Trachidermus fasciatus Tf-Hepcidin gene, Trachidermus fasciatus mature peptide protein and application thereof
A peptide protein and gene technology, applied in the field of Songjiang perch Tf-Hepcidin mature peptide protein, can solve the problems of expensive, no antimicrobial peptide antibacterial peptide application report, easy to be degraded by protease, synthesis cost, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1: Cloning of Songjiang perch Tf-Hepcidin gene and acquisition of full-length cDNA sequence:
[0025] First, 2 hours after Songjiang perch was infected with Vibrio anguillarum and lipopolysaccharide (LPS), the Songjiang perch liver, gills, stomach, intestine, spleen, kidney, skin, brain and other tissues were taken to construct a full-length cDNA sequence library of Songjiang perch. Obtain Tf-Hepcidin gene fragment information and monoclonal strain (vector pDNR-LIB) by randomly selecting single clones for sequencing, and then extract the plasmid and perform PCR with PCR primers M13-47 and RV-M to obtain the complete cDNA of Tf-Hepcidin gene. long sequence. in:
[0026] PCR primers:
[0027] M13-47: GAGCGGATAACAATTTCACACAGG;
[0028] RV-M: CGCCAGGGTTTTTCCCAGTCACGAC;
[0029] PCR reaction conditions:
[0030] Pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 45s, renaturation at 56°C for 45s, extension at 72°C for 30s, 35 cycles, and a total ex...
Embodiment 2
[0031] Embodiment 2: antibacterial activity detection
[0032] In this example, the tube-and-disk method [137] (Oxford cup method) to detect whether the purified Tf-Hepcidin mature peptide protein of Songjiang perch has antibacterial activity.
[0033] Select 4 Gram-negative bacteria: Escherichia coli E.coli, V. anguillarum, Klebsiella pneumoniae K.pneumoniae, Pseudomonas aeruginosa P.aeruginosa and 4 Gram-positive bacteria: Grape aureus Bacillus S.aureus, Bacillus thuringiensis B.thuringiensis, Bacillus megaterium B.megaterium, Bacillus subtilis B.subtilis were used for antibacterial experiments.
[0034]First, pick a single colony of each bacterium on a solid plate and inoculate it in 3 mL of liquid medium for culture at 37°C (Vibrio anguillarum at 28°C). When the bacteria grow to the logarithmic growth phase, take 50 μL and evenly spread it on LB solid medium surface, then place 3 sterilized Oxford cups, respectively add purified Songjiang perch Tf-Hepcidin mature peptide...
Embodiment 3
[0040] Embodiment 3: sugar binding test
[0041] In order to explore the antibacterial mode of Songjiang perch Tf-Hepcidin mature peptide protein, ELISA was used to detect whether it could interact with peptidoglycans (PGN), lipopolysaccharides (LPS), lipoteichoic acid (LTA), etc. Pathogen-associated pattern molecule binding.
[0042] Weigh 1mg of LTA, LPS and PGN respectively, dissolve in 200μl double distilled water to make mother solution (polysaccharide 20% power, 2×3s ultrasonic crushing can dissolve in water), then absorb 16μl mother solution and add to 984μl double distilled water to make The 80μg / ml solution is ready for use.
[0043] The specific steps of the sugar binding test are as follows:
[0044] (1) Packing plate: add 50 μL of polysaccharide to a 96-well plate, and place it in a constant temperature incubator at 25° C. to dry overnight (note: the 96-well plate is of high affinity).
[0045] (2) Fixation: Incubate at 60° C. for 30 minutes in the morning of th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
