Preparation method of random sgRNA library of target sequence by enzymatic method

Abstract

The present invention provides a method for preparing an enzymatic target sequence random sgRNA library, characterized in that the steps include: using random nicking enzyme Nt.CviPII to cut the PAM region of the sample DNA target sequence; connecting the fragmented DNA with a linker magnetic bead containing a BbsI restriction site; BbsI cutting and releasing DNA; random primer extension; connecting the sgRNA skeleton containing an MmeI restriction site; MmeI cutting and releasing the original spacer region; connecting the T7 promoter sequence; amplifying to obtain the sgRNA library template containing the T7 promoter; and in vitro transcription to obtain the sgRNA library. The preparation method of the enzymatic target sequence random sgRNA library of the present invention can prepare all sgRNA groups that randomly cover the target region at one time, has the advantages of low cost, simple preparation, uniform coverage, small preference, no restriction on the length of the target sequence, and no need to design sgRNA in large quantities, and has important application value in the capture and removal of target genes.

Description

Technical Field

[0001] The patent of this invention relates to a method for preparing an enzymatic target sequence random sgRNA library, which belongs to the field of biotechnology. Background Art

[0002] Since its development, CRISPR gene editing technology has been widely used in various fields such as gene therapy, in vitro diagnosis, gene capture and target gene removal, and won the 2020 Nobel Prize in Physiology or Medicine. It is an efficient and practical technology. The practical CRISPR system mainly consists of two parts: one is the Cas protein with two endonuclease active sites, which is responsible for cutting the two strands of DNA at the target site; the other is the guide RNA (sgRNA) with a DNA pairing sequence at the target site and a Cas protein binding sequence, which is responsible for recruiting Cas proteins and guiding Cas proteins to bind to complementary paired target sites. In the CRISPR system, the Cas protein first binds to the sgRNA to form a Cas-sgRNA complex and searches on the DNA. When the region complementary to the sgRNA is retrieved (the original spacer region, ProtoSpacer), and the NGG sequence (PAM sequence) exists at the 3' end of the ProtoSpacer region, the Cas protein unwinds the target site, allowing the unwound double-stranded DNA to enter the DNA cutting active domain of the Cas protein, and the Cas protein cuts the double-stranded DNA to produce double-stranded DNA breaks. The broken DNA is repaired by homologous recombination repair HR or non-homologous end joining NHEJ and other DNA damage repair methods to complete the editing of the target gene. The Cas proteins currently used for commercial applications mainly include Cas9, Cas12, Cas13 and Cas14 and their variants. Different Cas proteins recognize different PAM sequences and requirements, and the length of ProtoSpacer is also different. Therefore, different CRISPR systems have different application scenarios.

[0003] In addition to the purification and preparation of Cas proteins, the in vitro construction and synthesis of sgRNA is also an important part of the commercial application of CRISPR. The conventional method requires the use of primer synthesis to synthesize the target sgRNA primer containing the T7 promoter, and then use overlapping PCR to obtain the full-length sgRNA backbone template, and use in vitro transcription to obtain the required sgRNA. This method is short in time, low in cost, and highly controllable. It has been commercialized on a large scale and has become the main form of in vitro preparation of sgRNA, but there is still a problem of low throughput. Gene capture or removal usually requires the capture or removal of large areas of the genome, and requires coverage of up to 1M bp or even the entire complete genomic DNA. This requires the design and synthesis of tens of millions of sgRNAs. In the design and synthesis of sgRNA, both cost and technology are great challenges. Summary of the invention

[0004] The purpose of the present invention is to provide a method for preparing an enzymatic target sequence random sgRNA library.

[0005] The technical solution adopted by the present invention is: a method for preparing a random sgRNA library of target sequences by an enzymatic method, characterized in that the steps include:

[0006] (1) using random nicking enzyme Nt.CviPII to treat sample DNA, Nt.CviPII cuts the PAM region of the target sequence to obtain fragmented double-stranded DNA, and denatures the double-stranded DNA to obtain fragmented single-stranded DNA, wherein the denaturation treatment can be conventional high-temperature deformation;

[0007] (2) adding adapter magnetic beads containing a BbsI restriction site to the reaction system of step (1), and connecting the 3' end of the adapter to the fragmented single-stranded DNA;

