RNA (Ribonucleic Acid) aptamer for specifically recognizing rice Cerebron as well as screening method and salt tolerance application of RNA aptamer

By using SELEX technology to screen for the rice Cereblock, a Cereblon-specific RNA aptamer, the lack of molecular regulatory tools for improving rice salt tolerance was solved, and rice growth promotion and ion homeostasis enhancement were achieved under salt stress.

CN121825977APending Publication Date: 2026-04-10GUANGDONG OCEAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-25
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Current technologies lack molecular regulatory tools for rice cereblon (OsCRBN), which cannot effectively improve the salt tolerance of rice, and the application of traditional tools in plant systems is limited.

Method used

Cereblock, an RNA aptamer that binds highly specifically to rice Cereblon, was screened using SELEX technology and expressed in rice via a recombinant expression vector to regulate the protein homeostasis of OsCRBN and improve salt tolerance.

Benefits of technology

Cereblock can stabilize OsCRBN protein under salt stress, increase ubiquitination modification level, promote rice growth, enhance survival ability and ion homeostasis, and provide a novel strategy for improving salt tolerance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121825977A_ABST
    Figure CN121825977A_ABST
Patent Text Reader

Abstract

The invention discloses an RNA (Ribonucleic Acid) aptamer for specifically recognizing rice Cerebron as well as a screening method and salt tolerance application of the RNA aptamer. A random oligonucleotide library is screened, amplified and deeply sequenced by adopting an SELEX (systematic evolution of ligands by exponential enrichment) technology in combination with His-tag agarose beads to obtain an RNA (Ribonucleic Acid) aptamer Cereblock with high affinity and high specific binding capacity with the OsCRBN, the expression level of the OsCRBN can be stabilized under a salt stress condition by expressing the RNA aptamer Cereblock in rice, and the expression level of the OsCRBN can be stabilized under a salt stress condition. The ubiquitination level of protein in the rice is improved, and a protein aggregation structure is changed, so that the salt tolerance of the rice is improved. The RNA aptamer provided by the invention is small in molecular weight, capable of being chemically synthesized, low in cost, strong in affinity and specificity, convenient to mark, good in repeatability and stability and easy to store, has a definite application value of improving salt tolerance, and has a good popularization potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and plant stress physiology, specifically relating to an RNA aptamer that specifically recognizes rice Cereblon and its screening method and salt tolerance application. Background Technology

[0002] Salt stress leads to ion toxicity, osmotic stress, and oxidative damage in rice, ultimately resulting in growth inhibition and reduced yield. Current salt tolerance improvements primarily focus on sodium (Na+). + / K + While transport, osmotic regulation, and transcription factor regulation are possible, they can easily lead to problems such as growth burden or limited adaptability. Protein homeostasis is a crucial aspect of plant stress response, and the E3 ubiquitin ligase complex achieves rapid regulation through the selective recognition and degradation of substrate proteins. Cereblon (CRBN), as the substrate receptor of the CUL4-DDB1 E3 ubiquitin ligase complex, participates in substrate recognition and protein degradation processes, and has potential regulatory significance for cellular protein homeostasis remodeling under stress conditions. However, there is currently a lack of molecular regulatory tools targeting rice Cereblon, and there are no reports on OsCRBN nucleic acid aptamers and their screening methods, nor on their application in improving rice salt tolerance.

[0003] Aptamers are artificially synthesized single-stranded oligonucleotides with high affinity and specificity, enabling precise binding to target proteins and regulation of their function. Aptamers are typically obtained by screening large random sequence libraries using the SELEX method. Random RNA sequences readily form secondary structures such as loops, hairpins, pseudo-intercalations, and G-tetramers, thus forming highly binding complexes with proteins and other targets. Developing RNA aptamers targeting OsCRBN could serve as a novel tool for protein homeostasis regulation, potentially useful in modulating the adaptive response of rice under salt stress. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art, provide a set of RNA aptamers that specifically bind to rice Cereblon (OsCRBN) protein and their screening methods, and provide their application in improving rice salt tolerance.

[0005] This invention utilizes SELEX technology, a molecular biology technique, also known as phylogenetic index enrichment, to successfully prepare and screen a nucleic acid aptamer that binds highly specifically to rice Cereblon (OsCRBN). It was also found that the screened aptamer can regulate the OsCRBN-mediated protein homeostasis under salt stress, thereby improving the salt tolerance of rice.

[0006] The first objective of this invention is to provide an RNA aptamer that targets OsCRBN, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0007] A second objective of this invention is to provide a recombinant expression vector containing a DNA sequence encoding the aforementioned RNA aptamer.

[0008] A third objective of this invention is to provide the application of the RNA aptamer or the recombinant expression vector in improving the salt tolerance of rice.

[0009] Preferably, the application is the use of the RNA aptamer or the recombinant expression vector to promote rice growth, improve rice survival rate, increase rice chlorophyll content, or maintain rice ion homeostasis under salt stress.

[0010] Preferably, the RNA aptamer or the recombinant expression vector stabilizes the OsCRBN protein under salt stress, increases the overall protein ubiquitination level, or promotes the transformation of the OsCRBN protein into a dense structure, thereby improving the salt tolerance of rice.

[0011] A fourth objective of this invention is to provide a method for preparing transgenic rice protoplasts, including the step of transferring the protoplasts into the recombinant expression vector.

[0012] A fifth objective of this invention is to provide a method for preparing salt-tolerant rice, comprising the step of transferring the rice into the recombinant expression vector.

[0013] The beneficial effects of this invention are: 1. This invention establishes for the first time a technical system for screening and applying RNA gametes targeting rice Cereblon (OsCRBN).

