amplification primers for clones 3, 10, 12, and 25 were used to amplify the VHH region. F-EF1α:CATTTCAGGTGTCGTGAAGC (SEQ ID NO.7); R-FP: CGGTCCTCCCAGCAGCTCAG (SEQ ID NO. 8).

[0065] hIgG1-Fc fragment amplification primers F-IGg1: CTGAGCTGCTGGGAGGAccg (SEQ ID NO.9); R-IGg1:AAAAGGCGCAACCCGCTAGCtcatttacccggagacagggag (SEQ ID NO. 10).

[0066] The above two fragments were homologously recombinated with the large fragment 8044bp that was recovered after double digestion with NotI and NheI. The system preparation is shown in Table 3.

[0067] Table 1 Single-fragment amplification reaction system

[0068] Table 2 Reaction Procedure

[0069] (2) Multi-fragment homologous recombination preparation system and procedure Prepare the multi-fragment homologous recombination reaction system as shown in Table 3, and carry out the reaction according to the following reaction procedure: single-fragment recombination reaction, 50℃, 5 min; cool to 4℃ or immediately place on ice for cooling; multi-fragment recombination reaction, 50℃, 15 min; cool to 4℃ or immediately place on ice for cooling.

[0070] Table 3 Multi-fragment homologous recombination reaction system Example 2: Plasmid Extraction

[0071] (1) Transform the vector with the correct sequence alignment into a plasmid at 37°C for 14 h. (2) Pick single colonies, culture a small amount of bacterial solution, culture volume 4 mL Amp+ LB (100 mg / L Amp+), culture at 37℃, 220 rpm for 10 h; (3) Large-scale culture of bacterial culture: The next day, the seed culture was inoculated into 250mL Amp+ LB (100mg / L Amp+) and cultured at 37 ℃ and 220rpm for 14 h; (4) Plasmid extraction was performed using the Tiangen plasmid large-scale extraction kit: a. Add the bacterial culture to a collection bottle (500 mL), centrifuge at 4000 rpm for 30 min, and remove as much supernatant as possible; b. Column equilibration procedure: Add 2.5 mL of equilibration solution BL to the adsorption column CP6 (the adsorption column is placed in a 50 mL collection tube); c. Add 10 mL of solution P1 to the bacterial pellet to resuspend the bacterial cells; d. Add 10 mL of solution P2 to the bacterial suspension and gently invert 6-8 times to allow the bacterial cells to fully lyse; e. Add 10 mL of solution P4 to the centrifuge tube, gently invert 6 to 8 times to mix thoroughly until a white, dispersed flocculent precipitate appears in the solution; f. Centrifuge the lysate at 3580 × g for 30 min; g. Carefully pour the supernatant lysis buffer into filter CS1, slowly push the push handle to filter, and collect the filtrate in a clean 50mL tube; h. Add 3 mL of red endotoxin-free solution ER to each solution, mix by inverting, and the solution will turn into a uniform, transparent yellow. i. Add 0.3 times the volume of the above filtrate in isopropanol, mix by inverting the container, and then transfer it to the adsorption column CP6. j. Centrifuge at 8228×g for 2 min at room temperature, discard the waste liquid in the collection tube, and put the adsorption column CP6 back into the collection tube; k. Add 10 mL of buffer ED to the adsorption column CP6, centrifuge at 8228×g for 2 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. l. For low-copy plasmids, repeat step k; m. Add 10 mL of washing buffer PW to the adsorption column CP6, centrifuge at 8228×g for 2 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. n. Repeated operation steps m; o. Place the adsorption column CP6 back into the collection tube, centrifuge at 8228×g for 5 min, then open the cap of the adsorption column CP6 and place it at room temperature for several minutes to thoroughly dry the residual washing liquid in the adsorption material. p. Place the adsorption column CP6 in a clean 50 mL collection tube, add 1-2 mL of elution buffer TB dropwise to the middle of the adsorption membrane, incubate at room temperature for 5 min, and then centrifuge at 8228×g for 5 min at room temperature. q. Take 1 μL of plasmid DNA to determine the concentration (zero with Buffer TE), aliquot the plasmid DNA into 1.5 mL centrifuge tubes, and label them with the name, concentration, batch number and volume. Store at -20℃. Example 3: Antibody Production