[0008] (3) Cutting the DNA connected to the magnetic beads with BbsI enzyme to release single-stranded DNA;

[0009] (4) Random primer extension to convert single-stranded DNA into double-stranded DNA;

[0010] (5) Connecting the sgRNA backbone containing the MmeI restriction site to the 3' end of the double-stranded DNA;

[0011] (6) using MmeI to cut the ligation product of step (5) to release the original spacer region;

[0012] (7) connecting the T7 promoter sequence to the 5' end of the protospacer region;

[0013] (8) Amplifying and obtaining a sgRNA library template containing a T7 promoter;

[0014] (9) Obtain sgRNA library by in vitro transcription.

[0015] Preferably, the sample DNA is genomic DNA, PCR product or DNA library.

[0016] Preferably, the forward sequence of the linker magnetic beads in step (2) is / biotin / -TTTTTGAAGA, and the reverse sequence is / NH2C6 / -NNNNNNNHGGTCTTCAAAAA- / NH2C6 / , the two sequences are annealed at equimolar concentrations, and the magnetic beads are streptavidin magnetic beads.

[0017] Preferably, in step (2), T4 DNA ligase or E. coli DNA ligase is used to connect the fragmented DNA to the linker.

[0018] Preferably, the random primer in step (4) is a 6-base random primer, and Klenow DNA polymerase is used for extension.

[0019] Preferably, the sgRNA backbone of step (5) is a double-stranded DNA formed by complementary pairing of two single-stranded DNAs, wherein the forward sequence is / rApp / -NNNCGGTTGGAGCTAGAAATAGCAAGTCAACCTAACGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT- / NH2C6 / ; the reverse sequence is / NH2C6 / -AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCGTTAGGTTGACTTGCTATTTCTAGCTCCAACC- / ddG / .

[0020] Preferably, in step (5), T4 DNA ligase mutant K159L is used to connect the sgRNA backbone to the double-stranded DNA.

[0021] Preferably, step (7) uses T4 DNA ligase, the forward sequence of the T7 promoter is / NH2C6 / -TTCTAATACGACTCACTATAGGNN, and the reverse sequence is / ddC / -CTATAGTGAGTCGTATTAGAA- / NH2C6 / .

[0022] Preferably, the forward sequence of the primer pair used in the amplification reaction of step (8) is TTCTAATACGACTCACTATAGG, and the reverse sequence is AAAAGCACCGACTCGGTGCC.

[0023] Preferably, step (9) uses T7 RNA polymerase for transcription, and uses RNA recovery magnetic beads to recover the sgRNA library.

[0024] The beneficial effects of the present invention are:

[0025] The preparation method ERSP (Enzymatical Random sgRNA Preparation) of the enzymatic target sequence random sgRNA library of the present invention can prepare all sgRNA groups that randomly cover the target region at one time. The principle and process of ERSP are as follows: the PAM region of the target sequence is cut using the random nicking enzyme Nt.CviPII; DNA denaturation, magnetic beads connected to the linker containing the BbsI recognition site; BbsI cutting, releasing DNA; connecting the sgRNA backbone containing MmeI; MmeI cutting, obtaining the original spacer region sequence; connecting the T7 promoter; amplifying to obtain the sgRNA library with the T7 promoter; in vitro transcription to obtain the target sequence sgRNA library. ERSP has the advantages of low cost, simple preparation, uniform coverage, small preference, no restriction on the length of the target sequence, and no need to design sgRNA in large quantities, and has important application value in the capture and removal of target genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the principle and process of ERSP technology.

[0027] Figure 2 Effects of different Nt.CviPII input amounts on DNA fragmentation. The left lane is 0.5U, the middle lane is 1U, and the right lane is 2U.

[0028] Figure 3 Electrophoresis of DNA after ligation of sgRNA backbone. The left side is 18S / 28S DNA, and the right side is human whole genome DNA.

[0029] Figure 4 Electrophoresis of amplified products of the full coverage sgRNA library constructed by ERSP for 18S / 28S DNA (left) and whole human genome DNA (right).

[0030] Figure 5 Electrophoresis of the sgRNA library prepared by in vitro transcription of the amplified products of ERSP to construct a full coverage sgRNA library of 18S / 28S DNA (left) and human whole genome DNA (right).

