A drug for treating aging-related cognitive dysfunction

Abstract

This invention provides a pharmaceutical composition for treating age-related cognitive impairment in subjects and its use therein, the pharmaceutical composition comprising an antisense oligonucleotide as shown in SEQ ID NO:2. The pharmaceutical composition of this invention is administered via in situ injection, reducing and avoiding the effects of the antisense oligonucleotide on other organs.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a drug for treating aging-related cognitive dysfunction, wherein the drug is designed based on an antisense oligonucleotide strategy. Background Art

[0002] Antisense oligonucleotide (ASO) is a single-stranded nucleic acid polymer, which is a type of small molecule nucleic acid drug. It can inhibit the expression of target genes by specifically binding to target RNA and mediating its degradation. Therefore, ASO provides a direct therapeutic strategy for regulating gene expression (Wurster, CD, and Ludolph, AC (2018). Antisense oligonucleotides in neurological disorders. Ther Adv Neurol Disord 11, 1756286418776932.10.1177 / 1756286418776932).

[0003] ASO has achieved some success in the treatment of neurological diseases. In September 2016, the US FDA approved Eteplirsen, an ASO drug for the treatment of Duchenne Muscular Dystrophy (DMD). In December of the same year, the FDA approved Nusinersen, an ASO drug for the treatment of spinal muscular atrophy (SMA). And Tofersen, an ASO drug for the treatment of amyotrophic lateral sclerosis (ALS), which was just approved by the FDA in April 2023. The diseases listed above are all hereditary neurological diseases, and ASOs are used to eliminate incorrectly encoded products in a targeted manner to achieve therapeutic effects.

[0004] The issues that deserve attention in the field of ASO therapy are, first, there is technically no ASO sequence that targets the transfer RNA fragment; second, there is no strategy or means based on ASO to treat aging-related cognitive dysfunction. Summary of the invention

[0005] The present invention is based on the ASO strategy to clear abnormally accumulated transfer RNA fragments in the aging brain and achieve the purpose of treating aging-related cognitive dysfunction.

[0006] Normal brain aging is accompanied by cognitive impairment, but there is no effective prevention or treatment for aging-related cognitive impairment. Our previous research found that a large number of transfer RNA fragments are produced during brain aging, among which glutamate transfer RNA fragments accumulate most significantly in the aging brain. We found that these transfer RNA fragments can damage cognitive functions such as learning and memory by damaging the structure and function of mitochondria.

[0007] Based on the above previous findings, we designed an ASO sequence targeting the transfer RNA fragment of glutamate and evaluated the role of this ASO sequence in the treatment of aging-related cognitive dysfunction. The results showed that the ASO we designed can effectively remove the transfer RNA fragment of glutamate in the aging brain. Further research found that giving the ASO drug to elderly mice can significantly reduce the learning and memory disorders of elderly mice.

[0008] The ASO sequence of the present invention can induce the degradation of the transfer RNA fragment by completely complementary binding with the glutamate transfer RNA fragment sequence, thereby reducing its level. The specific ASO sequence is as follows: 5'GCCGAATCCTAACCACTAGACCACC3' (SEQ ID NO: 1), and the first base at the 5' end of the above ASO sequence is modified with a locked nucleic acid (LNA), that is, a methylene bridge bond is established between the 2' oxygen atom and the 4' carbon atom to lock the sugar ring into a double ring mode. This structure not only makes the nucleotide more stable, but also increases its affinity with the target RNA (Wurster, CD, and Ludolph, AC (2018). Antisense oligonucleotides in neurological disorders. Ther Adv Neurol Disord 11, 1756286418776932.10.1177 / 1756286418776932). The ASO sequence 5'G containing LNA modification L CCGAATCCTAACCACTAGACCACC 3' (SEQ ID NO: 2) (the base with the modification is marked with "L" in the upper right corner) was obtained by total synthesis.

[0009] Specifically, the present invention provides the following technical solutions:

[0010] In one aspect, the present invention provides a pharmaceutical composition for treating aging-related cognitive dysfunction in a subject, characterized in that the pharmaceutical composition comprises an antisense oligonucleotide as shown in SEQ ID NO:2.

