A plant-derived recombinant IL-37a protein and its preparation method and application

Abstract

The present invention relates to a plant-derived recombinant IL-37a protein and a preparation method and application thereof, and belongs to the field of biomedical technology. In order to solve the problem that the existing expression system cannot achieve high-yield and low-cost production of IL-37a protein, the present invention provides a plant-derived recombinant IL-37a protein and a preparation method and application thereof. The present invention designs an IL-37a mutant monomer recombinant sequence based on the IL-37a protein, and on the basis of the IL-37a mutant monomer recombinant sequence, three protein tags CTB, CPP, TEV and two signal peptides SP 1 and SP 2 Three recombinant IL‑37a protein encoding genes were designed, and plant-derived recombinant IL‑37a protein was produced using plant bioreactor tobacco. 4 mg of total protein could be extracted from 1 gram of tobacco leaves, and the content of the target protein after purification was about 0.2 mg, achieving high-yield and low-cost production of recombinant IL‑37a protein.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to a plant-derived recombinant IL-37a protein and a preparation method and application thereof. Background Art

[0002] Interleukin 37 (IL-37) is a member of the IL-1 cytokine family. There are five different subtypes of IL-37 (ae), of which IL-37b is the largest subtype. The current mechanism of action and functional characteristics of IL-37 are obtained through the study of IL-37b. IL-37a is different from other subtypes and has a potential exon 3-encoded elastase cleavage site. The activity and mechanism of action of IL-37a are still largely unknown.

[0003] In order to better study the role of IL-37a, it is urgent to produce high-quality and low-cost recombinant proteins. At present, the amount of IL-37 produced by E. coli is very small. Although E. coli is one of the most commonly used systems for expressing recombinant proteins, the E. coli expression system has several inherent limitations, including low protein solubility, inclusion body formation, and possible product contamination by endotoxins. Therefore, it is urgent to develop new alternative expression systems to achieve high-yield and low-cost production of IL-37a. Summary of the invention

[0004] In order to solve the problem that the existing expression system cannot achieve high-yield and low-cost production of IL-37a protein, the present invention provides a plant-derived recombinant IL-37a protein and a preparation method and application thereof.

[0005] The technical solution of the present invention:

[0006] A plant-derived recombinant IL-37a protein, wherein the recombinant IL-37a protein is encoded by the recombinant gene IL-37a mu, whose amino acid sequence is shown in SEQ ID NO: 1; or encoded by the recombinant gene CPP-IL-37a mu, whose amino acid sequence is shown in SEQ ID NO: 2; or encoded by the recombinant gene SP 1 -CTB-IL-37a mu, the amino acid sequence of which is shown in SEQ ID NO: 3; or 2 -TEV-IL-37a mu encodes, and its amino acid sequence is shown in SEQ ID NO:4.

[0007] A method for preparing plant-derived recombinant IL-37a protein comprises the following steps:

[0008] Step 1: Double-digest the plasmid containing the recombinant gene and the plasmid containing the plant efficient expression vector, then connect them to construct a recombinant plasmid containing the recombinant gene and the plant efficient expression vector, and transform the obtained recombinant plasmid into competent Escherichia coli;

[0009] Step 2: extracting the recombinant plasmid containing the recombinant gene from the Escherichia coli culture medium and transforming Agrobacterium tumefaciens;

[0010] Step 3: Infect tobacco leaves with the successfully transformed Agrobacterium tumefaciens obtained in step 2 by injection;

[0011] Step 4: extract total plant protein from the infected tobacco leaves, purify and dialyze to obtain recombinant immune protein, and then obtain plant-derived recombinant IL-37a protein.

[0012] Furthermore, the basic structure of the recombinant gene is that between the PacⅠ and NotⅠ double restriction sites, there are IL-37a mutant monomer encoding gene and His tag in sequence; or between the PacⅠ and NotⅠ double restriction sites, there are protein tag, IL-37a mutant monomer encoding gene and His tag in sequence; or between the PacⅠ and NotⅠ double restriction sites, there are signal peptide encoding gene, protein tag, IL-37a mutant monomer encoding gene and His tag in sequence.

[0013] Furthermore, the protein tag is cholera toxin B subunit CTB, cell penetrating peptide CPP or tobacco etch virus TEV; the signal peptide is barley α-amylase signal peptide SP 1 or IL-37b signal peptide SP 2 .

[0014] Furthermore, the plasmid containing the plant high-efficiency expression vector in step 1 is a pJL-TRBO plasmid.

[0015] Furthermore, in step 2, the recombinant plasmid containing the recombinant antigen gene is transformed into Agrobacterium tumefaciens using the freeze-thaw method.

[0016] Further, the injection method described in step 3 is to inject OD 600 A 0.5-0.8% suspension of Agrobacterium tumefaciens was injected into tobacco leaves through the scratch wound on the lower epidermis of the leaves using a 1 mL syringe until the leaves became moist.

[0017] Furthermore, the purification described in step 4 is carried out using nickel column affinity chromatography, and the elution buffer used is PBS solution containing 20mM, 50mM, 80mM, 200mM, 300mM, and 500mM imidazole, pH 7.4.

[0018] Application of plant-derived recombinant IL-37a protein in the preparation of anti-inflammatory drugs.

[0019] Furthermore, the anti-inflammatory drug is a drug for treating psoriasis.

[0020] Beneficial effects of the present invention:

[0021] The present invention designs the IL-37a mutant monomer recombinant sequence based on the IL-37a protein, and combines the IL-37a mutant monomer recombinant sequence with three protein tags, cholera toxin B subunit CTB, cell penetrating peptide CPP, tobacco etch virus TEV and two signal peptides, barley α-amylase signal peptide SP 1 and IL-37b signal peptide SP 2 Three recombinant IL-37a protein encoding genes were designed, and plant-derived recombinant IL-37a protein was produced with the help of plant bioreactor-tobacco. 4 mg of total protein can be extracted from 1 gram of tobacco leaves. After purification, the content of target protein is about 0.2 mg, and the concentration of target protein accounts for about 5% of the total tobacco protein, realizing high-yield and low-cost production of recombinant IL-37a protein.