[0031] Figure 6 Distribution of Nt.CviPII restriction sites on 18S rRNA DNA (shaded area).

[0032] Figure 7 The 18S / 28S ERSP library was used to test the effectiveness of CRISPR in rRNA removal.

[0033] Figure 8 Testing the effectiveness of the human whole genome ERSP library on CRISPR removal of human host genome. DETAILED DESCRIPTION

[0034] In order to further describe the specific content of the present invention, the present invention is described in detail with reference to the examples below. The operation methods and reagents involved in the examples are well known to those skilled in the art. It should be understood that the specific examples described below are only used to explain the invention in detail, but the implementation mode of the present invention is not limited by the following examples. The linker sequence and modification used in this example are shown in Table 1, and N is any base among A, T, C, and G. The process of ERSP is as follows Figure 1 shown.

[0035] Table 1 Linker sequences and modifications

[0036]

[0037]

[0038] Example 1: ERSP process

[0039] (1) Preparation of magnetic beads containing Bbs linkers

[0040] BbsI-F and BbsI-R were dissolved to 100 μM with 100 mM NaCl, mixed at equimolar concentrations, reacted at 95 °C for 5 min, and decreased by 1 °C per minute. After the reaction, the annealed linker was diluted to 10 μM with water. 20 μL of the diluted linker was taken, 5 μL of streptavidin magnetic beads C1 (Thermo) were added, and mixed by rotation at room temperature for 30 min. The magnetic beads were washed 3 times with 100 mM NaCl.

[0041] (2) Restriction enzyme cleavage that recognizes the PAM sequence:

[0042] Table 2 Restriction enzyme digestion system

[0043] Components Dosage Human genomic DNA 1 μg 10×rCutSmart buffer 1μL Nt.CviPII(NEB) 0.5-2U Rehydrate to 10μL

[0044] The reaction was carried out at 37°C for 30 min, and at 98°C for 10 min, and then immediately placed on ice. Figure 2 shown.

[0045] Table 3 Adapter magnetic beads containing BbsI restriction site connection

[0046] Components Dosage The above reaction system 10μL 50% PEG8000 8μL 10×T4 Ligase Reaction Buffer 5μL Rehydrate to 50μL

[0047] Resuspend the magnetic beads in the prepared reaction system, add 2000U T4 DNA Ligase (NEB) and mix well, connect at 20℃ for 1h, shake for 15s every 3min, and the speed is 1000rpm / min. After the reaction, wash the magnetic beads 3 times with 100mM NaCl. Prepare 30μL (10U) of BbsI (NEB) reaction system according to the instructions, resuspend the magnetic beads, digest at 37℃ for 1h, shake for 15s every 3min, and the speed is 1000rpm / min. After the reaction, take the supernatant. React at 94℃ for 10min and put it on ice immediately.

[0048] Table 4 Random primer extension system

[0049] Components Dosage The above reaction system 30μL 1mM N6 1μL <![CDATA[10×NEBuffer TM 2]]> 3μL Klenow fragment(NEB) 10U Rehydrate to 60μL

[0050] React at 37℃ for 20min. React at 60℃ for 5min.

[0051] (3) Connecting the sgRNA backbone containing restriction enzyme cleavage sites.

[0052] Backbone annealing: sg-F and sg-R were dissolved to 100 μM in 100 mM NaCl solution, mixed at equimolar concentrations, reacted at 95 °C for 5 min, and decreased by 1 °C per minute. After the reaction, the annealed backbone was diluted to 10 μM with water.

[0053] Table 5 Skeleton connection system

[0054] Components Dosage The above reaction system 60μL 10μM sgRNA backbone adapter 5μL 10×T4 Ligase Reaction Buffer 5μL 50% PEG8000 10μL T4 DNA Ligase(K159L) 2000U Rehydrate to 100μL

[0055] React at 20℃ for 30min. After the reaction, add 50μL Ampure DNA beads to recover DNA. Elute with 22μL water. Sequences above 140bp are recovered by DNA gel. The electrophoresis of DNA after connecting the sgRNA backbone is shown in the figure below. Figure 3 shown.

[0056] (5) MmeI digestion

[0057] Table 6

[0058]

[0059]

[0060] Incubate at 37℃ for 2h. After the reaction, add 70μL Ampure DNA beads to recover DNA and elute with 42μL water.