[0011] In some embodiments, the pharmaceutical composition may or may not contain a pharmaceutically acceptable carrier.

[0012] In some embodiments, the carrier can be a solvent or dispersion medium selected from water, ethanol, a polyol (eg, glycerol, propylene glycol, and liquid polyethylene glycol, and the like).

[0013] The pharmaceutical composition of the present invention may also include suitable excipients and diluents that are commonly used to prepare pharmaceutical compositions. In addition, the composition of the present invention may be prepared by a general method to be used as an injection. For example, intraventricular injection such as bilateral intraventricular injection may be included.

[0014] In some embodiments, the intraventricular injection is performed with the aid of an injection needle and a syringe pump.

[0015] In some embodiments, the antisense oligonucleotide is dissolved in artificial cerebrospinal fluid.

[0016] In some embodiments, the cerebrospinal fluid comprises 127 mM NaCl, 1.0 mM KCl, 1.2 mM KH2PO4, 26 mM NaHCO3, and 10 mM D-glucose.

[0017] In another aspect, the present invention provides use of an antisense oligonucleotide as shown in SEQ ID NO: 2 in the preparation of a pharmaceutical composition for treating aging-related cognitive dysfunction in a subject.

[0018] In another aspect, the present invention provides a method for treating aging-related cognitive dysfunction in a subject, characterized in that the method comprises administering to the subject an effective amount of an antisense oligonucleotide as shown in SEQ ID NO: 2.

[0019] In some embodiments, the subject is a mammal, including non-human primates, monkeys, cats, dogs, horses, rabbits, rodents (e.g., mice, rats, hamsters and guinea pigs), cows, sheep, goats and humans. Preferably, the subject is a human.

[0020] In some embodiments, more than 90% of the glutamate transport RNA fragments are cleared 4 weeks after administration of the antisense oligonucleotide, e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%.

[0021] In some embodiments, at least 35% of the glutamate transport RNA fragments are cleared 4 weeks after administration of the antisense oligonucleotide.

[0022] In some embodiments, administration of 0.29 mg / kg of antisense nucleotides eliminated 35% of glutamate transport RNA fragments, and administration of 2.86 mg / kg of antisense nucleotides eliminated 90% of glutamate transport RNA fragments.

[0023] In another aspect, the present invention provides a pharmaceutically acceptable salt of the antisense oligonucleotide of the present invention. In some embodiments, the pharmaceutically acceptable salt is selected from the group consisting of sodium salt, potassium salt and ammonium salt.

[0024] In some embodiments, the aging-related cognitive dysfunction includes spatial memory function, episodic memory function, and fear memory function.

[0025] In some embodiments, the antisense oligonucleotide exerts a therapeutic effect by clearing the senescence-associated glutamate transporter RNA fragment.

[0026] In some embodiments, the antisense oligonucleotide is obtained synthetically.

[0027] In some embodiments, the effective amount is at least 0.28 mg / kg, for example, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 0.90, 0.91, 0.92, 0.93 2. 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.9 7, 0.98, 0.99, 1.00, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.10, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.20, 1.21, 1.2 2, 1.23, 1.24, 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.40, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1. 47, 1.48, 1.49, 1.50, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.60, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.70, 1.71, 1. 72, 1.73, 1.74, 1.75, 1.76, 1.77, 1.78, 1.79, 1.80, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.90, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1. 97, 1.98, 1.99, 2.00, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.10, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.20, 2.21, 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.30, 2.31, 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.40, 2.41, 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, 2.50, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2.57, 2.58, 2.59, 2.60, 2.51, 2.52, 2.53, 2.54, 2.55, 2.56, 2 .57, 2.58, 2.59, 2.60, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.70, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.7 9. 2.80, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.90, 2.91, 2.92, 2.93, 2.91, 2.95, 2.96, 2.97, 2.98, 2.99, 3.00mg / kg. .

[0028] definition

[0029] Cognitive impairment: Cognitive impairment refers to abnormalities in brain memory, language, reasoning, calculation, emotion, attention, orientation, and execution, which cause learning and memory disorders, including forgetfulness, memory loss, and memory errors. Cognitive impairment can be divided into mild cognitive impairment and severe cognitive impairment, i.e. dementia.