[0022] The plant-derived recombinant IL-37a protein obtained by the present invention improves the delivery efficiency and stability of the protein in vivo through the modification of the protein tag, thereby better exercising its drug function and having broad application prospects in the field of anti-inflammatory. Experiments have confirmed that the four plant-derived recombinant IL-37a proteins can implement corresponding anti-inflammatory functions in mice, all of which improve the immune effect of experimental mice on psoriasis, and have a certain therapeutic effect on experimental psoriasis mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The electrophoresis diagram of the PCR amplification products of the Escherichia coli culture obtained by transformation in Example 1 to Example 4;

[0024] Figure 2 The electrophoresis diagram of the PCR amplification products of Agrobacterium tumefaciens obtained by transformation of Examples 1 to 4 and Comparative Example 1;

[0025] Figure 3 The WB test results of instantaneously infecting tobacco leaves of Examples 1 to 4 and Comparative Example 1 are shown;

[0026] Figure 4 The figure is a SDS-PAGE test result diagram of the purified proteins extracted from Examples 1 to 4 and Comparative Example 1;

[0027] Figure 5 These are photos of the visual appearance of the exposed skin on the backs of mice in each group on the 8th day of the experiment;

[0028] Figure 6 This is a comparison chart of the changes in the weight of mice in each group from the time the mice were depilated to the end of the experiment;

[0029] Figure 7 The pictures are of spleen phenotypes of mice in each group;

[0030] Figure 8 HE staining images of the back skin of mice in each group;

[0031] Fig. 9 This is a comparison chart of the relative expression levels of inflammatory genes in the spleen of each group of mice. DETAILED DESCRIPTION

[0032] The technical solution of the present invention is further described below in conjunction with the embodiments, but it is not limited thereto. Any modification or equivalent replacement of the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention shall be included in the protection scope of the present invention. The process equipment or devices not specifically noted in the following embodiments are all conventional equipment or devices in the art. If not specifically specified, the raw materials used in the embodiments of the present invention can be obtained commercially; if not specifically specified, the technical means used in the embodiments of the present invention are all conventional means well known to those skilled in the art.

[0033] Example 1

[0034] This embodiment provides a plant-derived recombinant IL-37a protein and a preparation method thereof.

[0035] In this example, the plant-derived recombinant IL-37a protein is encoded by the recombinant gene IL-37a mu, and its amino acid sequence is shown in SEQ ID No: 1.

[0036] The basic structure of the recombinant gene IL-37a mu is that the IL-37a mutant monomer encoding gene and the His tag are located between the PacⅠ and NotⅠ double restriction sites.

[0037] The IL-37a mutant monomer encoding gene was designed based on the cDNA sequence of the IL-37a gene in the NCBI database and related literature; the plasmid containing the recombinant gene IL-37a mu was synthesized by Beijing BGI Corporation and optimized according to the tomato codon.

[0038] The plant efficient expression vector plasmid used in this example is pJL-TRBO plasmid, purchased from Addgene, catalog number 80082; the strains used are chemically competent cells of Escherichia coli (DH5α), Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) strain GV3101 (P19) competent cells were purchased from Shanghai Weidi Biological Company; the plant bioreactor was Nicotiana benthamiana ( Nicotiana benthamiana )-Low alkaloid, i.e. low nicotine tobacco variety 81V9.

[0039] The method for preparing the plant-derived recombinant IL-37a protein in this embodiment comprises the following steps:

[0040] Step 1: construct a recombinant plasmid containing the recombinant gene IL-37a mu and a plant efficient expression vector.

[0041] The strain containing the recombinant gene IL-37a mu was dipped with an inoculation needle and placed in LB liquid medium with ampicillin resistance (Amp), and cultured overnight at 37°C and 200rpm in a constant temperature shaker. When the bacterial solution became turbid, a glass rod was used to dip the bacterial solution in an ultra-clean workbench and spread it on LB solid medium with 50 mg / L Kan resistance, and cultured at 37°C for 8 hours. When sparse colonies grew in the culture dish, a single colony was picked for propagation, and the plasmid of the propagated bacterial solution was extracted.

[0042] The plasmid extraction method was performed according to the instructions of the TIAN prep MiniPlasmid Kit purchased from Tiangen Biochemical Technology Co., Ltd. The plasmid was extracted and the plasmid containing the recombinant gene IL-37a mu was recovered by gel recovery after PCR identification.

[0043] Amplify the target gene fragment and design primers using SnapGene software. The sequences are as follows:

[0044] The base sequence of IL-37a mu-F is shown in SEQ ID NO:5: ATATTTAATTAACATGTCAGGC;

[0045] The base sequence of IL-37a mu-R is shown in SEQ ID NO:6: ATATGCGGCCGCTCTAGACTATC.

[0046] Using the extracted plasmid as a template, amplify the Pac Ⅰ and Not The target gene fragment of the restriction site I, the specific PCR reaction system is: template 1.0μL, upstream primer 0.6μL, downstream primer 0.6μL, KOD One TM PCR Master Mix 10.0 μL, ddH2O 7.8 μL, total 20.0 μL. The reaction procedure was (1) 98°C pre-denaturation for 5 min, (2) 98°C denaturation for 10 s, (3) (Tm-5)°C annealing for 5 s, (4) 68°C extension for 10 s, (2)-(4) 30 cycles; (5) 68°C final extension for 3 min.

[0047] After the PCR program was completed, part of the PCR product was mixed with 10× Loading Buffer in proportion, and the size of the PCR product was detected by agarose gel electrophoresis. The PCR product of the correct size was recovered by gel recovery, and the gel recovery kit used was purchased from Tiangen Biochemical Technology Co., Ltd.

[0048] According to the restriction sites reserved in the gene design, the same double restriction sites suitable for transient expression system exist in the expression vector pJL-TRBO plasmid and the plasmid containing the recombinant gene IL-37amu. Pac Ⅰ and Not Ⅰ Double digest the expression vector pJL-TRBO plasmid and the plasmid containing the recombinant gene IL-37a mu. The digestion system of the plasmid containing the recombinant gene IL-37a mu is: 20.0μL of purified product, 4.0μL of FlyCut Buffer, Pac Ⅰ1.0μL, Not I 1.0μL, ddH2O 14.0μL, total 40.0μL. Incubate at 37℃ for 25min, and perform agarose gel electrophoresis after the enzyme digestion. The enzyme digestion system of the expression vector pJL-TRBO plasmid is: pJL-TRBO plasmid 2.0μL, FlyCut Buffer 1.0μL, Pac Ⅰ0.3μL, Not I 0.3 μL, ddH2O 6.4 μL, total 10.0 μL. Incubate at 37°C for 30 min, inactivate at 65°C for 25 min, and perform agarose gel electrophoresis after enzyme digestion. Gel recovery of the double enzyme digestion product is the same as above.

[0049] Solution I ligase was used to connect the gel recovery product (target gene) and the plant efficient expression vector. The connection system was: 4.0 μL of gel recovery product, 1.0 μL of plant efficient expression vector (linear), 5.0 μL of Solution I ligase, a total of 10.0 μL. The connection was carried out overnight at 16°C for 3 hours to obtain a connection product containing the recombinant plasmid.