[0061] (6) T7 promoter ligation.

[0062] Adapter annealing: Dissolve T7-F and T7-R to 100μM with 100mM NaCl solution, take 10μL T7-F and 10μL T7-R in a PCR tube. React at 95℃ for 5min, and reduce 1℃ per minute. After the reaction, dilute the annealed adapter to 10μM with water.

[0063] Table 7 Connector connection system:

[0064] Components Dosage The recovered DNA 40μL 10 μM T7 adapter 5μL 10×T4 Ligase Reaction Buffer 5μL T4 DNA Ligase 2000U Rehydrate to 50μL

[0065] Incubate at 20°C for 1 hour. After the reaction, add 22.5 μL Ampure DNA beads to recover the DNA and remove the unconnected adapters. Elute with 22 μL water.

[0066] (5) sgRNA library amplification

[0067] Table 8 sgRNA library amplification system

[0068] Components Dosage The recovered DNA 20μL 10μM sgPCR-F / R 5μL Phusion High-Fidelity PCR Master Mix 25μL Rehydrate to 50μL

[0069] After denaturation at 98°C for 3 min, the library was amplified by cyclic amplification at 98°C for 10 s, annealing at 60°C for 20 s, and extension at 72°C for 10 s. The amplified product was recovered using 70 μL Ampure DNA beads and eluted with 22 μL DEPC water. The electrophoresis of the amplified product is shown in Figure 4 shown.

[0070] (6) In vitro transcription of sgRNA library

[0071] Table 9

[0072]

[0073]

[0074] After reacting at 37°C for 4 hours, 10U DNase I (TAKARA) was added and reacted at 37°C for 1 hour. 50μL Ampure RNAbeads (Beckman) were added to recover RNA. The size of sgRNA was detected by agarose gel electrophoresis.

[0075] The electrophoresis diagram of the sgRNA library prepared by in vitro transcription of the amplified product is shown in Figure 5 shown.

[0076] Example 2: Application of ERSP in rRNA and host genome removal.

[0077] In this example, we first prepared a random sgRNA library covering 18SrRNA and 28S rRNA using human RNA as a template according to the ERSP method in Example 1; and prepared a random sgRNA library covering human genomic DNA using human genomic DNA as a template, referred to as the ERSP library, and applied it to rRNA removal and host genome removal. The specific implementation is as follows:

[0078] Table 10 sgRNA library and Cas9 protein pre-assembly:

[0079] Components Dosage ERSP Library 2-10 μg Cas9 (NEB) 0.2-0.5 μg 500 mM NaCl 1μL Total volume 5μL

[0080] 37℃30min.

[0081] Table 11 CRISPR cleavage

[0082] Components Dosage Cas9-sgRNA library 5μL RNA or DNA library 1-100ng 10×NEB buffer 3.1 1μL Total volume 10μL

[0083] 37℃30-90min, 90℃10min.

[0084] (5) Library amplification

[0085] Table 12

[0086] Components Dosage The above reaction system 10μL Index Primer F / R(Yeasen,12610) 5μL 2×Canace PCR mix 25μL Rehydrate to 50μL

[0087] After denaturation at 98°C for 3 min, the library was amplified by cyclic amplification with denaturation at 98°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s. The amplified product was recovered using 45 μL Ampure DNA beads and eluted with 22 μL DEPC water.

[0088] The prepared library was quality checked by Qsep100 and then sequenced and analyzed on Illumina's NovaSeq 6000 platform.

[0089] Nt.CviPII cleavage sites are widely and randomly distributed on 18S rRNA (see Figure 6 ).

[0090] RNA library construction and sequencing results Figure 7 As shown in Figure 2, the sgRNA library prepared by the ERSP method can effectively remove 18S and 28S rRNA. Figure 8 As shown, the sgRNA library prepared by the ERSP method can effectively remove human host genomic DNA during the DNA library construction process.