[0014] By using an improved SELEX screening strategy, Cereblock, an RNA aptamer that can specifically recognize OsCRBN, was successfully obtained, filling the technological gap in rice for the lack of molecular regulatory tools targeting CRBN and providing a new technical means for regulating stress response from the perspective of protein homeostasis.

[0015] 2. The obtained RNA aptamer Cereblock has high affinity and high specificity, and its binding ability has been verified by various in vitro experimental methods.

[0016] Cereblock can specifically bind to OsCRBN under in vitro conditions. Its binding characteristics were verified by experiments such as biotinylated RNA pull-down and fluorescence polarization, indicating that the aptamer has a stable and reliable target recognition ability and is suitable for use as a molecular regulation tool.

[0017] 3. RNA aptamers are more suitable for plant system applications than traditional tools such as antibodies.

[0018] Cereblock can be prepared by in vitro transcription or chemical synthesis. It has advantages such as small molecular weight, easy modification, high stability, and good batch consistency. It overcomes the problems of difficult preparation and limited applicability of antibodies in plant systems and has good engineering and application flexibility.

[0019] 4. Cereblock can regulate the functional state of OsCRBN in vivo and significantly improve the salt tolerance of rice.

[0020] Cereblock can affect the ubiquitination level and subcellular localization behavior of OsCRBN under salt stress, thereby regulating its functional state. In rice seedling salt stress experiments, materials expressing Cereblock showed better growth phenotype, higher survival rate and more stable physiological and ion homeostasis, which clearly demonstrates its practical application effect in improving rice salt tolerance.

[0021] 5. This invention provides a novel salt tolerance improvement strategy based on protein homeostasis regulation, which has good potential for widespread application.

[0022] This technical approach breaks through the limitations of existing salt tolerance improvement methods that mainly rely on transcriptional translation regulation and ion transport. It can be extended to other crops and various abiotic stress scenarios, providing a new and universal technical approach for molecular breeding of crop stress resistance. Attached Figure Description

[0023] Figure 1 The process of screening rice Cereblock (OsCRBN) RNA aptamer is shown in Figure A. A schematic diagram of the dual-library SELEX screening process is shown in Figure B. The protein purification verification of OsCRBN is shown in Figure C. The samples loaded are protein lysis buffer (hereinafter referred to as lysis buffer), flow-through buffer, washing buffer 1, washing buffer 2, low-salt washing buffer and eluted protein sample, respectively. Figure C is the binding verification of candidate aptamers to OsCRBN.

[0024] Figure 2 The enrichment status after the 25th round of screening for the adaptor Cereblock.

[0025] Figure 3 The structure of the predicted aptamer Cereblock.

[0026] Figure 4 To experimentally verify the specific binding of the RNA aptamer Cereblock to OsCRBN.

[0027] Figure 5 Affinity assessment for Cereblock and OsCRBN.

[0028] Figure 6 Changes in ubiquitination levels under salt stress after the introduction of aptamer Cereblock into rice callus.

[0029] Figure 7 The effect of RNA aptamer Cereblock on the localization of OsCRBN protein under salt stress treatment.

[0030] Figure 8 This study evaluates and statistically analyzes the salt tolerance phenotype of rice expressing the aptamer Cereblock under salt stress. A shows a comparison of the growth phenotypes of the control group (Parental) and Cereblock-expressing rice plants after 7 days of treatment with 150 mM NaCl. B shows the salt tolerance phenotype score of rice seedlings under salt stress. C shows the statistics of fresh weight and survival rate of rice seedlings after salt treatment. D shows the chlorophyll content, seedling height, and ion homeostasis analysis of rice seedlings under salt stress. Detailed Implementation

[0031] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0032] Example 1: 1. Extraction and purification of OsCRBN protein The aboveground tissues of normally growing rice seedlings (Nipponbare, three-leaf stage) were selected, and total RNA was extracted using a plant total RNA rapid extraction kit (Sangon Biotech (Shanghai) Co., Ltd. (hereinafter referred to as Sangon), B518631-0100). The kit contained a denaturing agent lysis buffer, an RNA adsorption system, a washing buffer, and RNase-free water. High-purity RNA was obtained by adsorption through a silica membrane, and its A260 / A280 ratio was measured to be 1.8-2.1.

[0033] Using the obtained total RNA as a template, reverse transcription was performed using the EzyNGS UniScript IV first-strand cDNA synthesis kit (Sangon Biotech, N608465-0024). The kit contains reverse transcriptase, reaction buffer, dNTP mixture, Oligo(dT) primers, random hexamer primers, and RNase inhibitor. The reaction was carried out at 42-50℃ for 30-60 min to obtain rice cDNA.

[0034] Based on the coding sequence (SEQ ID NO.4) of rice Cereblon (OsCRBN, gene ID: Os05g0521500, GenBank accession number: BAS94946.1), specific primers were designed, with a restriction endonuclease site introduced at the 5′ end of the primers. Using the obtained rice cDNA as a template, the CDS sequence of OsCRBN was obtained by PCR amplification using high-fidelity DNA polymerase. The amplified product was recovered by electrophoresis and cloned into the prokaryotic expression vector pColdI with a 6×His tag to construct the OsCRBN-His fusion expression recombinant plasmid. The recombinant plasmid was transformed into Escherichia coli BL21(DE3) competent cells by heat shock. Positive clones were picked and inoculated into LB liquid medium containing the corresponding antibiotics and cultured at 37°C with shaking at 150 rpm until the bacterial culture reached OD. 600 After reaching a concentration of 0.4-0.6, the cells were cooled at 4°C for approximately 30 minutes and then induced with IPTG. The final IPTG concentration was preferably 1.0 mM. Expression was induced at 12-18°C for 12-20 h, followed by centrifugation at 4°C to collect the cells.