[0050] The ligation product containing the recombinant plasmid was transformed into E. coli competent DH5α, the steps are as follows:

[0051] 1. Place the DH5α competent cells in ice and wait for them to thaw after 5 minutes. Take out the ligation product from the 4°C refrigerator and slowly add it to the competent cells. Gently stir the bottom of the centrifuge tube by hand to mix the mixture. Place it on ice for 25 minutes.

[0052] 2. After standing, heat in a 42°C water bath for 45 seconds, place on ice for 2 minutes, and transfer gently;

[0053] 3. Pipette 700 µL of LB liquid medium in the clean bench and add it to the centrifuge tube containing the mixed product. Slowly and evenly blow and then place the centrifuge tube on a 37°C horizontal shaker with a speed of 200 rpm for 1 hour of shaking recovery culture.

[0054] 4. After the recovery, place the centrifuge tube in a centrifuge and centrifuge at 5000 rpm for 1 min to collect the bacteria;

[0055] 5. Take about 100µL of supernatant, gently blow with a pipette to resuspend the bacterial mass, take 50µL of the bacterial resuspension and spread it evenly on LB solid medium containing 50mg / L kanamycin, and invert and culture in a 37℃ constant temperature incubator for 12-24 h.

[0056] Pick the colonies with smooth edges and add them to LB liquid medium containing Kan resistance. Incubate at 37℃, 200rpm shaking for 6-12 hours. Use the turbid bacterial solution as a template for PCR amplification to verify whether the recombinant plasmid has been successfully transferred and determine the positive clones. The PCR reaction system is: template 1.0μL, upstream primer 0.6μL, downstream primer 0.6μL, 2× EasyTaq PCR Super Mix 10.0μL, ddH2O 7.8μL, total 20.0μL. The reaction procedure is (1) 98℃ pre-denaturation for 5min, (2) 98℃ denaturation for 10s, (3) (Tm-5)℃ annealing for 5s, (4) 68℃ extension for 10s, (2)-(4) 30 cycles; (5) 68℃ final extension for 3min. Detect the PCR product by 1% agarose gel electrophoresis to determine the positive clones. According to the PCR identification results, the recombinant plasmid containing the recombinant gene IL-37a mu was extracted and stored at -20°C.

[0057] Step 2: Use the recombinant plasmid containing the recombinant gene IL-37a mu obtained in step 1 to transform Agrobacterium tumefaciens.

[0058] According to the instructions of GV3101 (pSoup-p19) Chemically CompetentCell product of Shanghai Weidi Biotechnology Co., Ltd., the recombinant plasmid containing the recombinant gene IL-37a mu was transformed into Agrobacterium. The transformed Agrobacterium was identified and preserved by PCR for positive clones.

[0059] Step 3: Agrobacterium tumefaciens-mediated transient expression in tobacco.

[0060] Use a mixture of flower soil and vermiculite of equal quality, moisten it and sow the seeds of tobacco 81V9, cover the flowerpot with plastic wrap to keep it warm, and after 2 weeks, remove the seedlings and culture them in separate pots. The lighting conditions are 16 hours of light and 8 hours of darkness, and the seedlings are cultured until they are one month old.

[0061] The injection method is used to infect tobacco, and the specific method is as follows:

[0062] 1. Take out the successfully identified Agrobacterium liquid from the ultra-low temperature refrigerator, add it to a sterile conical flask, add 10mL of LB liquid culture medium containing kanamycin and rifampicin antibiotics, put it in a 28℃ horizontal shaker, and shake and culture at 200 rpm for 16 hours;

[0063] 2. Inoculate 1 mL of overnight culture into liquid LB containing the same concentration of antibiotics for activation. Use a UV spectrophotometer to detect the bacterial solution and maintain OD 600 The value was in the range of 1.7-2.0, and the bacteria were precipitated in a low-speed centrifuge at 5000 rpm at 4°C for 15 min;

[0064] 3. Use tobacco infiltration buffer to suspend the bacterial pellet, and the final OD 600 The value should be adjusted to 0.1-0.8;

[0065] 4. Place the tobacco infiltration buffer mixed with bacterial precipitate on the table and let it stand at room temperature for 2-4 hours; tobacco infiltration buffer formula: MES (pH=5.6) 10mM, MgCl2 10mM, AS 100-150µM;

[0066] 5. Use a 1 mL sterile syringe to infiltrate the tobacco leaves. Successful infiltration will result in the spread of wet areas on the tobacco leaves.

[0067] 6. Collect the infiltrated tobacco leaves 2-7 days after infiltration.

[0068] Step 4: Extraction and purification of plant-based protein.

[0069] The plant total protein is extracted from the infected tobacco leaves, and the specific method and steps are as follows:

[0070] 1. Take tobacco leaves 2-7 days after infection, put 200-400 mg of leaves into a mortar pre-cooled with liquid nitrogen and grind them with a pestle;

[0071] 2. Add 1 mL of pre-cooled protein extraction buffer to every 100 mg of leaves, mix thoroughly and transfer to a pre-cooled centrifuge tube; the formula of protein extraction buffer is: NaCl 0.8775 g, 1 M Tris-HCl (pH = 7.6) 1 mL, 0.5 M EDTA 400 µL, NP-40 500 µL, distilled water, 96 mL, total volume 100 mL;

[0072] 3. Place on ice for 10 minutes;

[0073] 4. Precool the high-speed centrifuge to 4°C and centrifuge at 12,000 rpm for 20 min;

[0074] 5. Take the supernatant and put it into a new centrifuge tube. Centrifuge at 12000rpm for 10 min.

[0075] 6. Transfer the supernatant to a pre-cooled and clean centrifuge tube and measure the protein concentration using bovine serum reagent and a spectrophotometer;

[0076] 7. Take the protein supernatant and divide it into individual centrifuge tubes to avoid repeated freezing and thawing, and store it in an ultra-low temperature refrigerator.

[0077] The plant total protein was purified by nickel column affinity chromatography. The specific steps are as follows:

[0078] 1. Prepare protein purification buffer:

[0079] Binding buffer: PBS buffer, pH 7.4;

[0080] Elution buffer: PBS buffer (pH 7.4), 20 mM imidazole, 50 mM imidazole, 80 mM imidazole, 200 mM imidazole, 300 mM imidazole, 500 mM imidazole, pH 7.4;

[0081] 2. Prepare the empty gravity column. Place the filter membrane in the gravity column, wash the filter membrane three times with 20% ethanol solution, and rinse the filter membrane three times with distilled water;

[0082] 3. Prepare the filler. Pipette 500 µL of filler into the gravity column and allow the liquid in the filler to flow down by gravity; add 5 times the column volume of distilled water to wash the filler; add 5-10 times the column volume of binding buffer to balance the gravity column;

[0083] 4. Slowly add the sample to be purified and collect the effluent in a pre-cooled centrifuge tube;

[0084] 5. Slowly add different concentrations of elution buffer (from low to high) and collect the eluted components respectively;

[0085] 6. Elute with 2 column volumes of elution buffer and collect the flow-through;

[0086] 7. Measure the absorbance at 595 nm using a UV spectrophotometer and confirm by SDS-PAGE.