[0030] Transfer RNA fragment: Mature transfer RNA (tRNA) is cleaved by enzymes to produce a small non-coding RNA molecule, which is mostly produced under stress conditions. It can participate in regulating gene expression at the transcription and translation levels.

[0031] Locked Nucleic Acid (LNA modification): A methylene bridge is established between the 2' oxygen atom and the 4' carbon atom to lock the sugar ring into a double ring pattern. This structure not only makes the nucleotide more stable, but also increases its affinity with the target RNA.

[0032] In situ injection: Use a stereotaxic apparatus to locate the bilateral lateral ventricles of the mouse, and use an injection needle and a syringe pump to inject ASO into the bilateral lateral ventricles.

[0033] Age-related cognitive dysfunction: During the aging process of the brain, cognitive function will progressively decline with age, manifested as slower thinking speed, easy forgetfulness, and inability to maintain long-term attention.

[0034] C57BL / 6J aged mice: This is a commonly used type of aged mice. Mice are generally divided into three stages: adult mice, middle-aged mice, and aged mice. 3-6 months old are adult mice, 10-14 months old are middle-aged mice, and 18-24 months old are aged mice, which correspond to 20-30 years old, 38-47 years old, and 56-69 years old humans, respectively. C57BL / 6J aged mice have the following characteristics: (1) increased weight, decreased neuromuscular strength and pain sensitivity, and motor dysfunction; (2) decreased autonomic activity and changes in anxiety behavior; (3) decreased social activity; (4) decreased acoustic startle response and increased prepulse inhibition; (5) decreased feedback from forced swimming stimulation; (6) impaired spatial learning and memory; and (7) decreased fear memory.

[0035] Beneficial Effects

[0036] The present invention fills the gap in the treatment of cognitive functions such as learning and memory related to aging, and the scheme is effective in treating learning and memory dysfunction related to aging. The in situ injection scheme is used to reduce and avoid the impact of ASO on other organs. The treatment scheme has no obvious toxic side effects on mice, and the mice injected with ASO have no obvious appearance and behavioral abnormalities. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The injected area is shown. The black LV marks the lateral ventricle, which is also the injected brain area.

[0038] Figure 2 The results of the comparison of the inhibitory effects of different doses of ASO on the glutamate transporter RNA fragment are shown. The statistical analysis used the t-test method, *P<0.05; **P<0.01; ***P<0.001; n=5.

[0039] Figure 3 The results of the spatial memory evaluation of mice are shown. A shows the time it takes for aged mice injected with ASO and control sequences to find the hidden platform during the training phase; B shows the frequency of aged mice injected with ASO and control sequences crossing the location of the platform during the test phase. Statistical analysis used the t-test method, **P<0.01; the number of animals in each group n=15.

[0040] Figure 4 The results of the contextual memory evaluation of mice are shown. The time spent exploring the same object and different objects by aged mice injected with ASO and control sequences, respectively. Statistical analysis was performed using the t-test method, **P<0.01; the number of animals in each group was n=15.

[0041] Figure 5The results of the fear memory evaluation of mice are shown. The immobility / freezing time of aged mice injected with ASO and control sequences during the sound stimulation period, the trace period after stimulation, and the test interval period. Statistical analysis used the t-test method, **P<0.01; the number of animals in each group was n=15.

[0042] Figure 6 The location of mouse Bregma is shown.

[0043] Figure 7 A diagram of a single base structure is shown. The molecule on the left is an unmodified structure, and the molecule on the right has a bridge (in red) added between the oxygen atom at position 2 and the carbon atom at position 4, which can make the molecule more stable and less prone to degradation. DETAILED DESCRIPTION

[0044] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings.

[0045] Example 1 ASO preparation

[0046] 5' end with LNA modified sequence 5'G L CCGAATCCTAACCACTAGACCACC 3' (SEQ ID NO: 2) was obtained by total synthesis commissioned by Nanjing GenScript Co., Ltd. aCSF (artificial cerebrospinal fluid) was prepared by itself, and the components were 127mM NaCl, 1.0mM KCl, 1.2mM KH2PO4, 26mM NaHCO3 and 10mM D-glucose. ASO was dissolved in aCSF to prepare a solution with a concentration of 20nM.