[0091] In summary, the present invention discloses an enzymatic method for preparing random sgRNA of target sequence, ERSP (Enzymatical Random sgRNA Preparation), which can prepare all sgRNA groups that randomly cover the target region at one time. The principle and process of ERSP are as follows: use random nicking enzyme Nt.CviPII to cut the PAM region of the target sequence; DNA denaturation, magnetic beads connected to the linker containing BbsI recognition site; BbsI cutting, releasing DNA; connecting sgRNA backbone containing MmeI; MmeI cutting, obtaining the original spacer region sequence; connecting T7 promoter; amplification to obtain sgRNA library with T7 promoter; in vitro transcription to obtain target sequence sgRNA library. ERSP has the advantages of low cost, simple preparation, uniform coverage, small preference, no restriction on target sequence length and no need to design sgRNA in large quantities, and has important application value in capturing and removing target genes.

Claims

1. A method for preparing an enzymatic target sequence random sgRNA library, characterized in that The steps include: (1) The sample DNA is treated with the random nicking enzyme Nt.CviPII, which cuts the PAM region of the target sequence to obtain fragmented double-stranded DNA, and the double-stranded DNA is denatured to obtain fragmented single-stranded DNA; (2) adding adapter magnetic beads containing a BbsI restriction site to the reaction system of step (1), and connecting the 3' end of the adapter to the fragmented single-stranded DNA; (3) Cut the DNA connected to the magnetic beads with BbsI enzyme to release single-stranded DNA; (4) Random primer extension to convert single-stranded DNA into double-stranded DNA; (5) Connect the sgRNA backbone containing the MmeI restriction site to the 3' end of the double-stranded DNA; (6) Cutting the ligation product from step (5) with MmeI to release the original spacer region; (7) Connecting the T7 promoter sequence to the 5' end of the protospacer region; (8) Amplify and obtain the sgRNA library template containing T7 promoter; (9) Obtaining sgRNA library by in vitro transcription; The forward sequence of the linker magnetic beads in step (2) is / biotin / -TTTTTGAAGA, and the reverse sequence is / NH2C6 / -NNNNNNNHGGTCTTCAAAAA- / NH2C6 / .

2. The method for preparing an enzymatic target sequence random sgRNA library according to claim 1, characterized in that: The sample DNA is genomic DNA, PCR product or DNA library.

3. The method for preparing an enzymatic target sequence random sgRNA library according to claim 1, characterized in that: In step (2), the two sequences of the linker magnetic beads are annealed at equimolar concentrations, and the magnetic beads are streptavidin magnetic beads.

4. The method for preparing an enzymatic target sequence random sgRNA library according to claim 3, characterized in that: In step (2), T4 DNA ligase or E. coli DNA ligase is used to connect the fragmented DNA to the adapter.

5. The method for preparing an enzymatic target sequence random sgRNA library according to claim 1, characterized in that: The random primer in step (4) is a 6-base random primer, and Klenow DNA polymerase is used for extension.

6. The method for preparing an enzymatic target sequence random sgRNA library according to claim 1, characterized in that: The sgRNA backbone of step (5) is a double-stranded DNA formed by the complementary pairing of two single-stranded DNAs, wherein the forward sequence is / rApp / -NNNCGGTTGGAGCTAGAAATAGCAAGTCAACCTAACGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT- / NH2C6 / ; the reverse sequence is / NH2C6 / -AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCGTTAGGTTGACTTGCTATTTCTAGCTCCAACC- / ddG / .

7. The method for preparing an enzymatic target sequence random sgRNA library according to claim 6, characterized in that: In step (5), T4 DNA ligase is used to connect the sgRNA backbone to the double-stranded DNA.

8. The method for preparing an enzymatic target sequence random sgRNA library according to claim 1, characterized in that: Step (7) uses T4 DNA ligase, the forward sequence of the T7 promoter is / NH2C6 / -TTCTAATACGACTCACTATAGGNN, and the reverse sequence is / ddC / -CTATAGTGAGTCGTATTAGAA- / NH2C6 / .

9. The method for preparing an enzymatic target sequence random sgRNA library according to claim 1, characterized in that: The forward sequence of the primer pair used in the amplification reaction of step (8) is TTCTAATACGACTCACTATAGG, and the reverse sequence is AAAAGCACCGACTCGGTGCC.

10. The method for preparing an enzymatic target sequence random sgRNA library according to claim 1, characterized in that: In step (9), T7 RNA polymerase is used for transcription, and RNA recovery magnetic beads are used to recover the sgRNA library.

Images