[0035] The bacterial pellet was resuspended in pre-cooled lysis buffer 1 (composition: 20 mM HEPES (pH 7.5), 300 mM NaCl, 0.5% NP-40, 20 mM Imidazole, 10 mM β-mercaptoethanol and protease inhibitor cocktail (MCE, HY-K0010, prepared at 1× working concentration), with the balance being H2O). The collected bacterial cells were then sonicated under ice bath conditions. During the disruption, the bacterial cells were resuspended in lysis buffer 2 (composition: 20 mM HEPES (pH 7.5), 500 mM NaCl, 10 mM Imidazole, 0.5% NP-40, 1 mM DTT, with the balance being H2O) to release soluble proteins.

[0036] After sonication, the lysis buffer containing bacterial cells was centrifuged at 4°C and 12,000-15,000 g, and the supernatant was used as the protein lysis buffer. The Ni-NTA agarose gel (Qiagen, 30210) was pre-equilibrated with lysis buffer 1, and then the above protein lysis buffer was added to ensure that the His-tagged His-OsCRBN protein was fully bound to the resin. The unbound portion was collected as the flow-through buffer. The following washing steps were then performed to remove non-specifically bound proteins: First, washing was performed using Wash Buffer 1 (composition: 20 mM HEPES (pH 7.5), 500 mM NaCl, 0.5% NP-40, 20 mM Imidazole, 1 mM DTT, balance H2O) to obtain Wash Buffer 1; then, washing was performed again using Wash Buffer 2 (composition: 20 mM HEPES (pH 7.5), 500 mM NaCl, 0.5% NP-40, 40 mM Imidazole, 1 mM DTT, balance H2O) to obtain Wash Buffer 2. To further improve purity, an additional wash was performed using a low-salt Wash Buffer (composition: 20 mM HEPES (pH 7.5), 150 mM NaCl, 0.5% NP-40, 10 mM Imidazole, 1 mM DTT, balance H2O) to reduce non-specific protein adsorption, resulting in a low-salt Wash Buffer. After washing, the His-OsCRBN fusion protein bound to the resin was eluted using elution buffer (composition as follows: 20 mM HEPES (pH 7.5), 500 mM NaCl, 250 mM Imidazole, 0.5% NP-40, 1 mM DTT, balance H2O). The eluted fraction was collected as the eluted protein. Protein lysis buffer, flow-through buffer, each washing buffer, and the eluted protein sample were sampled separately, separated by SDS-PAGE electrophoresis, and stained with Coomassie Brilliant Blue to verify the molecular weight and purity of the His-OsCRBN protein. Finally, high-purity OsCRBN protein was obtained for subsequent RNA aptamer SELEX screening. Figure 1 (B in the middle).

[0037] 2. Screening of rice Cereblon (OsCRBN) RNA aptamers This embodiment employs the phylogenetic index enrichment technique (SELEX) targeting rice Cereblon (OsCRBN) protein. A strategy involving parallel screening of two initial random libraries, subsequent mixed screening, and competitive elution is used to screen for the RNA aptamer CerebLock, which specifically binds to the OsCRBN active site. The screening process is as follows: Figure 1As shown in A, the specific steps include the following. It is worth noting that the large number of mutations occurring during the SELEX screening process mainly stems from the cumulative effect of multiple rounds of PCR amplification, in vitro transcription, and stringent selection pressure. During the repeated RNA–cDNA–DNA–RNA cycle, even with high-fidelity enzymes, base mismatches and micro-insertions / deletions are unavoidable and accumulate with each round. Simultaneously, the progressively increasing selection stringency continuously eliminates sequences with weaker affinity, preferentially retaining and enriching mutants that occur by chance but are structurally or bindingly more stable. Since the function of RNA aptamers is primarily determined by their secondary and tertiary structures, rather than a single linear sequence, these mutations do not disrupt the core structure; instead, they provide evolutionary diversity to the sequence space, promoting the directed evolution of high-affinity, high-specificity aptamers.

[0038] 2.1 Construction of the initial random DNA library Two initial single-stranded DNA random libraries with different structures were constructed, denoted as initial DNA library 1 and initial DNA library 2, respectively: (1) Initial DNA library 1: GTA TAATACGACTCACTATAG GGAGGCTCTCGGGACGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGTCCCGATGCTGCAATCGTAA (SEQ ID NO.1) contains a 40 nt random sequence region (N40) with fixed sequences at both ends for PCR amplification and T7 in vitro transcription (the underlined part is the T7 promoter sequence).

[0039] (2) Initial DNA library 2: GTA TAATACGACTCACTATAG GGAGACGCAACTGAATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTTCGGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGTAACTAGTCGCGTCAC (SEQ ID NO.2) contains two random sequence regions (N26) of 26 nt in length, with fixed sequences attached to both ends for subsequent PCR amplification and T7 in vitro transcription (the underlined part is the T7 promoter sequence).

[0040] 2.2 Separate screening of dual libraries and acquisition of RNA library The RNA libraries used for screening were obtained by in vitro transcription of the corresponding DNA libraries using T7 RNA polymerase. Specifically, the DNA libraries were double-stranded DNA libraries containing the T7 RNA polymerase promoter sequence at the 5′ end, with fixed sequences at both ends and a random region in the middle (corresponding to the designs of DNA Library 1 and DNA Library 2, respectively). Using the DNA libraries as templates, in vitro transcription was performed using a T7 RNA polymerase in vitro transcription kit (T7 High Yield RNA Synthesis Kit, Sangon Biotech, B639253). The total reaction volume was 20 μL, and the reaction was incubated at 37°C for 8 h to obtain the RNA libraries. After in vitro transcription, DNase I was added to the reaction system, and the mixture was incubated at 37°C for 30 min to completely remove the template DNA. Subsequently, the transcription products were purified and recovered using an RNA purification kit (RNA Clean & Concentrator™ Kit, Zymo Research) to remove enzymes, free nucleotides, and buffer salt ions, obtaining high-purity RNA libraries. The obtained RNA library was stored at -80℃ after the concentration was determined by spectrophotometry or quantitative fluorescence method.