[0087] Steps (1-6) were all performed at 4°C.

[0088] The purified protein was dialyzed against PBS using the following method:

[0089] First, cut the dialysis bag into appropriate lengths and clamp one end of the dialysis bag with a dialysis clamp; add distilled water into the dialysis bag, check for leakage, and replace the other end after inspection; drain the distilled water in the dialysis bag, put the sample into the dialysis bag, and clamp both ends with dialysis clamps; put the dialysis bag containing the sample into PBS buffer; replace the dialysate 2-4 h, 6-8 h and 10-14 h (the next day) after dialysis, and continue for at least 2 h after the last dialysate replacement to obtain the plant-derived recombinant IL-37a protein encoded by the recombinant gene IL-37a mu.

[0090] Example 2

[0091] This embodiment provides a plant-derived recombinant IL-37a protein and a preparation method thereof.

[0092] In this example, the plant-derived recombinant IL-37a protein is encoded by the recombinant gene CPP-IL-37a mu, and its amino acid sequence is shown in SEQ ID No: 2.

[0093] The basic structure of the recombinant gene CPP-IL-37a mu is that between the PacⅠ and NotⅠ double restriction sites are the protein tag cell-penetrating peptide CPP, the IL-37a mutant monomer encoding gene and the His tag.

[0094] The IL-37a mutant monomer encoding gene was designed based on the cDNA sequence of the IL-37a gene in the NCBI database and related literature; the plasmid containing the recombinant gene CPP-IL-37a mu was synthesized by Beijing BGI Corporation and optimized according to the tomato codon.

[0095] The plant efficient expression vector plasmid used in this example is pJL-TRBO plasmid, purchased from Addgene, catalog number 80082; the strains used are chemically competent cells of Escherichia coli (DH5α), Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) strain GV3101 (P19) competent cells were purchased from Shanghai Weidi Biological Company; the plant bioreactor was Nicotiana benthamiana ( Nicotiana benthamiana )-Low alkaloid, i.e. low nicotine tobacco variety 81V9.

[0096] The method for preparing the plant-derived recombinant IL-37a protein in this embodiment comprises the following steps:

[0097] Step 1: construct a recombinant plasmid containing the recombinant gene CPP-IL-37a mu and a plant efficient expression vector.

[0098] The strain containing the recombinant gene CPP-IL-37a mu was dipped with an inoculation needle and placed in LB liquid medium with ampicillin resistance (Amp), and cultured overnight at 37°C and 200rpm in a constant temperature shaker. When the bacterial solution became turbid, a glass rod was used to dip the bacterial solution in an ultra-clean workbench and spread it on LB solid medium with 50 mg / L Kan resistance, and cultured at 37°C for 8 hours. When sparse colonies grew in the culture dish, a single colony was picked for propagation, and the plasmid of the propagated bacterial solution was extracted.

[0099] The plasmid extraction method was performed according to the instructions of the TIAN prep MiniPlasmid Kit purchased from Tiangen Biochemical Technology Co., Ltd. The plasmid was extracted, and after PCR identification was correct, the plasmid containing the recombinant gene CPP-IL-37amu was recovered by gel recovery; the PCR identification method and gel recovery method were the same as in Example 1.

[0100] Amplify the target gene fragment and design primers using SnapGene software. The sequences are as follows:

[0101] The base sequence of CPP-IL-37a mu-F is shown in SEQ ID NO:7:

[0102] ATATTTAATTAACCATGGGAAGAAGATGGAGAAGATGGAAC;

[0103] The base sequence of CPP-IL-37a mu-R is shown in SEQ ID NO:8:

[0104] ATATGCGGCCGCTCTAGACTATCAAT.

[0105] According to the restriction sites reserved in the gene design, the same double restriction sites suitable for transient expression system exist in the expression vector pJL-TRBO plasmid and the plasmid containing the recombinant gene CPP-IL-37a mu. Pac Ⅰ and Not Ⅰ The expression vector pJL-TRBO plasmid and the plasmid containing the recombinant gene CPP-IL-37a mu were double-digested with enzymes. The enzyme digestion system and enzyme digestion method were the same as those in Example 1.

[0106] After the digestion, 1% agarose gel electrophoresis was performed. The double digestion product was recovered by gel electrophoresis and gel recovery methods were the same as those in Example 1.

[0107] The gel recovery product (target gene) and the plant efficient expression vector were connected using SolutionI ligase, and the connection product containing the recombinant plasmid was transformed into Escherichia coli competent DH5α. The Escherichia coli DH5α propagation culture liquid was subjected to PCR identification. The connection method, transformation method and PCR identification method were the same as those in Example 1.

[0108] According to the PCR identification results, the recombinant plasmid containing the recombinant gene CPP-IL-37a mu was extracted and stored at -20°C.

[0109] Step 2: Use the recombinant plasmid containing the recombinant gene CPP-IL-37a mu obtained in step 1 to transform Agrobacterium tumefaciens.

[0110] According to the instructions of GV3101 (pSoup-p19) Chemically CompetentCell product of Shanghai Weidi Biotechnology Co., Ltd., the recombinant plasmid containing the recombinant gene CPP-IL-37a mu was transformed into Agrobacterium. The transformed Agrobacterium was identified and preserved by PCR for positive clones.

[0111] Step 3: Agrobacterium tumefaciens-mediated transient expression in tobacco.

[0112] The tobacco leaves were infected by injection, and the specific injection method was the same as that in Example 1. The infiltrated tobacco leaves were collected 2-7 days after infiltration.

[0113] Step 4: Extraction and purification of plant-based protein.

[0114] The plant total protein was extracted from the infected tobacco leaves in the same manner as in Example 1.

[0115] The plant total protein was purified by nickel column affinity chromatography, and the purification method was the same as in Example 1; the purified protein was dialyzed with PBS, and the specific method was the same as in Example 1, and the dialyzation was carried out overnight to obtain the plant-derived recombinant IL-37a protein encoded by the recombinant gene CPP-IL-37a mu.