[0047] Example 2 ASO injection

[0048] 22-month-old mice (C57B / 6J, purchased from Vital River, code 213) were selected as the aging model mice. The bilateral lateral ventricles of mice are the ventricles closest to cognitive brain areas such as learning and memory, so ASO injection was performed in the bilateral lateral ventricles.

[0049] First, fix the mouse: first clamp the mouse incisors on the incisor clamp of the adapter, gently press the crossbar of the incisor clamp, adjust the height and front and back of the adapter so that the ear rod can easily enter the mouse's external auditory canal, and adjust the position of the incisor rod of the locator to be 3.3±0.4 below the horizontal line, that is, to reach the skull level. Hold up the mouse's head with your left hand, insert the left ear rod into the mouse's ear canal, adjust the left and right ear rods to keep the animal's head in the center of the U-shaped opening, first lock and fix one ear rod, then tighten the other ear rod to prevent the animal's head from shaking, and tighten the incisor clamp screws at the same time.

[0050] After shaving the mouse's head, disinfect it with iodine, cut the scalp, and find the bregma (see Figure 6 ). A dental drill was used to make a hole and then perform brain injection.

[0051] Bilateral intracerebroventricular injection was performed using a mouse brain localizer and the following coordinates: AP (Y axis) -0.2, ML (X axis) 1.1, DV (Z axis) -2.2 and AP (Y axis) -0.2, ML (X axis) -1.1, DV (Z axis) -2.2 ( Figure 1 ), slowly inject ASO solution into bilateral cerebral ventricles by pressure injection pump, the injection doses are 10μg, 50μg and 100μg respectively (the average weight of aged mice is about 35g, so the injection volume is 0.29mg / kg, 1.43mg / kg, and 2.86mg / kg respectively), and the injection speed is controlled at 0.1-0.15μL / min. After the injection, leave the needle in place for 10 minutes and then slowly withdraw the needle.

[0052] After localized injection, the scalp was sutured and a small amount of erythromycin ointment was applied to the suture to prevent infection, and the brain injection was completed. The knockdown effect of the glutamate transporter RNA fragment was detected in mice 4 weeks after injection.

[0053] Example 3 ASO clearance function detection

[0054] Four weeks after ASO injection into the bilateral lateral ventricles, the level of glutamate transporter RNA fragments in the prefrontal cortex of mice was detected by fluorescent quantitative PCR. The details are as follows:

[0055] (1) The mouse prefrontal cortex tissue was isolated and placed in an RNase-free centrifuge tube. Trizol reagent was added and the mixture was fully ground using a grinding rod and allowed to stand at room temperature for 5 minutes.

[0056] (2) Add chloroform to the above lysate, shake vigorously for 30 seconds, let stand for 10 minutes, and then centrifuge at 12,000g at 4°C for 15 minutes;

[0057] (3) Transfer the top aqueous phase to a new enzyme-free centrifuge tube, add isopropanol and mix well, let stand at 4°C for 15 minutes, and then centrifuge at 12,000 g for 15 minutes to obtain total RNA precipitate;

[0058] (4) Wash the precipitate with 75% precooled ethanol, centrifuge at 12,000 g for 15 min at 4°C, and repeat the washing process.

[0059] (5) After the RNA precipitate is dried, it is dissolved in DEPC-treated enzyme-free water. TMPAGE Recovery Kit (Zymo Research) was used to select RNAs with a size range of 20-50 nt, and tRF&tiRNA Pretreatment Kit (Arraystar) was used to remove RNA methylation modifications;

[0060] (6) The 3′ end of the obtained RNA was poly A-tailed using poly A polymerase (NEB), and reverse transcribed using reverse transcriptase (NoviZan) to obtain cDNA (Table 2);

