PhHMA5I, a heavy metal transporter, its mutants, and their applications

By constructing a PhHMA5I mutant of the heavy metal transporter using gene editing technology, the problem of insufficient research on the mechanism of zinc transport in plants was solved, the tolerance of petunias to zinc was improved, and the plant growth in high zinc environments was promoted.

CN116554289BActive Publication Date: 2026-05-26SHANGHAI JIAOTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI JIAOTONG UNIV
Filing Date
2022-12-26
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Current technologies lack sufficient research on the mechanism of zinc transport in plants, especially on the tolerance of landscape plants to zinc stress, which affects the screening and cultivation of resistant plants.

Method used

The heavy metal transporter PhHMA5I and its mutant were provided. A knockout cassette vector was constructed using gene editing technology and transferred into petunia W115 to form a mutant, which improved the plant's ability to transport and tolerate zinc.

Benefits of technology

Under high zinc stress, the root elongation of the petunia mutant was significantly higher than that of the wild type, showing a significant improvement in zinc tolerance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116554289B_ABST
    Figure CN116554289B_ABST
Patent Text Reader

Abstract

This invention relates to a heavy metal transporter PhHMA5I, its mutants, and its applications. The heavy metal transporter PhHMA5I is a protein as described in (1) or (2): (1) a protein encoded by the heavy metal transporter gene PhHMA5I as shown in SEQ ID No. 1, with an amino acid sequence as shown in SEQ ID No. 2; (2) a protein derived from (1) with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2. Compared with the prior art, the heavy metal transporter PhHMA5I of this invention is constructed using gene editing technology to create a knockout cassette vector and transferred into petunia W115 to form a petunia mutant. Under high zinc stress, the root elongation of this petunia mutant is significantly higher than that of wild-type petunia W115.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a heavy metal transporter PhHMA5I, its mutants, and their applications. Background Technology

[0002] Petunia hybrida is an important model plant for molecular biology research. Studies on its flower color, fragrance, and shape have provided important theoretical guidance and a reserve of candidate genes for improving the ornamental shape of flowers and breeding new hybrids. Furthermore, due to its rich flower colors, diverse flower shapes, abundant blooms, long flowering period, and ease of cultivation, petunia is also one of the most widely used landscaping and roadside greening flowers, earning it the reputation of "King of Flowerbeds" and possessing significant economic value.

[0003] Zinc ions are an essential micronutrient for plant growth, playing a crucial role in many coenzymes and photosynthetic pigments. Zinc deficiency severely hinders plant growth. However, excessive zinc in the plant environment can also inhibit growth and cause significant damage. Zinc is a major source of inorganic pollution in soil, and excessive zinc can accumulate in the human body through the food chain, impacting human health. Therefore, replacing food crops with cash crops such as flowers, cotton, and flax in severely zinc-contaminated soils can effectively and rationally utilize land and create economic value. However, the unclear mechanisms of zinc translocation in plants, especially important flowering plants, significantly hinder the selection and cultivation of resistant plants.

[0004] P 1B ATPase-type heavy metal transporters (HMAs) are important heavy metal detoxification proteins in plants, primarily responsible for the transport of heavy metals such as zinc, cadmium, lead, cobalt, silver, and copper. They utilize the energy generated from ATP hydrolysis to pump the corresponding metal ions out of the cell or into specific organelles, thus achieving transport and detoxification. While the structure of this protein family is highly conserved, their transport substrates and mechanisms of action vary across different species. Furthermore, current research on their functional mechanisms mainly focuses on model plants such as Arabidopsis thaliana and rice, primarily addressing the transport mechanism of cadmium ions; research on zinc stress tolerance in landscaping plants is still limited. Summary of the Invention

[0005] The purpose of this invention is to overcome the defects of the prior art by providing a heavy metal transporter PhHMA5I, its mutants, and its applications.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] One of the technical solutions of the present invention is to provide a heavy metal transporter gene PhHMA5I, the nucleotide sequence of which is shown in SEQ ID No.1.

[0008] The second technical solution of the present invention is to provide a heavy metal transporter protein PhHMA5I, wherein the heavy metal transporter protein PhHMA5I is a protein as follows (1) or (2):

[0009] (1) The protein encoded by the heavy metal transporter gene PhHMA5I as described in one of the technical solutions, the amino acid sequence of which is shown in SEQ ID No.2;

[0010] (2) A protein derived from (1) with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues as shown in SEQ ID No.2.