[0116] Example 3

[0117] This embodiment provides a plant-derived recombinant IL-37a protein and a preparation method thereof.

[0118] In this embodiment, the plant-derived recombinant IL-37a protein is produced by the recombinant gene SP 1-CTB-IL-37a mu encoding, the amino acid sequence of which is shown in SEQ ID No:3.

[0119] Recombinant gene SP 1 The basic structure of -CTB-IL-37a mu is: between the PacⅠ and NotⅠ double restriction sites, there is the barley α-amylase signal peptide SP 1 , cholera toxin B subunit CTB, IL-37a mutant monomer encoding gene and His tag.

[0120] The IL-37a mutant monomer encoding gene was designed based on the cDNA sequence of the IL-37a gene in the NCBI database and related literature; it contains the recombinant gene SP 1 The plasmid of -CTB-IL-37a mu was synthesized by Beijing BGI and optimized according to the tomato codon.

[0121] The plant efficient expression vector plasmid used in this example is pJL-TRBO plasmid, purchased from Addgene, catalog number 80082; the strains used are chemically competent cells of Escherichia coli (DH5α), Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) strain GV3101 (P19) competent cells were purchased from Shanghai Weidi Biological Company; the plant bioreactor was Nicotiana benthamiana ( Nicotiana benthamiana )-Low alkaloid, i.e. low nicotine tobacco variety 81V9.

[0122] The method for preparing the plant-derived recombinant IL-37a protein in this embodiment comprises the following steps:

[0123] Step 1: Constructing a recombinant gene SP containing a recombinant gene 1 -CTB-IL-37a mu and plant high-efficiency expression vector recombinant plasmid.

[0124] The recombinant gene SP 1 -CTB-IL-37a mu strain was dipped with an inoculation needle and placed in LB liquid medium with ampicillin resistance (Amp), and cultured overnight in a constant temperature shaker at 37°C and 200rpm. When the bacterial solution became turbid, a glass rod was used to dip the bacterial solution in an ultra-clean workbench and spread it on LB solid medium with 50 mg / L Kan resistance, and cultured at 37°C for 8 hours. When sparse colonies grew in the culture dish, a single colony was picked for propagation, and the plasmid of the propagated bacterial solution was extracted.

[0125] Plasmid extraction method: According to the instructions of the purchased plasmid extraction kit TIAN prep MiniPlasmid Kit from Tiangen Biochemical Technology Co., Ltd., plasmid was extracted. After PCR identification, the recombinant gene SP was recovered by gel recovery. 1-CTB-IL-37a mu plasmid; PCR identification method and gel recovery method are the same as in Example 1.

[0126] Amplify the target gene fragment and design primers using SnapGene software. The sequences are as follows:

[0127] SP 1 -CTB-IL-37a mu-F base sequence is shown in SEQ ID NO:9:

[0128] ATATTTAATTAACCATGGGAAAGAACGGTAGTCTATGC;

[0129] SP 1 -CTB-IL-37a mu-R base sequence is shown in SEQ ID NO: 10:

[0130] ATATGCGGCCGCTCTAGATTATCAAAGCT.

[0131] According to the restriction sites reserved in gene design, the expression vector pJL-TRBO plasmid and the recombinant gene SP 1 -CTB-IL-37a mu plasmids have the same double restriction sites suitable for transient expression system. Pac Ⅰ and Not Ⅰ Pair of expression vector pJL-TRBO plasmid and recombinant gene SP 1 -CTB-IL-37a mu plasmid was double-digested, and the digestion system and digestion method were the same as in Example 1.

[0132] After the digestion, 1% agarose gel electrophoresis was performed. The double digestion product was recovered by gel electrophoresis and gel recovery methods were the same as those in Example 1.

[0133] The gel recovery product (target gene) and the plant efficient expression vector were connected using SolutionI ligase, and the connection product containing the recombinant plasmid was transformed into Escherichia coli competent DH5α. The Escherichia coli DH5α propagation culture liquid was subjected to PCR identification. The connection method, transformation method and PCR identification method were the same as those in Example 1.

[0134] According to the PCR identification results, the recombinant gene SP 1 -CTB-IL-37a mu recombinant plasmid was stored at -20°C.

[0135] Step 2: Use the SP containing the recombinant gene obtained in step 1 1 -CTB-IL-37a mu recombinant plasmid was used to transform Agrobacterium tumefaciens.

[0136] According to the instructions of GV3101 (pSoup-p19) Chemically CompetentCell product of Shanghai Weidi Biotechnology Co., Ltd., the recombinant gene SP 1 -CTB-IL-37a mu recombinant plasmid was used to transform Agrobacterium. The transformed Agrobacterium was identified and preserved by PCR for positive clones.

[0137] Step 3: Agrobacterium tumefaciens-mediated transient expression in tobacco.

[0138] The tobacco leaves were infected by injection, and the specific injection method was the same as that in Example 1. The infiltrated tobacco leaves were collected 2-7 days after infiltration.

[0139] Step 4: Extraction and purification of plant-based protein.

[0140] The plant total protein was extracted from the infected tobacco leaves in the same manner as in Example 1.

[0141] The plant total protein was purified by nickel column affinity chromatography in the same way as in Example 1; the purified protein was dialyzed with PBS in the same way as in Example 1 overnight to obtain the protein obtained by the recombinant gene SP 1 -CTB-IL-37a mu encodes plant-derived recombinant IL-37a protein.

[0142] Example 4

[0143] This embodiment provides a plant-derived recombinant IL-37a protein and a preparation method thereof.

[0144] In this embodiment, the plant-derived recombinant IL-37a protein is produced by the recombinant gene SP 2 -TEV-IL-37a mu encodes, and its amino acid sequence is shown in SEQ ID No:4.

[0145] Recombinant gene SP 2 The basic structure of -TEV-IL-37a mu is that between the PacⅠ and NotⅠ double restriction sites, there is the IL-37b signal peptide SP 2 , tobacco etch virus TEV, IL-37a mutant monomer encoding gene and His tag.

[0146] The IL-37a mutant monomer encoding gene was designed based on the cDNA sequence of the IL-37a gene in the NCBI database and related literature; it contains the recombinant gene SP 2 The plasmid of -TEV-IL-37a mu was synthesized by Beijing BGI and optimized according to the tomato codon.

[0147] The plant efficient expression vector plasmid used in this example is pJL-TRBO plasmid, purchased from Addgene, catalog number 80082; the strains used are chemically competent cells of Escherichia coli (DH5α), Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) strain GV3101 (P19) competent cells were purchased from Shanghai Weidi Biological Company; the plant bioreactor was Nicotiana benthamiana ( Nicotiana benthamiana )-Low alkaloid, i.e. low nicotine tobacco variety 81V9.