[0041] Before entering the protein binding screening, the RNA library was prefolded: an appropriate amount of RNA library was heated at 95℃ for 5 min to fully denature it, then immediately placed on ice to cool for 2 min, and then subjected to a Mg²⁺-containing solution. + The RNA molecules were incubated in binding buffer at room temperature for 15 min to promote the formation of stable secondary structures. Rice OsCRBN protein was immobilized on His-tagged agarose beads (Ni-NTA Agarose, Qiagen, 30210) and incubated with RNA libraries 1 and 2, respectively, in binding buffer (20 mM HEPES (pH 7.5), 150 mM NaCl, 5 mM MgCl2, 0.05% Tween-20, 1 mM DTT, balance H2O) to allow specific or non-specific binding of RNA molecules to OsCRBN. After incubation at room temperature (25℃) for 2 h, the mixture was centrifuged at 700 g for 30 s, the supernatant was discarded, and the beads were resuspended in binding buffer. This process was repeated three times to remove unbound or weakly bound RNA, retaining only RNA molecules bound to OsCRBN.

[0042] 2.3 Elution and amplification of target-bound RNA RNA bound to OsCRBN was eluted, and the target-bound RNA aptamers were recovered. The elution method involved adding elution reagent (20 mM HEPES (pH 7.5), 150 mM NaCl, 5 mM MgCl2, 0.05% Tween-20, 1 mM DTT, 250 mM Imidazole, with the balance being H2O). The recovered RNA was reverse transcribed to generate cDNA, followed by PCR amplification. The amplified product was then transcribed again in vitro to form a new RNA library for the next round of screening. This process constitutes a complete SELEX screening cycle. Through multiple rounds of repeated screening, RNA sequences with high affinity for OsCRBN were progressively enriched.

[0043] 2.4 Acquisition and Mixed Screening of Advantageous Documents In the later stages of screening, the screening products from DNA Library 1 and DNA Library 2 were subjected to deep sequencing and bioinformatics analysis to obtain their respective dominant DNA libraries 1 and 2. These two dominant libraries were then mixed in a 1:1 ratio to form a mixed DNA library, which was used as a new starting library for further screening of the OsCRBN protein. This enhanced competition between high-affinity sequences, thereby identifying aptamer sequences with stronger binding ability and higher specificity.

[0044] 2.5 Competitive elution and enrichment of active site binding aptamers In the mixed screening stage, a competitive elution strategy was introduced to improve the functional relevance of RNA aptamer screening. Specifically, during the elution of the RNA-OsCRBN complex, a competitive small molecule, mezigdomide (CC-92480), capable of binding to the OsCRBN active site, was added to the elution system. By competitively occupying the key binding site of OsCRBN, RNA aptamers with stronger binding ability and better conformational matching to the OsCRBN active site were preferentially dissociated from the protein-RNA complex and eluted, while non-specific or weakly binding RNA molecules remained on the resin. The RNA molecules obtained by competitive elution were then purified and recovered, and used as templates for reverse transcription to synthesize the corresponding cDNA. The cDNA was further amplified by PCR using specific primers designed for a fixed sequence to obtain double-stranded DNA amplification products (…). Figure 1(C) The amplification reaction used high-fidelity Phusion DNA polymerase (ThermoFisher, F630S) to ensure sequence accuracy. After electrophoresis detection and purification, the PCR products were used as templates for in vitro transcription to generate a new RNA pool for the next round of SELEX screening. By introducing the above-mentioned strategy of combining competitive elution with DNA amplification in the later stage of screening, RNA aptamers directly related to the OsCRBN active site can be selectively enriched while maintaining sequence diversity, thereby significantly improving the functional specificity and application value of the final screening results.

[0045] 3. Sequencing data analysis workflow The raw data was quality controlled and adapters removed using the default parameters of fastp; fastq was converted to fasta using seqtk; sequence statistics were performed using the Count module of FASTAptameR 2.0, enrichment clustering analysis was performed using the Cluster module, and comparative enrichment analysis was performed between rounds using the Enrichment module. Significant enrichment was observed starting from round 10, and the enrichment trend in round 25 was consistent with that in round 24, indicating that SELEX screening was complete. Using the enrichment results of round 25 to round 1 as the standard, sequences with log2(Enrichmentb / Enrichmenta) ≥ 6 were selected as candidate RNA aptamers, where Enrichmenta = abundance in round 1 and Enrichmentb = abundance in round 25. Further combining read count, enrichment index, and cross-round consistency, the optimal sequence was selected as the candidate aptamer Cereblock (…). Figure 2 This was used for validation and functional analysis. The secondary structure of the aptamer Cereblock was predicted using the RNAstructure website; its secondary structure is shown below. Figure 3 As shown, its nucleotide sequence is GUGACGCUACUGAAUGAAGGGUCACGAUUAACAAUCUGCUGCUUCGGCGGCAUGUACCCUCCGUAACUAGUCGCGUCAC (SEQ ID NO.3).

[0046] 4. Prediction and in vitro validation of aptamer binding affinity to OsCRBN To clarify the binding ability and affinity characteristics between the RNA aptamer Cereblock and the rice Cereblon (OsCRBN) protein, this embodiment systematically verified the interaction between Cereblock and OsCRBN by combining bioinformatics prediction analysis and in vitro molecular interaction experiments.