[0061] (7) The PCR amplification reaction system was configured according to Table 2, and the forward (SEQ ID NO: 4, TCCCTGGTGGTCTAGTGGTTAGG) and reverse (SEQ ID NO: 5, CCAGTCTCAGGGTCCGAGGTATTC) primers were used to detect the glutamate transfer RNA fragment, and PCR amplification was performed using Roche's LightCycler 96. The reaction amplification conditions were pre-denaturation at 95°C for 10 minutes, denaturation at 95°C for 5 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 35 seconds, for a total of 40 cycles; and finally reaction at 72°C for 10 minutes;

[0062] (8) The relative levels of glutamate transporter RNA fragments were determined by 2 -ΔΔCt The method was calculated as follows: ΔCt = Ct target gene - Ct internal reference gene, ΔΔCt = ΔCt ASO - ΔCt control group, relative abundance = 2 - ΔΔCt.

[0063] Table 1 Reverse transcription reaction system

[0064] Purpose Reagents Dosage poly A tailing RNA 1 μg <![CDATA[25mM MnCl2]]> 1μL 5mM ATP 1.5μL 5×poly A buffer 2μL poly A polymerase 0.5μL <![CDATA[ddH2O]]> Total volume 10 μL Incubate at 37°C for 30 minutes Synthesize cDNA Oligo(dT)(50μM) 0.5μL Heat at 60℃ for 5 minutes and cool to room temperature within 2 minutes 5× Reverse Transcription Buffer 4μL dNTP mix 2μL 0.1M DTT 1.5μL Reverse transcriptase 1μL <![CDATA[ddH2O]]> Total volume 20 μL Incubate at 42°C for 60 minutes and heat at 95°C for 10 minutes to inactivate the enzyme.

[0065] Table 2 Fluorescence quantitative PCR reaction system

[0066]

[0067]

[0068] Compared with injection of the same amount of control sequence (SEQ ID NO:3, CCTAAGGTTAAGTCGCCCTCGCTCG), injection of 100 μg of ASO can eliminate more than 90% (0.94±0.11; t-test p<0.0001) of glutamate transfer RNA fragments, while injection of 50 μg of ASO eliminates 56% (0.56±0.12; t-test p=0.0013) of transfer RNA fragments, and injection of 10 μg of ASO eliminates 35% (0.35±0.12, t-test p=0.0172) of transfer RNA fragments.

[0069] Therefore, 100 μg of ASO was injected as the therapeutic dose for aged mice ( Figure 2 ).

[0070] Example 4 Behavioral evaluation after ASO injection

[0071] (1) Using the water maze test to evaluate the spatial memory ability of mice

[0072] A circular pool with a diameter of 100 cm was filled with 30 cm deep water, which was mixed with titanium dioxide to make the water opaque to reduce visual interference. The water temperature was maintained at 21-22 degrees Celsius. The pool was artificially divided into four quadrants, northeast (NE), northwest (NW), southwest (SW) and southeast (SE). A 10×10 cm platform was placed 2 cm below the water surface in the SW quadrant.

[0073] 1.1 Positioning navigation experiment / hidden platform experiment

[0074] From the 1st to the 5th day, the mice were trained to find the platform. Every day, the mice were placed in the pool from four different directions facing the pool wall (Table 3), and the mice were allowed to freely search for the platform in the pool. If the mouse found the platform within 60 seconds, the time (latency) required from the animal being placed in the pool to finding the platform was recorded, and the mouse was allowed to stay in the platform area for 30 seconds before the experiment at the next location was carried out. If the mouse could not find the platform by itself within 60 seconds, the time to find the platform was recorded as 60 seconds, and the mouse was guided to the platform area and stayed for 30 seconds before the experiment at the next location was carried out. The mice were placed in the pool for experiments in turn according to the time and direction shown in the table. The learning and memory curve of the mice was drawn according to the time to find the platform. During the training phase, each mouse received 5 consecutive days of training.

