Check patentability & draft patents in minutes with Patsnap Eureka AI!

A kind of Songjiang perch tf-hepcidin gene, Songjiang perch tf-hepcidin mature peptide protein and its application

A peptide protein, a mature technology, applied in the field of genetic engineering, can solve the problems of protease degradation synthesis cost, no antimicrobial peptide application report, easy inactivation, etc.

Inactive Publication Date: 2020-01-24
SHANDONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Similar to the application research of other antimicrobial peptides, fish-derived antimicrobial peptides face some urgent problems, such as easy inactivation in vivo, easy to be degraded by proteases, and expensive synthesis, etc.
Therefore, so far, the relatively mature antimicrobial peptides are mainly derived from insects and mammals, and are mainly used in livestock and poultry farming. There are almost no reports on the application of antimicrobial peptides, especially those derived from aquatic animals, in aquaculture.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Songjiang perch tf-hepcidin gene, Songjiang perch tf-hepcidin mature peptide protein and its application
  • A kind of Songjiang perch tf-hepcidin gene, Songjiang perch tf-hepcidin mature peptide protein and its application
  • A kind of Songjiang perch tf-hepcidin gene, Songjiang perch tf-hepcidin mature peptide protein and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Cloning of Songjiang perch Tf-Hepcidin gene and acquisition of full-length cDNA sequence:

[0025] First, 2 hours after Songjiang perch was infected with Vibrio anguillarum and lipopolysaccharide (LPS), the Songjiang perch liver, gills, stomach, intestine, spleen, kidney, skin, brain and other tissues were taken to construct a full-length cDNA sequence library of Songjiang perch. Obtain Tf-Hepcidin gene fragment information and monoclonal strain (vector pDNR-LIB) by randomly selecting single clones for sequencing, and then extract the plasmid and perform PCR with PCR primers M13-47 and RV-M to obtain the complete cDNA of Tf-Hepcidin gene. long sequence. in:

[0026] PCR primers:

[0027] M13-47: GAGCGGATAACAATTTCACACAGG;

[0028] RV-M: CGCCAGGGTTTTTCCCAGTCACGAC;

[0029] PCR reaction conditions:

[0030] Pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 45s, renaturation at 56°C for 45s, extension at 72°C for 30s, 35 cycles, and a total ex...

Embodiment 2

[0031] Embodiment 2: antibacterial activity detection

[0032] In this example, the tube-and-disk method [137] (Oxford cup method) to detect whether the purified Tf-Hepcidin mature peptide protein of Songjiang perch has antibacterial activity.

[0033] Select 4 Gram-negative bacteria: Escherichia coli E.coli, V. anguillarum, Klebsiella pneumoniae K.pneumoniae, Pseudomonas aeruginosa P.aeruginosa and 4 Gram-positive bacteria: Grape aureus Bacillus S.aureus, Bacillus thuringiensis B.thuringiensis, Bacillus megaterium B.megaterium, Bacillus subtilis B.subtilis were used for antibacterial experiments.

[0034]First, pick a single colony of each bacterium on a solid plate and inoculate it in 3 mL of liquid medium for culture at 37°C (Vibrio anguillarum at 28°C). When the bacteria grow to the logarithmic growth phase, take 50 μL and evenly spread it on LB solid medium surface, then place 3 sterilized Oxford cups, respectively add purified Songjiang perch Tf-Hepcidin mature peptide...

Embodiment 3

[0040] Embodiment 3: sugar binding test

[0041] In order to explore the antibacterial mode of Songjiang perch Tf-Hepcidin mature peptide protein, ELISA was used to detect whether it could interact with peptidoglycans (PGN), lipopolysaccharides (LPS), lipoteichoic acid (LTA), etc. Pathogen-associated pattern molecule binding.

[0042] Weigh 1mg of LTA, LPS and PGN respectively, dissolve in 200μl double distilled water to make mother solution (polysaccharide 20% power, 2×3s ultrasonic crushing can dissolve in water), then absorb 16μl mother solution and add to 984μl double distilled water to make The 80μg / ml solution is ready for use.

[0043] The specific steps of the sugar binding test are as follows:

[0044] (1) Packing plate: add 50 μL of polysaccharide to a 96-well plate, and place it in a constant temperature incubator at 25° C. to dry overnight (note: the 96-well plate is of high affinity).

[0045] (2) Fixation: Incubate at 60° C. for 30 minutes in the morning of th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Songjiang perch Tf-Hepcidin gene, Songjiang perch Tf-Hepcidin mature peptide protein and application thereof, which belong to the technical field of genetic engineering, obtain the full-length sequence of Songjiang perch Tf-Hepcidin gene and can be applied in aquaculture fish-derived antimicrobial peptides. The Songjiang perch Tf-Hepcidin gene has a full-length sequence of 988bp and includes a 273bp gene open reading frame. The invention can be used in the preparation of antibacterial composition or fish feed.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a full-length cDNA sequence of Songjiang perch Tf-Hepcidin gene, Songjiang perch Tf-Hepcidin mature peptide protein expressed by the yeast eukaryotic expression system and application thereof. Background technique [0002] Songjiang perch (Trachidermus fasciatus), also known as four-gill perch, belongs to the order Scorpaeniforme, the family Cottidae, and the genus Trachidermus. The whole growth period faces two more complicated living environments of seawater and freshwater, and was once widely distributed in my country's coastal areas. In recent years, due to water pollution and the construction of river water conservancy and other reasons, the habitat, reproduction and migration routes of Songjiang perch have been destroyed, resulting in a sharp decline in the population of this species, and the distribution area has also shrunk sharply. Significance. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C07K14/46A61K38/17A61P31/04A23K50/80A23K20/147C12R1/84
CPCA61K38/00C07K14/461
Inventor 刘莹莹韩晓弟于珊珊陈学昭柴迎梅张雷祝茜
Owner SHANDONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More