[0148] The method for preparing the plant-derived recombinant IL-37a protein in this embodiment comprises the following steps:

[0149] Step 1: Constructing a recombinant gene SP containing a recombinant gene 2 -Recombinant plasmid of TEV-IL-37a mu and plant efficient expression vector.

[0150] The recombinant gene SP 2 -TEV-IL-37a mu strain was dipped in an appropriate amount with an inoculation needle and placed in LB liquid medium with ampicillin resistance (Amp), and cultured overnight in a constant temperature shaker at 37°C and 200rpm. When the bacterial solution became turbid, a glass rod was used to dip in an appropriate amount of the bacterial solution in a clean bench and spread on LB solid medium with 50 mg / L Kan resistance, and cultured at 37°C for 8 hours. When sparse colonies grew in the culture dish, a single colony was picked for propagation, and the plasmid of the propagated bacterial solution was extracted.

[0151] Plasmid extraction method: According to the instructions of the purchased plasmid extraction kit TIAN prep MiniPlasmid Kit from Tiangen Biochemical Technology Co., Ltd., plasmid was extracted. After PCR identification, the recombinant gene SP was recovered by gel recovery. 2 -TEV-IL-37a mu plasmid; PCR identification method and gel recovery method are the same as in Example 1.

[0152] Amplify the target gene fragment and design primers using SnapGene software. The sequences are as follows:

[0153] SP 1 -CTB-IL-37a mu-F base sequence is shown in SEQ ID NO: 11:

[0154] ATATTTAATTAACCATGGGAAAGAACGGTAGTCTATGC;

[0155] SP 1 -CTB-IL-37a mu-R base sequence is shown in SEQ ID NO: 12:

[0156] ATATGCGGCCGCTCTAGATTATCAAAGCT.

[0157] According to the restriction sites reserved in gene design, the expression vector pJL-TRBO plasmid and the recombinant gene SP 2 -TEV-IL-37a mu plasmids have the same double restriction sites suitable for transient expression system. Pac Ⅰ and Not Ⅰ Pair of expression vector pJL-TRBO plasmid and recombinant gene SP 2 -TEV-IL-37a mu plasmid was double-digested, and the digestion system and digestion method were the same as in Example 1.

[0158] After the digestion, 1% agarose gel electrophoresis was performed. The double digestion product was recovered by gel electrophoresis and gel recovery methods were the same as those in Example 1.

[0159] The gel recovery product (target gene) and the plant efficient expression vector were connected using SolutionI ligase, and the connection product containing the recombinant plasmid was transformed into Escherichia coli competent DH5α. The Escherichia coli DH5α propagation culture liquid was subjected to PCR identification. The connection method, transformation method and PCR identification method were the same as those in Example 1.

[0160] According to the PCR identification results, the recombinant gene SP 2 -TEV-IL-37a mu recombinant plasmid was stored at -20℃.

[0161] Step 2: Use the SP containing the recombinant gene obtained in step 1 2 -TEV-IL-37a mu recombinant plasmid was transformed into Agrobacterium tumefaciens.

[0162] According to the instructions of GV3101 (pSoup-p19) Chemically CompetentCell product of Shanghai Weidi Biotechnology Co., Ltd., the recombinant gene SP 2 -TEV-IL-37a mu recombinant plasmid was used to transform Agrobacterium. The transformed Agrobacterium was identified and preserved by PCR for positive clones.

[0163] Step 3: Agrobacterium tumefaciens-mediated transient expression in tobacco.

[0164] The tobacco leaves were infected by injection, and the specific injection method was the same as that in Example 1. The infiltrated tobacco leaves were collected 2-7 days after infiltration.

[0165] Step 4: Extraction and purification of plant-based protein.

[0166] The plant total protein was extracted from the infected tobacco leaves in the same manner as in Example 1.

[0167] The plant total protein was purified by nickel column affinity chromatography in the same way as in Example 1; the purified protein was dialyzed with PBS in the same way as in Example 1 overnight to obtain the protein obtained by the recombinant gene SP 1 -CTB-IL-37a mu encodes plant-derived recombinant IL-37a protein.

[0168] Comparative Example 1

[0169] This comparative example provides a plant-derived human IL-37a protein and a preparation method thereof.

[0170] In this comparative example, the plant-derived human IL-37a protein is encoded by the IL-37a ma gene, and its amino acid sequence is shown in SEQ ID No:13.

[0171] The basic structure of IL-37a ma gene is that between PacⅠ and NotⅠ double restriction sites are barley α-amylase signal peptide SP 1 , IL-37a ma gene and His tag.

[0172] The IL-37a ma gene was designed based on the cDNA sequence of the IL-37a gene in the NCBI database and related literature; the corresponding strain containing the IL-37a ma gene plasmid was donated by Professor Ma Shengwu.

[0173] The pJL-TRBO plasmid plant bioreactor used in this comparative example is Nicotiana benthamiana ( Nicotiana benthamiana )-Low alkaloid, i.e. low nicotine tobacco variety 81V9.

[0174] The preparation method of the plant-derived recombinant IL-37a protein in this comparative example comprises the following steps:

[0175] Step 1: Extract the recombinant plasmid containing the IL-37a ma gene and the plant efficient expression vector.

[0176] The Escherichia coli strain containing the IL-37a ma gene was dipped with an inoculation needle and placed in a LB liquid medium with Kan resistance, and cultured overnight at 37°C and 200rpm in a constant temperature shaker. When the bacterial solution became turbid, a glass rod was used to dip the bacterial solution in an ultra-clean workbench and spread it on a 50 mg / L Kan-resistant LB solid medium, and cultured at 37°C for 8 hours. When sparse colonies grew in the culture dish, a single colony was picked for propagation, and the plasmid of the propagated bacterial solution was extracted.

[0177] The plasmid extraction method was performed according to the instructions of the purchased plasmid extraction kit TIAN prep MiniPlasmid Kit from Tiangen Biochemical Technology Co., Ltd. The plasmid was extracted, and the plasmid containing the IL-37a ma gene was extracted after PCR identification was correct; the PCR identification method was the same as that in Example 1.

[0178] Primers were designed using SnapGene software and the sequences are as follows:

[0179] The base sequence of IL-37a ma-F is shown in SEQ ID NO: 14:

[0180] ATATTTAATTAACCATGGGAAAGAACGGTTCA;

[0181] The base sequence of IL-37a ma-R is shown in SEQ ID NO: 15:

[0182] ATATGCGGCCGCTCTAGATCATTATAACTC.