[0075] Table 3 Starting position information of mice during the water maze experiment training phase

[0076]

[0077]

[0078] 1.2 Space Exploration Experiment

[0079] The purpose of this experiment is to detect the spatial memory ability of the subjects. On the 6th day of the experiment, the platform in the pool was removed and the mice were allowed to swim freely in the pool. Each mouse was placed in the pool from the SW direction of the pool (opposite to the location of the platform) facing the pool wall, and each mouse was given 90 seconds to freely find the location of the platform. The swimming trajectory of the mice was recorded by a camera above the pool, and Ethovision XT 11 software (Noldus) was used to analyze the time when the mice first arrived at the platform area, the time they stayed in the platform area and each quadrant, the frequency of crossing the platform area and the total distance they swam. The more times a mouse crosses, the better its spatial memory ability.

[0080] (2) Using object recognition experiments to evaluate the episodic memory function of mice

[0081] The place for novel object recognition was an open box with a length, width and height of 45×45×40 cm.

[0082] On the first day (day 1), the exploration box was sprayed with 70% ethanol, and the mice were placed in the box one by one, and allowed to explore freely for 10 minutes to familiarize themselves with the environment. On the second day of the experiment (day 2), two identical objects (A1, A2) were placed in the box, and the mice were placed in the box one by one, and allowed to explore freely for 10 minutes. After each mouse test, the exploration box and the objects inside were sprayed with 70% ethanol to remove the smell that the previous mouse may have left. The activity trajectory of the mouse was recorded by a camera, including the residence time on objects A1 and A2 respectively. On the third day of the experiment (day 3), object A2 was replaced with object B (new object) of different shape and color, and then the mice were placed in the box one by one, and allowed to explore freely for 10 minutes. After each mouse test, the exploration box and the objects inside were sprayed with 70% ethanol to remove the smell that the previous mouse may have left. The activity trajectory of the mouse was recorded by a camera, including the residence time on objects A1 and B respectively. Using analysis software, the exploration time of each mouse on objects A1 and A2 on the second day and on objects A1 and B on the third day were plotted. The longer the mouse stayed on the new object, the better its contextual memory function.

[0083] (3) Evaluating fear memory in mice using fear experiments

[0084] The fear memory of mice was completed in a fear memory box (Shanghai Xinruan). On the first day (day 1), mice were placed in the fear memory box one by one and allowed to explore freely for 3 minutes. Then each mouse was given a 20-second sound (2700 Hz, 85 dB) as a conditioned stimulus. After 20 seconds, a 2-second electric shock (0.5 mA) was given to the mouse's paw as an unconditioned stimulus. The above stimulation was repeated 5 times, with an interval of 200 seconds each time.

[0085] On the second day of the experiment (day 2), the fear memory of mice was evaluated. Each mouse was given a 2-minute adaptation time (baseline), and then given three sound stimulations, each lasting 20 seconds, with an interval of 220 seconds between two. At the same time, the immobility / stagnation time of the mice was recorded. The freezing behavior of the mice was analyzed using SuperFcs XR software. The longer the immobility / stagnation time of the mice, the better their fear memory ability.

[0086] Example 5 Behavioral evaluation results after ASO injection

[0087] The following behavioral analyses were performed on mice injected with equal amounts (100 μg) of the control sequence (SEQ ID NO: 3, CCTAAGGTTAAGTCGCCCTCGCTCG) and the ASO sequence (100 μg): Morris water maze to evaluate the spatial memory function of mice ( Figure 3 ), novel object recognition to evaluate the episodic memory function of mice ( Figure 4 ) and situational fear test to evaluate the fear memory of mice ( Figure 5 ).

[0088] We found that in the Morris water maze test, on the last day of the training phase, the average time required for ASO-injected aged mice to find the location of the hidden platform was about 24.5 seconds, while the average time required for control-injected mice to find the location of the hidden platform was 39.5 seconds, indicating that ASO-injected mice found the location of the hidden platform faster than control-injected mice (-14.93±0.94; t-test P<0.0001) ( Figure 3 A); In the test phase, the average number of times the ASO-injected aged mice crossed the platform was 2.3, while the average number of times the control-injected mice crossed the platform was 1.2, indicating that the ASO-injected mice crossed the platform more frequently than the control-injected mice (1.13±0.36; t-test P=0.0017) ( Figure 3 B) These results indicate that ASO can significantly improve the spatial memory function of aged mice.