[0047] 4.1 Biotinylated RNA pull-down assay to verify the in vitro binding of Cereblock and OsCRBN To verify the binding ability of the RNA aptamer Cereblock to rice Cereblon (OsCRBN) protein in vitro, the biotinylated RNA pull-down method was used. Figure 4 The test was conducted using A) of the rice variety. The experimental material was Nipponbare rice (…). Oryza sativa ssp. japonica The aboveground tissue of *C. Nipponbare* seedlings was used as a protein source: after removing the shells from mature seeds, they were disinfected sequentially with 70% (v / v) ethanol for 1 min, then with 2.5% (approximately 1% available chlorine) sodium hypochlorite solution for 15 min, and rinsed 5 times with sterile water. After germination in the dark at 28°C for 2 days on 1 / 2 MS solid medium, the seeds were transferred to an artificial climate chamber (28°C / 25°C day and night, 12 h light) and cultured until the three-leaf stage (culture time approximately 7-10 days). 200 mg of aboveground tissue was taken from each sample and thoroughly ground into powder with liquid nitrogen. Lysis buffer (composition: 20 mM HEPES (pH 7.5), 150 mM NaCl, 0.5% NP-40, 5 mM MgCl2, 1 mM DTT, 10% glycerol, 1 mM PMSF (added fresh), 1× protease inhibitor cocktail, balance H2O) 600 µL (approximately 3 mL / g tissue) was added for lysis, along with the RNase inhibitor SUPERase·In (ThermoFisher, AM2696, final concentration 1 U / µL). After lysis by rotary rotation at 4°C for 25 min, the mixture was centrifuged at 12,000g at 4°C for 20 min, and the supernatant was used as the total protein extract. After quantification using the BCA method, the total protein input for each pull-down reaction was standardized to 800 µg.

[0048] Biotinylated CerebLock RNA was prepared via T7 in vitro transcription incorporating Biotin-UTP: A double-stranded DNA template containing a T7 promoter (the N-terminus of the Cereblock DNA sequence containing the T7 promoter, synthesized by Sangon Biotech) was used as the transcription template. A T7 RNA polymerase transcription system (Sangon Biotech, B639253) was employed, with an ATP:CTP:GTP:UTP:Biotin-UTP molar ratio of 1:1:1:0.8:0.2 in the nucleotide donors. This allowed for random incorporation of biotin-labeled RNA during transcription. Biotin-UTP was purchased from MCE (catalog number 186033-13-6). After transcription, DNase I (1 U / 10 µL) was added, and the reaction was carried out at 37°C for 15 min to remove the DNA template. The RNA was then purified by column chromatography to obtain biotinylated RNA. Control RNA (e.g., Library 1 RNA) was prepared using the same system and proportions.

[0049] Before the binding reaction, the biotinylated RNA was prefolded: the RNA was heated at 90°C for 3 min, allowed to stand at room temperature for 5 min, and then 1× binding buffer (20 mM HEPES (pH 7.5), 150 mM NaCl, 5 mM MgCl2, 0.05% Tween-20, 1 mM DTT, with the balance being H2O) was added and incubated at 25°C for 10 min.

[0050] The results showed that ( Figure 4 In a reaction system using biotinylated CerebLock RNA as bait, OsCRBN protein (antibody Abclonal, A24651) showed a significant enrichment signal in the elution fraction. However, in the control group treated with biotinylated control RNA (library 1 RNA), the detection signal of OsCRBN was significantly weakened and approached background levels, indicating that CerebLock can specifically bind to and enrich OsCRBN protein in vitro. Furthermore, detection of OsDDB1, a component of the OsCRBN-related complex, revealed a co-enrichment signal of OsDDB1 (antibody Abcam, ab9194) in the CerebLock pull-down group. Figure 4 The signal was significantly reduced in the control RNA group (B), indicating that the binding of CerebLock to OsCRBN does not disrupt the complex structure formed by OsCRBN and its related proteins. This suggests that the RNA aptamer may participate in the homeostasis regulation of its related proteins by binding to OsCRBN.

[0051] 4.2 Quantitative determination of the binding affinity between CerebLock and OsCRBN by fluorescence polarization method To quantitatively assess the binding affinity between the RNA aptamer Cereblock and rice Cereblon (OsCRBN) protein, the dissociation constant (Kd) was determined using fluorescence polarization (FP) method. The OsCRBN protein used was the recombinant protein purified using the aforementioned method. The His-OsCRBN fusion protein obtained by elution was subjected to buffer replacement in an Amicon Ultra ultrafiltration tube (10 kDa molecular weight cutoff, Millipore) before being used for FP experiments. The specific replacement procedure was as follows: the eluted protein was added to an Amicon 10 kDa ultrafiltration tube, centrifuged at 4℃ and 4,500 g to concentrate to the desired volume, diluted with FP binding buffer, and centrifuged again; this process was repeated three times to thoroughly remove imidazole components from the eluent and complete buffer replacement. Finally, the protein was concentrated and resuspended in FP binding buffer, and the protein concentration was measured for subsequent experiments. The FP binding buffer consisted of 20 mM HEPES (pH 7.5), 150 mM NaCl, 5 mM MgCl2, 0.01% Tween-20, and 1 mM DTT, with the balance being H2O; this buffer was used to maintain protein stability and reduce non-specific adsorption. The OsCRBN protein, after being replaced with the FP binding buffer, was used for fluorescence polarization binding analysis with fluorescently labeled RNA aptamers.

[0052] 4.2.1 Preparation of fluorescently labeled RNA The fluorescently labeled CerebLock RNA used in the FP experiment was prepared using a T7 RNA in vitro transcription system: Double-stranded DNA containing a T7 promoter was used as a template (bioengineered). In the in vitro transcription reaction, all UTP was replaced by a mixture of UTP and FAM fluorescently labeled UTP (JenaBioscience, BP-59006) at a 4:1 molar ratio, allowing the transcribed RNA to be randomly incorporated with the fluorescent label during transcription. After transcription, the template DNA was removed by DNase I treatment, and high-purity fluorescently labeled RNA was obtained through column purification. The control RNA (Library 1 RNA) was prepared using the same method to ensure consistency in labeling and chemical properties.