[0011] The third technical solution of the present invention is to provide a mutant protein of the heavy metal transporter PhHMA5I. The mutant protein is a protein in which the amino acid sequence of the heavy metal transporter PhHMA5I described in the second technical solution is replaced and / or deleted and / or added by one or more amino acid residues, and the function of the heavy metal transporter PhHMA5I is lost.

[0012] Furthermore, the SRIVEA sequence following position 161 of the amino acid sequence shown in SEQ ID No.2 was mutated to AGLLKQ.

[0013] The fourth technical solution of the present invention is to provide a recombinant expression vector, wherein the recombinant expression vector comprises the nucleic acid of the mutant protein of heavy metal protein PhHMA5I as described in technical solution three.

[0014] The fifth technical solution of the present invention is to provide a recombinant expression transformant, comprising the recombinant expression vector as described in the fourth technical solution.

[0015] The sixth technical solution of the present invention is to provide an application of a recombinant expression transformant to promote plant growth under heavy metal stress.

[0016] Furthermore, under heavy metal stress, enhancing the plant's heavy metal transport capacity or tolerance to heavy metals can promote plant growth.

[0017] Furthermore, the heavy metal is zinc.

[0018] Furthermore, the plants include dicotyledonous plants or monocotyledonous plants.

[0019] Furthermore, the dicotyledonous plants are selected from Arabidopsis thaliana, alfalfa, petunia, cotton, and castor bean.

[0020] Furthermore, the recombinant expression transformant was transformed into plants.

[0021] Furthermore, the recombinant expression transformant was transferred into the plant via Agrobacterium-mediated transformation.

[0022] Compared with existing technologies, this invention obtains a heavy metal transporter gene, PhHMA5I, from petunia W115, which has high homology with the rice OsHMA4 gene. A knockout cassette vector was constructed using gene editing technology and transferred into petunia W115 to form a petunia mutant. Under high zinc stress, the root elongation of this petunia mutant was significantly higher than that of wild-type petunia W115. Attached Figure Description

[0023] Figure 1 This is a comparison diagram of the amino acid sequence of PhHMA5I from petunia and the amino acid sequence of OsHMA4 from rice in Example 1 of this invention.

[0024] Figure 2 This is a functional domain diagram of the petunia PhHMA5I protein from Example 1 of the present invention.

[0025] Figure 3 This is a schematic diagram of the target site on the PhHMA5I gene of petunia in Example 2 of the present invention.

[0026] Figure 4 This is a spectrum of the recombinant plasmid from Example 2 of the present invention.

[0027] Figure 5 This is a diagram showing the sequencing results of the target site on the recombinant plasmid in Example 2 of the present invention.

[0028] Figure 6 This is a comparison diagram of partial gene sequences of the petunia mutant and wild-type petunia in Example 3 of the present invention.

[0029] Figure 7 This is a comparison diagram of partial amino acid sequences of the petunia mutant and wild-type petunia in Example 3 of the present invention.

[0030] Figure 8 This is a graph showing the root elongation of petunia mutants and wild-type petunias under high concentrations of zinc, cadmium, lead, and cobalt stress in Example 4 of the present invention. Detailed Implementation

[0031] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this does not limit the invention to the scope of the described embodiments. Experimental methods in the following embodiments that do not specify specific conditions are performed according to conventional methods and conditions, or as selected according to the product instructions. In the following embodiments, unless otherwise specified, the raw materials are all commercially available raw materials commonly used in the art. The reaction or detection conditions described in the invention can be combined or modified based on common knowledge in the art, and can be verified experimentally.

[0032] The materials or formulations in the following embodiments are:

[0033] The petunia variety is W115.

[0034] The strain of Agrobacterium is Agl0.

[0035] The formula for LB solid medium is as follows: 10g tryptone (purchased from oxoid), 5g yeast extract (purchased from oxoid), 10g sodium chloride (purchased from Sinopharm), 10g agar powder (purchased from Shanghai Sangon Biotech), add water to 1000mL, mix well, set pH to natural, and sterilize at 121℃ for 15min before use.

[0036] The formula for LB liquid culture medium is as follows: 10g tryptone (purchased from oxoid), 5g yeast extract (purchased from oxoid), 10g sodium chloride (purchased from Sinopharm), add water to 1000mL, mix well, set pH to natural, and sterilize at 121℃ for 15min before use.

