Application of mir-4527 in the preparation of preparations for diagnosing or treating tumor drug resistance
A technology of mir-4527 and drug resistance, applied in the field of molecular biology, to achieve the effect of reducing expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Screening of tumor drug-resistant cell lines
[0021] The initial cell line was SK-OV-3 cells (ovarian cancer cells, purchased from Shanghai Yiyan Biotechnology Co., Ltd.), and the specific operation steps were as follows:
[0022] (1) Place SK-OV-3 cells in RPMI-1640 culture medium containing 10% fetal bovine serum at 37°C and 5% CO 2 , Humidity is cultivated in the incubator under the condition of 95%;
[0023] (2) When the SK-OV-3 cells in the logarithmic growth phase are cultivated to a 75% adherence rate, the supernatant is discarded, and a culture solution containing cisplatin is added, and the action concentration of the cisplatin is 0.04 μg / ml, After incubating for 1 hour, discard the drug-containing culture medium, add 1.5ml of trypsin-EDTA digestion solution, and then add 1×10 5 / ml cell concentration inoculated in a new culture flask, at 37°C, 5% CO 2 , Humidity is 96% under the condition of culturing, when the cells grow to 75% adhesion rate, ad...
Embodiment 2
[0025] Example 2 Difference analysis of mRNA and miRNA expression
[0026] RNA extraction:
[0027] (1) Separate the collected SK-OV-3 drug-resistant cells and the control group SK-OV-3 cells, add 1ml Trizol in the EP tube, add Trizol, pipette and lyse, and let stand at room temperature for 5-10min;
[0028] (2) Add 0.2m1 chloroform, shake vigorously for 15s, let stand at room temperature for 2-4min, and centrifuge at 10000 rpm for 15min at 4°C;
[0029] (3) Suck out about 600ul of the supernatant water phase and transfer it to another centrifuge tube, add 500:1 isopropanol, mix it upside down, and let it stand at room temperature for 10 minutes;
[0030] (4) Centrifuge at 10,000 g for 10 min at 4°C, discard the supernatant; add 1 ml of 75% cold ethanol for spin washing, and wash the isopropanol;
[0031] (5) Centrifuge at 7500g for 5min at 4°C, remove ethanol, let it dry for 5-10min, and dissolve RNA with 20u1 DEPC water.
[0032] RNA extraction standards: RNA purity: OD26...
Embodiment 3
[0035] Example 3 Real-time PCR detection of miR-3689a-5p expression in drug-resistant SK-OV-3 cells
[0036] Take 1 μg of the total RNA extracted in Example 2, and use III Reverse Transcriptase (invitrogen, catalog number 18080-044) to carry out cDNA reverse transcription, and the experimental operation is carried out according to the product manual. The obtained cDNA was stored in a -20°C refrigerator for later use.
[0037] Preparation of RT system: 1 μg total RNA as template RNA; 5×miScript HiSpec Buffer 4 μl; 10×Nucleics Mix 2 μl; miScript Reverse Transcriptase Mix 2 μl; sterilized water to make up to 20 μl. Incubate at 37°C for 60 minutes on an ABI9700 PCR instrument to complete the reverse transcription reaction, then stop the reaction at 95°C for 5 minutes. Add 80 μl Nuclease-free H 2 O was diluted to 100 μl and stored in a -20°C refrigerator for later use.
[0038] Reverse transcription primer:
[0039] 5'GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAC AGTC 3' (SEQ ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More