[0053] 4.2.2 RNA prefolding treatment Before the binding reaction, fluorescently labeled RNA was dissolved in RNase-free water, heated at 90°C for 3 min, and then naturally cooled to room temperature. 1× binding buffer was then added and incubated at 25°C for 10–15 min to prefold and form a stable secondary structure. The binding buffer composition was as follows: 20 mM HEPES (pH 7.5), 150 mM NaCl, 5 mM MgCl2, 0.01% Tween-20, 1 mM DTT, 0.1 mg / mL BSA, with the balance being H2O. Adding 0.1 mg / mL BSA reduced nonspecific adsorption.

[0054] 4.2.3 Combining the reaction system with concentration gradient settings The FP binding reaction was performed in black 384-well (Corning, 3540) filters, with a total reaction volume of 20 µL per well. The OsCRBN protein concentration was kept constant at 0.5 µM, and a logarithmic gradient of fluorescently labeled RNA concentrations was established, covering the range of 0.0001–1000 µM to ensure coverage of the binding initiation, linear, and saturation regions. At least three technical replicates were performed for each concentration. After mixing, the mixture was incubated at 25°C in the dark for 25 min to allow the binding reaction to reach equilibrium.

[0055] 4.2.4 Acquisition of Fluorescence Polarization Signal Signals were read using a multi-functional microplate reader (Tecan, Sunrise™) equipped with a fluorescence polarization detection module. The excitation wavelength was set to 485±10 nm, and the emission wavelength to 535±15 nm. The polarization value (mP) or anisotropy value (r) of each reaction well was recorded. Protein-free control wells were also included to obtain the polarization signal of free RNA.

[0056] 4.2.5 Calculation of binding rate and fitting of Kd The fluorescence polarization value measured under protein-free conditions is defined as the polarization value of the free RNA state (P). free The fluorescence polarization value measured under conditions where the protein concentration reaches saturation is defined as the polarization value of the RNA-protein fully bound state (P). bound P obs This represents the observed polarization value of fluorescently labeled RNA in the system under given protein concentration conditions, reflecting the weighted average polarization signal of free RNA and bound RNA. The RNA binding rate corresponding to each protein concentration point is calculated using the following formula: f = (P obs - P free ) / (P bound - P free ).

[0057] The obtained binding rate data were used to plot binding curves with RNA concentration on the x-axis, and a one-point binding model was used for nonlinear fitting to calculate the dissociation constant Kd. Based on the fitting results ( Figure 5 The binding curve of Cereblock to OsCRBN reaches saturation at relatively low RNA concentrations. K d The Kd was approximately 0.35 µM, exhibiting high affinity; in contrast, the control RNA (library 1) produced limited binding signals only at higher concentrations, and the maximum binding was significantly limited, with a Kd of approximately 3.5 µM.

[0058] 5. Effects of aptamers on OsCRBN protein-mediated ubiquitination levels To investigate the effect of the RNA aptamer Cereblock on the level of rice Cereblon (OsCRBN)-mediated protein ubiquitination under in vivo conditions, a plant expression vector of Cereblock was constructed and introduced into rice callus via Agrobacterium-mediated transformation. To prevent rapid degradation of ubiquitinated proteins by the proteasome pathway, the proteasome inhibitor MG132 (Selleckchem, S2619) was added to the callus after infection to enrich ubiquitinated protein intermediates. Specifically, after Agrobacterium infection and Cereblock introduction, MG132 (final concentration 50 μM) was added at the start of treatment, and samples were collected at 6 h to collect total protein from the rice callus. Protein samples were separated by SDS-PAGE and transferred to a membrane, then detected by Western blot. An anti-ubiquitination antibody (Invitrogen, PA1-187) was used to analyze ubiquitination signals to reflect changes in OsCRBN-mediated ubiquitination levels.

[0059] The specific steps are as follows: The Cereblock sequence was cloned into the plant short RNA expression vector pCAMBIA1300-OsU6, which uses the rice OsU6 promoter (Pol III) to drive stable expression of the short RNA and carries a hygromycin resistance selection marker. After the constructed recombinant plasmid was verified by sequencing, it was transformed into Agrobacterium strain EHA105 using the freeze-thaw method. Positive single clones were selected and verified by PCR before being used for subsequent infection experiments.