[0037] The MS solid co-culture medium formula is as follows: 5g sucrose, 2.5g glucose, 2g agar, 1.1g MS, 250μL 1mg / mL folic acid, 250μL 2mg / mL 6-benzyladenine, 250μL 0.1mg / mL 1-naphthaleneacetic acid, 250μL 1mg / mL zeatin, 25μL 200mM acetylsylgenone, add water to 250mL, mix, adjust pH to 5.8, sterilize at 115℃ for 30min and use.

[0038] The formula for MS solid selective medium is as follows: 5g sucrose, 2.5g glucose, 2g agar, 1.1g MS, 500μL 1mg / mL zeatin, 250μL 1mg / mL folic acid, 50mg / L kanamycin, 250mg / L carbenicillin, add water to 250mL, mix, adjust pH to 5.8, sterilize at 115℃ for 30min and use.

[0039] The rooting medium formula is as follows: 5g sucrose, 2.5g glucose, 2g agar, 1.1g MS, 250μL 1mg / mL folic acid, 250mg / L carbenicillin, add water to 250mL, mix, adjust pH to 5.8, sterilize at 115℃ for 30min and use.

[0040] Example 1: Cloning of the PhHMA5I gene in petunias

[0041] I. Obtaining Plant Materials

[0042] Petal tissues from petunia W115 were collected for RNA extraction.

[0043] II. Extraction of Total RNA

[0044] Take the petal tissue of the above-mentioned petunia W115, freeze it in liquid nitrogen, grind it in a mortar to obtain powder, then mix it thoroughly with 1.5 mL of RNAiso Plus (Takara) in a centrifuge tube and let it stand at room temperature for 5 min.

[0045] Add 300 μL of chloroform to the centrifuge tubes mentioned above. Invert the tube thoroughly to mix for 30 seconds, then let it stand at room temperature for 5 minutes. Centrifuge at 13200 rpm for 15 minutes, transfer 800 μL of the supernatant to a new centrifuge tube, add 800 μL of isopropanol (from Sinopharm), mix thoroughly, let stand for 10 minutes, centrifuge at 13200 rpm for 10 minutes, and discard the supernatant. Add 1.5 mL of 70% ethanol, vortex for 30 minutes, centrifuge at 13200 rpm for 10 minutes, discard the supernatant, centrifuge for 2 minutes, and remove all ethanol. Add 20 μL–50 μL of RNase-free ddH2O, vortex at room temperature for 30 minutes to obtain total plant RNA.

[0046] The concentration of extracted RNA, OD, was detected using a NanoDrop micro-spectrophotometer. 260 / OD 280 RNA with a ratio between 1.90 and 2.10 was used for subsequent experiments.

[0047] III. Obtaining cDNA

[0048] Using 2 μg of the total RNA obtained above as a template, cDNA was synthesized by reverse transcription using the Novizan HiScript II 1st Strand cDNASynthesis Kit (+gDNA wiper), following the instructions in the kit manual.

[0049] IV. Obtaining the full-length PhHMA5I gene

[0050] Using the cDNA obtained above as a template, the PhHMA5I gene was amplified in its full length using primers F as shown in SEQ ID NO.3 and R as shown in SEQ ID NO.4, according to the PrimeSTAR Max DNA Polymerase (Takara) kit system. The PhHMA5I gene with a length of 2958 bp was obtained, and its sequence is shown in SEQ ID NO.1. The PhHMA5I protein with a total of 985 amino acids was deduced from the open reading frame sequence, and its sequence is shown in SEQ ID NO.2.

[0051] The above PCR amplification procedure is as follows: on the PCR instrument, pre-denature at 98℃ for 1 min, denature at 98℃ for 30 s, anneal at 58℃ for 30 s, extend at 72℃ for 2 min, for 32 cycles; finally extend at 72℃ for 7 min, and store at 4℃.

[0052] SEQ ID NO.1 (PhHMA5I gene fragment):

[0053]

[0054] SEQ ID NO.2 (Amino acid sequence of PhHMA5I protein):

[0055]

[0056] SEQ ID NO.3 (Amplification primer F for the PhHMA5I gene):

[0057] ATGGAAGCTAACGGGAAGGAC.