[0089] In the novel object recognition test, the average time that the ASO-injected aged mice stayed at the novel object was about 45.5 seconds, while the average time that the control-injected mice stayed at the novel object was about 40.1 seconds. Therefore, the time that the ASO-injected aged mice stayed at the novel object was significantly longer than that of the control-injected mice (5.4±0.61; t-test p=0.0015) ( Figure 4 ), indicating that ASO can significantly improve the episodic memory function of aged mice.

[0090] In the fear test, the average freezing time of the aged mice injected with ASO and control sequence during the sound stimulation period was 42.2 seconds and 29.4 seconds, the average freezing time during the trace period after stimulation was 47 seconds and 31.1 seconds, and the average freezing time during the test interval was 39.8 seconds and 31.5 seconds, respectively. Therefore, the immobility time / freezing state of the mice injected with ASO was significantly increased during the sound stimulation period (12.8±1.24; t-test p=0.0021), the trace period after stimulation (15.9±1.29; t-test p=0.0018), and the test interval (8.3±1.09; t-test p=0.0043). Figure 5 ), indicating that ASO can significantly improve the fear memory function of aged mice.

[0091] In summary, old mice treated with ASO showed significant recovery in spatial memory, episodic memory, and fear memory, supporting the idea that this ASO sequence can treat aging-related learning and memory disorders.

[0092] sequence

[0093] SEQ ID NO: 1ASO sequence

[0094] 5'GCCGAATCCTAACCACTAGACCACC 3'

[0095] SEQ ID NO:2 modified ASO sequence

[0096] 5'G L CCGAATCCTAACCACTAGACCACC 3'

[0097] SEQ ID NO: 3 Control sequence

[0098] CCTAAGGTTAAGTCGCCCTCGCTCG

[0099] SEQ ID NO:4 forward primer

[0100] TCCCTGGTGGTCTAGTGGTTAGG

[0101] SEQ ID NO:5 Reverse primer

[0102] CCAGTCTCAGGGTCCGAGGTATTC

[0103] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A pharmaceutical composition for treating aging-related cognitive dysfunction in a subject, characterized in that: The pharmaceutical composition comprises the antisense oligonucleotide as shown in SEQ ID NO: 2, and the aging-related cognitive dysfunction comprises spatial memory function, situational memory function and fear memory function.

2. Use of the antisense oligonucleotide as shown in SEQ ID NO: 2 in the preparation of a pharmaceutical composition for treating aging-related cognitive dysfunction in a subject, wherein the aging-related cognitive dysfunction includes spatial memory function, episodic memory function and fear memory function.

3. The pharmaceutical composition according to claim 1, characterized in that The antisense oligonucleotides are dissolved in artificial cerebrospinal fluid.

4. The use according to claim 2, characterized in that: The antisense oligonucleotides are dissolved in artificial cerebrospinal fluid.

5. The pharmaceutical composition according to claim 3, characterized in that The cerebrospinal fluid included 127 mM NaCl, 1.0 mM KCl, 1.2 mM KH2PO4, 26 mM NaHCO3 and 10 mM D-glucose.

6. The use according to claim 4, characterized in that The cerebrospinal fluid included 127 mM NaCl, 1.0 mM KCl, 1.2 mM KH2PO4, 26 mM NaHCO3 and 10 mM D-glucose.

7. The pharmaceutical composition according to claim 5, characterized in that The pharmaceutical composition is prepared for administration as an injection.

8. The use according to claim 6, characterized in that The pharmaceutical composition is prepared for administration as an injection.

9. The pharmaceutical composition according to claim 7, characterized in that The injection was intracerebroventricular.

10. The pharmaceutical composition according to claim 9, characterized in that The injection is bilateral intracerebroventricular injection.

11. The use according to claim 8, characterized in that The injection was intracerebroventricular.

12. The use according to claim 11, characterized in that The injection is bilateral intracerebroventricular injection.

13. The pharmaceutical composition according to claim 9, characterized in that The intracerebroventricular injection is performed with the aid of an injection needle and a syringe pump.

14. The use according to claim 11, characterized in that The intracerebroventricular injection is performed with the aid of an injection needle and a syringe pump.