[0183] pJL-TRBO plasmid pJL-TRBO plasmid was used to perform PCR identification on the E. coli DH5α propagation culture liquid. The PCR identification method was the same as that in Example 1.

[0184] According to the PCR identification results, the recombinant plasmid containing the IL-37a ma gene was extracted and stored at -20°C.

[0185] Step 2: Use the recombinant plasmid containing the IL-37a ma gene obtained in step 1 to transform Agrobacterium tumefaciens.

[0186] According to the instructions of GV3101 (pSoup-p19) Chemically CompetentCell product of Shanghai Weidi Biotechnology Co., Ltd., the recombinant plasmid containing IL-37a ma gene was transformed into Agrobacterium. The transformed Agrobacterium was identified and preserved by PCR for positive clones.

[0187] Step 3: Agrobacterium tumefaciens-mediated transient expression in tobacco.

[0188] The tobacco leaves were infected by injection, and the specific injection method was the same as that in Example 1. The infiltrated tobacco leaves were collected 2-7 days after infiltration.

[0189] Step 4: Extraction and purification of plant-based protein.

[0190] The plant total protein was extracted from the infected tobacco leaves in the same manner as in Example 1.

[0191] The plant total protein was purified by nickel column affinity chromatography, and the purification method was the same as in Example 1; the purified protein was dialyzed with PBS, and the specific method was the same as in Example 1, and the dialyzation was carried out overnight to obtain the plant-derived human IL-37a protein encoded by the IL-37a ma gene.

[0192] 1. PCR identification was performed on the bacterial solution of E. coli DH5α obtained by transformation in Examples 1 to 4. The results are shown in Figure 1 .

[0193] Figure 1 The electrophoresis diagram of the PCR amplification products of the Escherichia coli culture obtained by transformation in Example 1 to Example 4, in which M represents 2000 bp DNA Maker, water represents water control, 680 bp gene size is connected to the CPP-IL-37a mu recombinant plasmid; 631 bp gene size is connected to the IL-37a mu recombinant plasmid, and 1034 bp gene size is connected to the SP 1 -CTB-IL-37a mu recombinant plasmid, 1522 bp gene size for connecting SP 2 -TEV-IL-37a mu recombinant plasmid.

[0194] The results showed that Examples 1-4 all produced electrophoresis bands consistent with the expected size, proving that each recombinant gene and the plant efficient expression vector were successfully connected, and the recombinant plasmids of Examples 1-4 were successfully transformed into Escherichia coli DH5α.

[0195] 2. PCR identification was performed on the propagated bacterial solution of Agrobacterium tumefaciens obtained by transformation in Examples 1 to 4 and Comparative Example 1, with water as a negative control. The results are shown in Figure 2 .

[0196] Figure 2 It is the electrophoresis diagram of the PCR amplification products of Agrobacterium tumefaciens obtained by transformation of Examples 1 to 4 and Comparative Example 1, in which M represents DNAMaker, water represents water control, and AE are the bands of PCR amplification products corresponding to the Agrobacterium tumefaciens obtained in Example 1, Comparative Example 1, Example 2, Example 3 and Example 4, respectively.

[0197] The results showed that Examples 1 to 4 and Comparative Example 1 all produced PCR agarose gel electrophoresis bands that were consistent with the expected size, proving that the recombinant plasmids of Examples 1 to 4 and Comparative Example 1 were successfully transformed into Agrobacterium tumefaciens.

[0198] 3. Western Blot protein immunoblot detection was performed on the tobacco leaf samples obtained by transient infection in Examples 1 to 4 and Comparative Example 1. The primary antibody was diluted with blocking solution according to the instructions and incubated with the PVDF membrane; then the membrane was incubated at room temperature using a low-speed shaker for 1 h or overnight at 4°C; after the incubation, the PVDF membrane was washed with an appropriate amount of TBST buffer, 5 min each time for 6 times; after the washing, the secondary antibody was diluted with blocking solution according to the instructions and used to incubate the PVDF membrane, and then the membrane was incubated at room temperature using a low-speed shaker for 1 h. The results are shown in FIG. Figure 3 .

[0199] Figure 3 The WB test results of instant infection of tobacco leaves in Examples 1 to 4 and Comparative Example 1 are shown in FIG. 1 ; M in the figure is Protein Marker, A: From left to right, the first stripe represents Example 1- IL-37a mu, the second and third stripes represent Example 4- SP 2 -TEV-IL-37a mu; B: The strip in the box represents Example 2 -CPP-IL-37a mu; C: The strip in the box represents Example 3SP 1 -CTB-IL-37a mu; D: The strip in the box represents Comparative Example 1 - IL-37a ma.

[0200] The results showed that the expression of the target protein could be detected within a short period of time after transient transformation of tobacco in Examples 1 to 4 and Comparative Example 1, and there were target bands at the expected size position, indicating that the tobacco successfully expressed the recombinant proteins in each example.

[0201] 4. The purified proteins extracted from Examples 1 to 4 and Comparative Example 1 were subjected to SDS-PAGE detection. The results are shown in Figure 4 .

[0202] Figure 4 The SDS-PAGE test results of the purified proteins extracted from Examples 1 to 4 and Comparative Example 1 are shown in FIG. 1 ; M in the figure is Protein Marker, A: from left to right, the first band represents Example 1-IL-37a mu, and the second band represents Example 4-SP 2 -TEV-IL-37a mu; B: The strip in the box represents Comparative Example 1-IL-37a ma; C: The strip in the box represents Example 2-CPP-IL-37a mu; D: The strip in the box represents Example 3-SP 1 -CTB-IL-37a mu.

[0203] The results showed that the expression of the target protein could be detected in a short time after Examples 1 to 4 and transient transformation of tobacco, and there was a target band at the expected size position, indicating that the recombinant protein containing the histidine tag was purified.

[0204] 5. The physicochemical properties of the four plant-derived recombinant proteins prepared in Examples 1 to 4 and the plant-derived human IL-37a protein prepared in Comparative Example 1 were investigated. The results are shown in Table 1.

[0205] Table 1

[0206] ;

[0207] 6. Subcutaneous administration of the four plant-derived recombinant IL-37a proteins prepared in Examples 1 to 4 and the plant-derived IL-37a protein prepared in Comparative Example 1 to mice for the treatment of psoriasis.

[0208] 1. Establishment of psoriasis mouse model

[0209] The experimental mice were purchased from Liaoning Changsheng Biotechnology Co., Ltd., 6-week-old C57 experimental mice, weighed and caged, and tail-tagged; there were 3 model groups, 2 normal groups, and 5 drug-treated experimental groups with 4 mice each, for a total of 7 groups, with a total of 25 experimental mice.