[0058] SEQ ID NO.4 (Amplification primer R for PhHMA5I gene):

[0059] TTAATTGACTCGAGTATGCAGAG.

[0060] V. Sequence information analysis of PhHMA5I protein in petunia strain W115

[0061] The sequences were compared with existing databases (Genbank) using BLASTP (http: / / blast.ncbi.nlm.nih.gov / ) on the NCBI website. The comparison results are available in [link to comparison]. Figure 1 The amino acid sequence of petunia PhHMA5I is 70% identical to that of rice OsHMA4.

[0062] The functional structural region analysis of the amino acid sequence of PhHMA5I protein was performed according to the description in reference 1 (Yanbang Li, Mazhar Iqbal, Qianqian Zhang, Cornelis Spelt, Mattijs Bliek, Henk WJHakvoort, Francesca M, Quattrocchio, Ronald Koes, HenkSchat. Two Silene vulgaris copper transporters residing in different cellular compartments confer copper hypertolerance by distinct mechanisms when expressed in Arabidopsis thaliana. New Phytologist, 215(3):1102-1114(2017)). The results are shown in […]. Figure 2 The PhHMA5I protein has a molecular weight of 106.12 kDa. It contains two metal ion binding sites, one ATP binding site, and eight transmembrane domains, and its structure is conserved.

[0063] Example 2: Construction and transformation of pYLCRISPR / Cas9 plasmids

[0064] Two gene editing target sites were selected from the PhHMA5I gene obtained in Example 1, ligated into the pYLCRISPR / Cas9 plant expression vector, and transformed into Agrobacterium. These included the following:

[0065] I. Obtaining Recombinant Plasmids

[0066] The full-length PhHMA5I gene sequence was input into the online software CRISPR-GE and CRISPR-P 2.0. Two target sequences for PhHMA5I gene knockout were selected, and corresponding primers for ligating the pYLCRISPR / Cas9 recombinant plasmid were designed using the CRISPR-GE online software. The enzyme digestion and ligation conditions for pYLCRISPR / Cas9 described in Reference 2 (Ma, X. et al. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and DicotPlants. Mol. Plant 8, 1274–1284 (2015)) were followed.

[0067] like Figure 3 As shown, target site 1 is located in the coding region from +467 bp to +486 bp and is expressed by the AtU3b promoter. The sequence used to construct the vector is shown in SEQ ID NO.5 and SEQ ID NO.6.

[0068] SEQ ID NO.5 (target site 1 positive strand): gtcaCAACTGTTACCAGTACCAGC;

[0069] SEQ ID NO.6 (target site 1 negative chain): aaacGCTGGTACTGGTAACAGTTG;

[0070] In this context, the lowercase letters gtca and aaac represent the connectors that connect to the carrier.

[0071] like Figure 3 As shown, target site 2 is located in the coding region from +203 bp to +221 bp and is expressed by the AtU6-1 promoter. The sequence used to construct the vector is shown in SEQ ID NO.7 and SEQ ID NO.8.

[0072] SEQ ID NO.7 (target site 2 positive strand): attgCGGTGTCCCCACTTCAAGG;

[0073] SEQ ID NO.8 (target site 2 negative chain): aaacCCTTGAAGTGGGGACACCG;

[0074] In this context, the lowercase letters attg and aaac represent the connectors that connect to the carrier.

[0075] The expression cassettes for target site 1 (i.e., the positive and negative strands of target site 1) and target site 2 (i.e., the positive and negative strands of target site 2) were sequentially ligated into the pYLCRISPR / Cas9 vector to obtain the pYLCRISPR / Cas9 recombinant plasmid, as shown in the diagram. Figure 4 As shown in the figure. Recombinant plasmids with correct sequences were obtained by sequencing the target site at Suzhou Genewiz Company. The sequencing results are shown in the figure. Figure 5 As shown.

[0076] II. pYLCRISPR / Cas9 recombinant plasmid was transformed into Agrobacterium strain Agl0.

[0077] Take 2 μL of pYLCRISPR / Cas9 recombinant plasmid and carefully mix it with 50 μL of Agrobacterium strain Agl0. Then, perform electroporation at 1500V using an eppendorf apparatus to obtain the transformed bacteria.

[0078] Spread 30 μL of the transformed bacterial culture onto LB solid medium containing 150 μg / mL kanamycine and incubate at 30°C for 48 h.