[0072] (1) Observe the 293T cells used for packaging under a microscope and screen out cells with a cell density of 80% to 95%; (2) Prepare 10% packaged culture medium. Open a new bottle of 500 mL DMEM culture medium, add 55 mL FBS, then add 550 μL of 1 mol / L sodium pyruvate solution and 550 μL of 25 mmol / L chloroquine phosphate solution, and mix well. (3) Take the screened cells out of the incubator, pour the old culture medium in the culture flask into the waste liquid container, add 17 mL of 10% packaged culture medium, and then put it back into the carbon dioxide incubator to adapt; (4) Calculate the amount of plasmid to be added (30 μg plasmid per bottle) and 0.125 mol / L calcium chloride solution according to the number of culture bottles to be transfected, and prepare a DNA-CaCl2 mixture; then take an equal volume of 2×HBS solution and add it dropwise to the DNA-CaCl2 mixture while vortexing the DNA-CaCl2 mixture; after the addition is complete, let it stand at room temperature for 20 min until a white precipitate forms; (5) Remove the cells obtained in step (3) from the incubator, add 8 mL of calcium phosphate-DNA precipitation complex to each bottle, and label the bottle with the virus name and operation date. Return the bottle to the incubator and change the medium with 5% packaged culture medium for 4-6 hours. To prepare 5% packaged culture medium, open a new 500 mL bottle of DMEM medium, add 27.5 mL of FBS and 27.5 mL of gibco KnockOut™ serum substitute (catalog number 10828028), then add 550 μL of 1 mol / L sodium pyruvate solution and 550 μL of 25 mmol / L chloroquine phosphate solution, and mix well. (6) Take out the 293T cells obtained in step (5) from the incubator, discard the old culture medium, add 25 mL of 5% packaged culture medium to each bottle, and then put them back into the incubator to continue culturing. After culturing for 72 h, harvest the supernatant to obtain the fusion antibody. Example 4: Antibody supernatant specificity test

[0073] (1) Collect 1 mL of the antibody supernatant obtained 72 h after transfection (Example 3) into a 1.5 mL centrifuge tube; (2) Centrifuge at 12,000 rpm for 5 min to remove cell debris, then clarify using a 0.22 μm filter for later use; (3) Cell staining: Take PD-L1 293T cells and 293T cells to be stained by flow cytometry, digest them with trypsin, wash them with sodium chloride / PBS, add 400 μL of antibody supernatant from step (2), and incubate at 4℃ for 30 min in the dark. (4) Wash the stained cells with sodium chloride, centrifuge, discard the supernatant, add anti-hunan-FC-PE flow cytometry antibody, incubate at 4℃ for 30 min, and protect from light; (5) Wash the cells to be tested with sodium chloride, centrifuge, add flow cytometry buffer, and then test.

[0074] Flow cytometry results showed that the 25Ab-PD-L1 antibody bound to 293T-PDL1 but not to 293T cells, indicating that the binding of the 25Ab-PD-L1 antibody to PDL1 is specific. Figure 1 ). Example 5: Antibody Concentration and Purification

[0075] (1) The 72 h supernatant obtained in Example 3 was aliquoted into 50 mL centrifuge tubes and centrifuged in a centrifuge with centrifugation parameters set to 4000 g, 25 min, and 4 °C. (2) Transfer the supernatant of the centrifuged lentivirus solution to a 022 μm vacuum filtration system for filtration; (3) Large-volume concentration was carried out using hollow fiber membrane columns / membrane packs. After concentration of 40×, it was purified by AKATA. Protein G was selected as the packing material. (4) Small-volume antibody supernatant was purified using a gravity purification column, with Protein G and 30KD ultrafiltration tubes as the packing material for concentration; (5) The purified antibody can be used for WB detection.

[0076] 25Ab-PD-L1 antibody was detected by Western blotting (WB). Figure 6 The band size is close to 50 KD, which is correct. The band is intact, single, and without breakage, making it suitable for the subsequent large-scale antibody purification process using AKATA. Example 6: Antibody Blocking Test Experiment

[0077] (1) Construction of K562-PD1-RFP and K562-PD-L1 EGFP cell lines: construct lentiviral vectors containing PD1 and PDL1 gene sequences, transduce K562 cell lines, MOI=5, transduce for 72h, and detect the positive rate of RFP and EGFP by flow cytometry. Subsequent experiments can only be carried out if the positive rate reaches more than 90%. (2) Take the above cells for cell counting; (3) Based on the counting results, the cell density was diluted to 1E6 / mL. 200 μL of each cell type was placed in a 1.5 mL centrifuge tube. 1 μg of purified antibody (Example 5) was added to the Blank group, RM1640 without antibody was added to the Control group, and the blocking agent was added to the Control group. The PD-L1 antibody sequence (amino acid sequence as shown in SEQ ID NO.11) obtained by literature search was used as the diluent. The buffer was 50 μL of 1% FBS 1640. (4) Incubate at 37℃ for 1 h; (5) Flow cytometry testing.

[0078] The blocking results of co-incubation detection of anti-PD-L1 antibody are as follows: Figures 2-5 As shown, flow cytometry results for K562-PD1-RFP and K562-PD-L1 EGFP cell lines without anti-PDL1 antibody blockade showed that K562-PD1-RFP could bind to K562-PD-L1. When 25Ab-PD-L1 antibody was added to the mixed cell solution of K562-PD1-RFP and K562-PD-L1 EGFP after quantification, it could bind to K562-PD-L1 EGFP and prevent K562-PD1-RFP from binding to K562-PD-L1, with a blocking effect superior to that of the positive control antibody.

[0079] The above is a further detailed description of the present invention and should not be considered as a limitation on the specific implementation of the present invention. For those skilled in the art, simple deductions or substitutions without departing from the concept of the present invention are all within the protection scope of the present invention.