[0060] The rice used for infection was Nipponbare ( Oryza sativa ssp. japonicaEmbryogenic callus obtained from mature seeds of Agrobacterium tumefaciens (cv. Nipponbare): After surface sterilization, seeds were cultured on callus induction medium at 28°C in the dark for 14 days. Pale yellow, dense embryogenic callus was selected for experiments. Positive Agrobacterium tumefaciens monoclonal inoculation was inoculated into YEP liquid medium containing the corresponding antibiotic and cultured with shaking at 28°C and 250 rpm until OD (Organic Growth Rate). 600 Once the bacterial culture reaches 0.8-1.0, take 1 mL of the culture, centrifuge at 5,000g for 5 min to remove the supernatant, and resuspend in AAM infection solution containing 200 μM acetylsuccinone (AS) to OD. 600 ≈0.3. The callus tissue was placed in the resuspended bacterial solution for 10-15 min, gently mixed during this time, and excess bacterial solution was removed before transferring to a co-culture medium containing AS. The culture was then carried out in the dark at 28℃ for 3 days. After co-culture, the callus tissue was transferred to a selection medium containing 150 mM NaCl and antibacterial antibiotics. A portion of the callus tissue was used for qRT-PCR verification of Cereblock expression: approximately 30 mg of callus tissue was used, and total RNA was extracted using a plant total RNA extraction kit. After DNase I treatment to remove genomic DNA, cDNA was synthesized using a reverse transcription kit. Real-time quantitative PCR amplification was performed using Cereblock-specific primers (forward primer: GTGACGCTACTGAATGAAGG, SEQ ID NO.5; reverse primer: GTGACGCGACTAGTTACGGA, SEQ ID NO.6), using rice internal reference genes. OsACT1(gene ID: Os03g0718100, forward primer: GTCCTCTTCCAGCCTTCCTT, SEQ ID NO.7; reverse primer: CTCATCCTGTCAGCAATGCC, SEQ ID NO.8) served as a control to confirm successful expression of Cereblock under the treatment conditions. Another portion of callus tissue (approximately 35 mg) was used for protein extraction: 300 μL of RIPA lysis buffer containing a protease inhibitor (RIPA Buffer was freshly prepared with a Protease Inhibitor Cocktail (MCE, HY-K0010) at a 1× working concentration) was added, and the mixture was thoroughly lysed on ice. Subsequently, it was centrifuged at 15,000 g for 15 min at 4°C, and the supernatant was used as the total protein extract. After quantification, an equal volume of the protein sample was mixed with 5× SDS loading buffer, denatured at 95°C for 3 min, separated by SDS-PAGE, and transferred to a PVDF membrane. Western blot analysis was performed, and the accumulation of OsCRBN-related ubiquitination bands was analyzed using anti-ubiquitin antibodies to assess the in vivo regulatory effect of Cereblock on the ubiquitination modification level of OsCRBN protein under salt stress.

[0061] Experimental results showed that under the conditions of treatment with 150 mM NaCl and combined with the proteasome inhibitor MG132, qRT-PCR analysis showed ( Figure 6 (A) Compared with the untransformed group and the empty vector control group, Cereblock transcripts were significantly accumulated in the Cereblock-transformed material, indicating that the aptamer can be stably expressed under salt stress. Further Western blot analysis results ( Figure 6 As shown in section B), under the same treatment conditions, the OsCRBN-related high-molecular-weight ubiquitinated protein bands were significantly enhanced and accumulated in the Cereblock-transformed group, while the ubiquitination signal was weaker in the untransformed and empty vector control groups. These results indicate that the presence of Cereblock can significantly affect the OsCRBN-mediated protein ubiquitination modification process under salt stress, suggesting that this RNA aptamer participates in the regulation of OsCRBN-related protein homeostasis pathways, and its role is closely related to the ubiquitin-proteasome pathway.

[0062] 6. Effects of Cereblock administration on OsCRBN subcellular localization under salt stress conditions Based on the detection of Cereblock's regulation of OsCRBN protein ubiquitination level, in order to further analyze the effect of Cereblock on the subcellular localization behavior of OsCRBN protein under salt stress, the intracellular distribution characteristics of OsCRBN before and after Cereblock introduction were observed and compared using the rice protoplast immunofluorescence system.

[0063] The experimental material was Nipponbare rice ( ). Oryza sativa ssp. japonica Seedlings of *C. Nipponbare* were used as the source of protoplasts. Mature seeds were surface-sterilized and germinated on 1 / 2 MS medium, cultured at 28°C under 12 h light for 7 days. Seedling leaves were then used for protoplast preparation. The leaves were cut into strips approximately 0.5–1 mm in diameter and placed in an enzymatic hydrolysate for digestion at 28°C, 50 rpm, and in the dark for 4.5 h. The hydrolysate consisted of: Cellulase R10 (1.5% w / v), Macerozyme R10 (0.4% w / v), 0.4 M mannitol, 20 mM MES (pH 5.7), 20 mM KCl, 10 mM CaCl2, and 0.1% BSA (v / v), with the remainder being H2O. After enzymatic hydrolysis, the protoplasts were filtered through a 75 μm filter, washed with W5 solution, and collected by low-speed centrifugation (100 g, 5 min). Finally, the protoplasts were resuspended in MMG solution (composition: 0.4 M mannitol, 15 mM MgCl2, 4 mM MES, balance H2O, pH 5.7) and the protoplast concentration was adjusted to approximately 1 × 10⁻⁶. 6 per mL.

[0064] Cereblock was introduced using PEG-mediated transfection. Cereblock RNA obtained through in vitro transcription via T7 cells was mixed with protoplasts and incubated at room temperature for 15 min in 40% PEG4000 solution. The reaction was then terminated with W5 solution and the cells were washed. The mixture was subsequently incubated statically at 25°C in the dark for 15 h to ensure Cereblock's full intracellular activity. After Cereblock introduction and recovery of culture, the experimental group was subjected to 150 mM NaCl salt stress for 3 h. Protoplasts before salt stress served as a "pre-salt stress" control. Immediate fixation and immunostaining were performed after treatment. During immunofluorescence staining, protoplasts were first fixed with 4% paraformaldehyde at room temperature for 25 min, washed with PBS, permeabilized with 0.2% Triton X-100 for 10 min, and then blocked with 5% BSA for 1 h. Subsequently, anti-OsCRBN primary antibody (Abclonal, A24651) was added, and the mixture was incubated overnight at 4°C. After washing, fluorescently labeled secondary antibody (Abclonal, AS053) was added, and the mixture was incubated at room temperature in the dark for 1 h. After staining, the samples were washed with PBS and mounted on glass slides. The samples were imaged and observed using a confocal laser scanning microscope. Images of different treatment groups were acquired using the same laser power, gain, and exposure parameters to ensure the comparability of the results.