[0079] Single colonies were picked for colony PCR, and positive monoclonal colonies were preserved in glycerol and stored at -80°C.

[0080] Example 3: Transformation of pYLCRISPR / Cas9 recombinant plasmid into petunia

[0081] The positive monoclonal colonies obtained in Example 2 were used to infect petunia W115 leaves and cultured to obtain gene-edited petunias, including the following:

[0082] I. Pre-shaking Agrobacterium

[0083] Pipette 50 μL of positive monoclonal bacterial culture into 10 mL of LB liquid medium and incubate at 30°C and 200 rpm for 12–16 h; incubate until the absorbance OD reaches a certain level. 600 =0.8~1.2, to obtain pre-shaken Agrobacterium. Add water to the pre-shaken Agrobacterium to 35mL and add 3.5μL of 200mM acetylsyl syringone, mix well, and obtain bacterial solution.

[0084] II. Leaf disinfection

[0085] Take green, non-yellowed leaves from petunia W115, disinfect them with 70% alcohol for 15 seconds, then with 0.4% sodium hypochlorite for 10 minutes, and soak them in sterile water for 2 minutes. Repeat this process 5 times. Then, cut the leaves into 1cm pieces with a blade.2 Small pieces.

[0086] III. Transformed Plants

[0087] Prepare 35 mL of an aqueous solution containing acetylsuccinone, wherein the aqueous solution contains 3.5 μL of 200 mM acetylsuccinone. Resuspend the pre-shaken Agrobacterium in the aqueous solution containing acetylsuccinone.

[0088] Soak small pieces of leaf in the aforementioned resuspended pre-shaken Agrobacterium solution for 15 minutes.

[0089] IV. Joint Training

[0090] Leaves soaked in bacterial solution were placed on MS solid co-culture medium and cultured in the dark in an artificial climate chamber for 48 hours.

[0091] V. Induction of callus and seedlings

[0092] The co-cultured leaves were transferred to MS solid selective medium, and the leaves were transferred to new MS solid medium every 2-3 weeks.

[0093] VI. Rooting

[0094] After the callus transforms into a bud that grows into a long stem, the stem is cut off and transferred to a rooting culture medium. Once the plant has grown roots, it is transferred to soil and cultured to obtain the transformed plant.

[0095] VII. Identification of Gene-Edited Lines

[0096] DNA was extracted from the transformed plants, and positive gene-edited plants were obtained by screening with primers showing the sequences shown in SEQ ID NO. 9 and SEQ ID NO. 10.

[0097] SEQ ID NO.9 (screening primer F): ATGTTGACCGGTAAGGCGCG;

[0098] SEQ ID NO.10 (screening primer R): AAACCGGTGTCCCCACTTCAAGG.

[0099] Then, using the DNA from the screened positive plants as templates, primers with sequences shown in SEQ ID NO. 11 and SEQ ID NO. 12 were used to amplify the region containing target site 1 by PCR; primers with sequences shown in SEQ ID NO. 13 and SEQ ID NO. 14 were used to amplify the region containing target site 2 by PCR. The PCR amplification system was performed according to the SanTaqPlus PCR Master Mix (with Blue Dye) kit. The PCR reaction program was: 98℃ pre-denaturation for 60 s, followed by 32 cycles: 98℃ denaturation for 30 s; 58℃ annealing for 30 s; 72℃ extension for 90 s, followed by 72℃ extension for 7 min.

[0100] SEQ ID NO.11 (Target site 1 amplification primer F): ATGGAAGCTAACGGGAAGGAC;

[0101] SEQ ID NO.12 (Target site 1 amplification primer R): TCTTGCTCTGGGAACTCATC;

[0102] SEQ ID NO.13 (Target Site 2 Amplification Primer F): AAGAAGCTGTCGAAGACACTG;

[0103] SEQ ID NO.14 (Target site 2 amplification primer R): GCACAGGTGTGCAGAGGATCC.

[0104] The PCR amplification products of the target site 1 region were sequenced using sequencing primers with the sequence shown in SEQ ID NO.15, and the PCR amplification products of the target site 2 region were sequenced using sequencing primers with the sequence shown in SEQ ID NO.16 to identify the mutation sites in transgenic petunias.