15. The pharmaceutical composition according to any one of claims 1, 3, 5, 7, 9-10, 13, characterized in that At least 35% of the glutamate transporter RNA fragments were cleared 4 weeks after administration of the antisense oligonucleotides.

16. The use according to any one of claims 2, 4, 6, 8, 11-12, 14, characterized in that At least 35% of the glutamate transporter RNA fragments were cleared 4 weeks after administration of the antisense oligonucleotides.

17. The pharmaceutical composition according to any one of claims 1, 3, 5, 7, 9-10, 13, characterized in that The pharmaceutical composition is used in an amount of at least 0.28 mg / kg.

18. The pharmaceutical composition according to claim 17, characterized in that The dosage of the pharmaceutical composition is 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75 , 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 1.0 0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.10, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.20, 1.21, 1.22, 1.23, 1.24, 1.25 5, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.40, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1. 50, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.60, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.70, 1.71, 1.72, 1.73, 1.74, 1. 75, 1.76, 1.77, 1.78, 1.79, 1.80, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.90, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2. 00, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.10, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.20, 2.21, 2.22, 2.23, 2.24, 2.25、2.26、2.27、2.28、2.29、2.30、2.31、2.32、2.33、2.34、2.35、2.36、2.37、2.38、2.39、2.40、2.41、2.42、2.43、2.44、2.45、2.46、2.47、2.48、2.49、2.50、2.51、2.52、2.53、2.54、2.55、2.56、2.57、2.58、2.59、2.60、2.51、2.52、2.53、2.54、2.55、2.56、2.57、 2.58, 2.59, 2.60, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.70, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.80, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.90, 2.91, 2.92, 2.93, 2.91, 2.95, 2.96, 2.97, 2.98, 2.99, or 3.00 mg / kg.

19. The use according to any one of claims 2, 4, 6, 8, 11-12, 14, characterized in that The pharmaceutical composition is used in an amount of at least 0.28 mg / kg.

20. The use according to claim 19, characterized in that The dosage of the pharmaceutical composition is 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, 0.75 , 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, 1.0 0, 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.10, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.20, 1.21, 1.22, 1.23, 1.24, 1.25 5, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, 1.40, 1.41, 1.42, 1.43, 1.44, 1.45, 1.46, 1.47, 1.48, 1.49, 1. 50, 1.51, 1.52, 1.53, 1.54, 1.55, 1.56, 1.57, 1.58, 1.59, 1.60, 1.61, 1.62, 1.63, 1.64, 1.65, 1.66, 1.67, 1.68, 1.69, 1.70, 1.71, 1.72, 1.73, 1.74, 1. 75, 1.76, 1.77, 1.78, 1.79, 1.80, 1.81, 1.82, 1.83, 1.84, 1.85, 1.86, 1.87, 1.88, 1.89, 1.90, 1.91, 1.92, 1.93, 1.94, 1.95, 1.96, 1.97, 1.98, 1.99, 2. 00, 2.01, 2.02, 2.03, 2.04, 2.05, 2.06, 2.07, 2.08, 2.09, 2.10, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.20, 2.21, 2.22, 2.23, 2.24, 2.25、2.26、2.27、2.28、2.29、2.30、2.31、2.32、2.33、2.34、2.35、2.36、2.37、2.38、2.39、2.40、2.41、2.42、2.43、2.44、2.45、2.46、2.47、2.48、2.49、2.50、2.51、2.52、2.53、2.54、2.55、2.56、2.57、2.58、2.59、2.60、2.51、2.52、2.53、2.54、2.55、2.56、2.57、 2.58, 2.59, 2.60, 2.61, 2.62, 2.63, 2.64, 2.65, 2.66, 2.67, 2.68, 2.69, 2.70, 2.71, 2.72, 2.73, 2.74, 2.75, 2.76, 2.77, 2.78, 2.79, 2.80, 2.81, 2.82, 2.83, 2.84, 2.85, 2.86, 2.87, 2.88, 2.89, 2.90, 2.91, 2.92, 2.93, 2.91, 2.95, 2.96, 2.97, 2.98, 2.99, or 3.00 mg / kg.

Images