[0065] Image analysis results ( Figure 7 The results showed that, under the condition of introducing Cereblock but without salt stress, the fluorescence signal of OsCRBN was mainly diffusely distributed in the cytoplasm; however, after salt stress was applied, the fluorescence signal of OsCRBN in cells introduced with Cereblock underwent significant spatial rearrangement, forming multiple locally enriched granular or aggregated structures in the cells. The OsCRBN aggregates were more clearly distinguishable after salt stress treatment, while this phenomenon was not obvious under the control condition without salt treatment.

[0066] The above results indicate that the RNA aptamer Cereblock can significantly affect the subcellular localization behavior of OsCRBN under salt stress, promoting its transformation from a diffuse distribution to a specific aggregated structure. Combined with the aforementioned results on Cereblock's regulation of OsCRBN ubiquitination levels, it can be inferred that Cereblock participates in the adaptive regulation of rice to salt stress by influencing OsCRBN protein homeostasis and its spatial organization within cells.

[0067] 7. Functional verification of aptamer Cereblock in enhancing salt tolerance in rice To verify the functional effect of the RNA aptamer Cereblock in improving salt tolerance in rice, this embodiment subjected Cereblock-expressing materials to salt stress in a rice seedling system and systematically evaluated their salt tolerance performance from multiple levels, including phenotype, growth indicators, and physiological indicators.

[0068] (1) Obtaining and processing experimental materials The experimental material was Nipponbare rice ( ). Oryza sativa ssp. japonica (cv. Nipponbare). The Cereblock sequence was constructed into the plant short RNA expression vector pCAMBIA1300-OsU6, and transgenic materials stably expressing Cereblock were obtained by Agrobacterium-mediated transformation of rice. After confirming positive plants through resistance screening, PCR identification, and aptamer expression detection, at least three independent transformation events were selected for salt tolerance analysis; materials from the original library 1 with the same background were used as controls. Seeds were surface sterilized and germinated under the same conditions, and cultured on 1 / 2 MS medium at 28℃ and 12 h light conditions until the seedling stage of 10 days for salt stress treatment experiments.

[0069] (2) Salt stress treatment program Salt stress treatment was performed using NaCl solution. Seedlings were transferred to a nutrient solution containing NaCl, with a final NaCl concentration of 150 mM to simulate medium-to-high intensity salt stress conditions. Salt treatment lasted for 7 days. Each treatment group contained at least 20 seedlings, and at least three biological replicates were established.

[0070] (3) Observation and scoring of salt tolerance phenotype After salt treatment, the overall growth phenotype of rice seedlings was observed and recorded, including plant uprightness, leaf curling or yellowing, and overall growth status. Based on this, the salt tolerance of seedlings was graded and scored according to the degree of leaf yellowing, wilting, and plant vigor, with the scoring criteria quantified and statistically analyzed according to a pre-set level. By comparing the score distributions of different treatment groups, the effect of Cereblock expression on the salt tolerance phenotype of rice was evaluated.

[0071] (4) Growth indicators and survival rate determination Growth indicators of seedlings after salt stress treatment were statistically analyzed. After removing the seedlings and drying off the surface moisture, the fresh weight of each plant was measured to reflect biomass accumulation under salt stress. Simultaneously, the number of surviving plants in each treatment group was counted, and the survival rate was calculated (survival rate = number of surviving plants / total number of plants in each treatment group × 100%). The effect of Cereblock on the growth and survival ability of rice under salt stress was evaluated by comparing the control group with the Cereblock expression group.

[0072] (5) Physiological indicators and ion homeostasis analysis To further assess rice salt tolerance from a physiological perspective, the relative chlorophyll content (SPAD value) of leaves was measured using a SPAD meter to reflect changes in plant photosynthetic capacity under salt stress; seedling height was measured to assess the degree of growth inhibition. Simultaneously, aboveground tissues of seedlings were collected, dried, or digested, and then Na+ was measured. + and K + Content (flame photometry), and calculate Na + / K + The ratio is used to assess the ion homeostasis within the plant.

[0073] (6) Results Analysis and Functional Effect Description The results of comprehensive phenotypic observation, growth index and physiological index analysis show that, under the same salt stress conditions, the overall growth status of rice seedlings expressing Cereblock was significantly better than that of the control group. Figure 8 In the A category, the salt tolerance phenotype score is relatively high ( Figure 8 The fresh weight and survival rate of the B group were also significantly higher than those of the control group (B group). Figure 8 (C in the text); at the same time, its chlorophyll content and seedling height remain at a high level, Na + / K + The ratio was significantly lower than that of the control group ( Figure 8 The D in the figure indicates that it has better photosynthetic capacity, growth potential and ion homeostasis regulation ability under salt stress conditions.

[0074] The above results indicate that the expression of the RNA aptamer Cereblock can significantly enhance the rice's tolerance to salt stress, demonstrating its clear functional effect and application value in improving rice salt tolerance.

Claims

1. An RNA aptamer targeting OsCRBN, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

3.

2. A recombinant expression vector, characterized in that, A DNA sequence containing the RNA aptamer of claim 1.

3. The application of the RNA aptamer of claim 1 or the recombinant expression vector of claim 2 in improving the salt tolerance of rice.

4. The application according to claim 3, characterized in that, The application of the RNA aptamer of claim 1 or the recombinant expression vector of claim 2 in promoting rice growth, improving rice survival rate, increasing rice chlorophyll content, or maintaining rice ion homeostasis under salt stress.

5. The application according to claim 4, characterized in that, The RNA aptamer of claim 1 or the recombinant expression vector of claim 2 can stabilize OsCRBN protein under salt stress, increase the overall protein ubiquitination modification level, or promote the transformation of OsCRBN protein to a dense structure, thereby improving rice salt tolerance.

6. A method for preparing transgenic rice protoplasts, characterized in that, Includes the step of transferring into the recombinant expression vector as described in claim 2.

7. A method for preparing salt-tolerant rice, characterized in that, Includes the step of transferring into the recombinant expression vector as described in claim 2.