[0105] SEQ ID NO.15 (Sequencing primers for target site 1): CAGAGCAAGACATTGCTATCTG;

[0106] SEQ ID NO.16 (Sequencing primers for target site 2): AGTATGCTATAGGACTGTAGAG.

[0107] Figure 6 This is a comparison of partial gene sequences from gene-edited petunias and wild-type petunias in this embodiment. In the figure, - represents the deletion of a C base. From... Figure 7 It was found that the deletion of the C base resulted in a frameshift mutation from SRIVEA to AGLLKQ in the PhHMA5I protein after position 161, subsequently terminating translation prematurely. This indicates that gene-edited petunias have been successfully obtained.

[0108] Example 4: Detection of heavy metal stress tolerance in gene-edited petunias and wild-type petunias

[0109] The gene-edited petunias obtained in Example 3 were self-pollinated, and the seeds after self-pollination were tested for their tolerance to high concentrations of zinc, cadmium, lead, and cobalt stress, including the following:

[0110] Wild-type petunia W115 seeds (denoted as W115) and gene-edited petunia seeds (denoted as phhma5i) were vortexed for 10 min using 0.08% sodium hypochlorite and 70% alcohol, then soaked in sterile water for 1 min, repeated 4 times. After adding sterile water, the seeds were incubated in the dark at 4℃ for 5 days. The sterilized seeds were then sown on 1 / 2 MS medium and grown for 7 days. The seedlings were then transferred to 1 / 2 MS medium containing zinc (450 μM), cadmium (40 μM), lead (300 μM), and cobalt (300 μM) and cultured for 3 days, during which root elongation was recorded. During the growth period, the plants were given 16 h of light, 8 h of darkness, and a temperature of 25℃.

[0111] like Figure 8 As shown, different letters represent significant differences (P>0.05). On standard 1 / 2 MS medium, there was no significant difference in root elongation between the W115 wild-type and the phhma5i mutant. After 3 days of growth on 1 / 2 MS medium containing high zinc concentration, the root elongation of the W115 wild-type petunia decreased from 1.50 cm to 1.07 cm, a significant difference, indicating that petunia growth was inhibited. On 1 / 2 MS medium containing high zinc concentration, although the root elongation of the phhma5i mutant increased from 1.71 cm to 1.54 cm, the difference was not significant according to significance analysis. On medium containing high zinc concentration, the elongation of the phhma5i mutant was significantly higher than that of the W115 wild-type. After 3 days of cultivation on 1 / 2 MS medium containing high concentrations of cadmium, lead, and cobalt, there was also no significant difference in root elongation between the W115 wild-type and the phhma5i mutant.

[0112] In summary, the PhHMA5I gene specifically participates in the transport of zinc, but not in the transport of cadmium, lead, or cobalt. Mutating PhHMA5I to the point of loss of function significantly improved zinc tolerance in gene-edited petunias.

[0113] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. A recombinant expression vector for targeting the gene encoding the heavy metal transporter PhHMA5I, characterized in that, The recombinant expression vector is a pYLCRISPR / Cas9 vector comprising an expression cassette targeting target site 1 of the PhHMA5I gene encoding heavy metal transporter and an expression cassette targeting target site 2 of the PhHMA5I gene encoding heavy metal transporter. The nucleotide sequence of the gene encoding the heavy metal transporter PhHMA5I is shown in SEQ ID NO.

1. The target site 1 is located at +467 bp to +486 bp in the PhHMA5I coding gene. The target site 2 is located at +203 bp to +221 bp in the PhHMA5I coding gene. The expression cassette for the PhHMA5I gene encoding the heavy metal transporter includes the AtU3b promoter, the positive strand of target site 1, and the negative strand of target site 1. The nucleotide sequences of the positive strand and the negative strand of target site 1 are shown in SEQ ID NO.5 and 6, respectively; The expression cassette targeting the heavy metal transporter PhHMA5I gene at target site 2 includes the AtU6-1 promoter, the positive strand of target site 2, and the negative strand of target site 2. The nucleotide sequences of the positive strand and negative strand of target site 2 are shown in SEQ ID NO.7 and 8, respectively.

2. A recombinant expression transformant, characterized in that, It includes the recombinant expression vector as described in claim 1, wherein the recombinant expression transformant is Agrobacterium.

3. The application of the recombinant expression transformant as described in claim 2, characterized in that, Under zinc stress, increasing the zinc transport capacity or tolerance of petunias promotes root elongation.