Claims

1. An anti-PD-Ll Nanobody, comprising complementarity determining regions (CDRs), wherein the complementarity determining region (CDR) 1 has an amino acid sequence as set forth in SEQ ID NO. 2; the complementarity determining region (CDR) 2 has an amino acid sequence as set forth in SEQ ID NO. 3; the complementarity determining region (CDR) 3 has an amino acid sequence as set forth in SEQ ID NO. 4; and the VHH amino acid sequence of the anti-PD-Ll Nanobody is as set forth in SEQ ID NO. 1, or a functionally equivalent or similar amino acid sequence modified from the amino acid sequence as set forth in SEQ ID NO. 1 by substitution, deletion or addition of one or more amino acids. 2.The anti-PD-Ll Nanobody of claim 1, wherein the first domain is the anti-PD-Ll Nanobody of claim 1 or 2; and the second domain is used to prolong the half-life of the first domain in vivo. 3.The anti-PD-Ll Nanobody of claim 2, wherein the second domain is selected from at least one of an immunoglobulin Fc region, a serum albumin or a fragment thereof, a domain binding to serum albumin, a polyethylene glycol, and a polyethylene glycol-liposome complex. 4.The anti-PD-Ll Nanobody of claim 3, wherein the amino acid sequence of the immunoglobulin Fc region is as set forth in SEQ ID NO. 5, or a functionally equivalent or similar amino acid sequence modified from the amino acid sequence as set forth in SEQ ID NO. 5 by substitution, deletion or addition of one or more amino acids.

2. The anti-PD-Ll Nanobody according to claim 1, characterized in that, 5.The anti-PD-Ll Nanobody of claim 3, wherein the amino acid sequence of the fusion protein is as set forth in SEQ ID NO.

6.

3. A fusion protein comprising a first domain and a second domain, characterized in that, 6.The anti-PD-Ll Nanobody of claim 3, wherein the first domain and the second domain are connected to each other directly or through a linker.

4. The fusion protein of claim 3, wherein, 7.A biomaterial, comprising any one of a1) to a12) : a1) a nucleic acid molecule encoding the anti-PD-Ll Nanobody of claim 1 or 2, or the fusion protein of any one of claims 3 to 6; a2) an expression cassette comprising the nucleic acid molecule of a1) ; a3) a recombinant vector comprising the nucleic acid molecule of a1) ; a4) a recombinant vector comprising the expression cassette of a2) ; a5) a recombinant microorganism comprising the nucleic acid molecule of a1) ; a6) a recombinant microorganism comprising the expression cassette of a2) ; a7) a recombinant microorganism comprising the recombinant vector of a3) ; a8) a recombinant microorganism comprising the recombinant vector of a4) ; a9) a transgenic cell line comprising the nucleic acid molecule of a1) ; a10) a transgenic cell line comprising the expression cassette of a2) ; a11) a transgenic cell line comprising the recombinant vector of a3) ; and a12) a transgenic cell line comprising the recombinant vector of a4). 8.A pharmaceutical composition, comprising: one of the anti-PD-Ll Nanobody of claim 1 or 2, or a conjugate thereof, the fusion protein of any one of claims 3 to 6, or a conjugate thereof, and the biomaterial of claim 7; and a pharmaceutically acceptable carrier. 9.The pharmaceutical composition of claim 8, wherein the conjugate comprises at least one of a cytotoxin, a detectable label, and a biologically active protein.

5. The fusion protein of claim 3, wherein, 10.The pharmaceutical composition of claim 9, wherein the cytotoxin comprises a prodrug-activating enzyme and a chemotherapeutic agent.

6. The fusion protein of claim 5, wherein, The linker is a flexible linker, preferably, the flexible linker is selected from at least one of a hinge region of an antibody, YAPVDV, GSAS, (GGCAGCGCCAGC) n , (GGCGGCGGCAGC) n , (GGCGGCGGCGGCAGC) n , (GGGS) n , (GGSG) n , (GGGGS) n , (G) n , n is an integer not less than 1, preferably, n is an integer between 1 and 10, between 1 and 5.

7. A biomaterial, characterized by, ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ 8. A biological agent, characterized in that, ​ ​ ​ ​ Preferably, the bioactive protein comprises a molecule targeting a tumor surface marker, a molecule inhibiting a tumor, a molecule targeting a surface marker of an immune cell, an extracellular hinge region, a transmembrane region and an intracellular signal region based on a chimeric antigen receptor technology, a cytokine, an antibody, an antibody Fc fragment, an antibody scFv fragment; Preferably, the detectable label comprises a radioisotope, a fluorescent substance, a chemiluminescent label, a colored substance, an MRI or CT contrast agent, an enzyme capable of producing a detectable product, a viral particle, a liposome, a nanoparticle.

9. Use of the anti-PD-Ll nanobody of claim 1 or 2, the fusion protein of any one of claims 3-6, the biomaterial of claim 7 or the biological preparation of claim 8 in the preparation of a preparation, a kit or a medicament for the diagnosis, treatment or prevention of cancer.

10. Use according to claim 9, characterized in that, The cancer comprises lung cancer, melanoma, gastric cancer, ovarian cancer, colon cancer, liver cancer, kidney cancer, bladder cancer, breast cancer, head and neck cancer or nasopharyngeal cancer.

Images