[0210] Use 4% chloral hydrate at a dosage of 0.2 mL / 20 g to briefly anesthetize the mice; apply depilatory cream evenly on the hair on the back of the mice, wait for 5 minutes, and use a cotton swab to gently scrape the hair on the back of the mice, exposing about 2.5 cm × 2.5 cm of the back skin of the mice. After all the mice are awake, record the weight of the depilated mice.

[0211] The model group and experimental group mice were modeled with commercially available imiquimod ointment (purchased from Sichuan Mingxin Pharmaceutical Co., Ltd.) at a ratio of 62.5 mg applied to 2.5 cm × 2.5 cm back skin. Imiquimod ointment was applied continuously for eight consecutive days at the same time, and the weight of the mice and the phenotypic differences of the back skin were recorded every day.

[0212] (II) Subcutaneous injection of four plant-derived recombinant IL-37a proteins prepared in Examples 1 to 4 and the plant-derived IL-37a protein prepared in Comparative Example 1

[0213] After the second application of imiquimod ointment, at least 5 hours later, the 5 experimental group mice were given subcutaneous injections at a dosage of 1 mg / kg, and the experimental group mice were treated. The phenotypic changes of the skin on the back of the mice were recorded by photographing, and the weight of the mice was recorded.

[0214] The model group was treated with imiquimod ointment and the weight of mice was recorded within 8 days without any other treatment. The normal group was treated with decimal weight without any other treatment.

[0215] After 6 days of continuous administration, the mice were euthanized and samples were collected for subsequent experiments, including fixed skin for pathological observation and spleen stored at -80°C for qRT-PCR quantitative analysis.

[0216] 3. Differences in skin phenotypes of mice in different groups

[0217] Figure 5 The following are photos of the visual performance of the exposed skin on the back of each group of mice on the 8th day of the experiment; AG in the figure are the normal group, model group, Example 3 group, Example 1 group, Example 2 group, Comparative Example 1 group and Example 4 group, respectively. The pictures show that the model group experimental mice, which were only applied with imiquimod ointment during the 8-day test, had obvious swelling and dark red patches on the back skin, and thick white scales attached to the back, which was significantly different from the normal group. Compared with the model group, it can be seen that the skin lesions on the back of the mice in the drug-treated group were alleviated, and the visual appearance was improved. There are certain differences in the therapeutic effects of plant-derived proteins with different modification effects on experimental psoriasis mice. However, compared with the model group, it can be seen that the plant-derived proteins prepared in Examples 1-4 and Comparative Example 1 have certain therapeutic effects on experimental psoriasis mice, and Sp 2 In the -TEV-37a mu test group, the phenotype of the mouse back skin was close to that of the normal group. This indicates that both the mutant monomer and the mature form of the plant-derived IL-37a protein have biological activity.

[0218] (IV) Body weight changes of mice in different groups

[0219] Figure 6 This is a comparative chart of the weight changes of seven groups of mice from the time the mice were depilated to the end of the experiment. The picture shows that there was no significant weight loss in the mice in each treatment group, indicating that the plant-derived protein did not cause obvious acute toxic side effects on the mice during the treatment process.

[0220] (V) Changes in spleen index of mice in different groups

[0221] After the experiment, the mice were euthanized, the spleens of the mice were weighed and the spleen index of the mice was calculated, as shown in Table 2. The spleen index calculation formula was: spleen index (mg / g) = spleen weight (mg) / mouse body weight (g).

[0222] Table 2

[0223] ;

[0224] As shown in Table 2, only applying imiquimod ointment significantly increased the spleen index of the experimental mice in the model group, and the spleen index of the five drug-treated groups decreased to varying degrees compared with the model group.

[0225] Figure 7The spleen phenotype photos of each group of mice; AG are normal group, model group, Example 3 group, Example 1 group, Example 2 group, Comparative Example 1 group and Example 4 group. The pictures show that the spleen of the normal group mice is bright red, while the spleen of the model group test mice is dark red. In addition, the spleens of the other five groups of test mice given different plant sources have obvious changes. It can be inferred that the plant-derived recombinant IL-37a protein containing different modifications has biological activity and has solid anti-inflammatory and immunosuppressive effects.

[0226] 6. HE staining of skin sections of mice in different groups

[0227] Skin tissue was fixed with 4% paraformaldehyde and embedded in paraffin after 24 h-7d. Skin sections were taken with a thickness of 6 µm. Tissue sections were dewaxed with xylene and gradient ethanol, and further stained with hematoxylin and eosin (HE) and observed under a microscope.

[0228] Figure 8 HE staining of the back skin of mice in each group; AG are normal group, model group, Example 3 group, Example 1 group, Example 2 group, Comparative Example 1 group and Example 4 group. The picture shows that compared with the normal group, only the acanthosis, parakeratosis, dermis and epidermis infiltration increased in the imiquimod-treated group. Compared with the model group, the epidermal hyperplasia phenomenon in the other five treatment groups decreased significantly, which shows that subcutaneous injection of plant-derived IL-37a protein containing different protein modification tags may be sufficient to control the severity of psoriasis inflammation and epidermal hyperplasia.

[0229] 7. Detection of pro-inflammatory cytokine transcription levels in the spleen of each group of mice

[0230] The spleen RNA of each group of mice was extracted by Trizol method, and the RNA concentration of each sample was adjusted to keep consistent. The corresponding cDNA was obtained by reverse transcription, and qRT-PCR was used to detect the relative expression levels of three proinflammatory cytokine genes IL-1β, IL-6, and TNF-α in the spleen.

[0231] Fig. 9 The figure is a comparison of the relative expression of inflammatory genes in the spleen of each group of mice; the figure shows that in the model group, the level of proinflammatory cytokines increased significantly. After applying five groups of plant-derived IL-37a proteins, proinflammatory cytokines such as IL-1β, IL-6 and TNF-α in the spleen lesions of experimental mice decreased to varying degrees. These results indicate that plant-derived recombinant IL-37a protein can reduce the severity of psoriasis skin inflammation caused by imiquimod.

[0232] In summary, the recombinant IL-37a protein containing different protein modification tags expressed by tobacco has biological activity and has a certain therapeutic effect on psoriasis induced by imiquimod ointment.

Claims

1. A plant-derived recombinant IL-37a protein, characterized in that: The recombinant IL-37a protein is encoded by the recombinant gene IL-37amu, whose amino acid sequence is shown in SEQ ID NO: 1; or encoded by the recombinant gene CPP-IL-37a mu, whose amino acid sequence is shown in SEQ ID NO: 2; or encoded by the recombinant gene SP 1 -CTB-IL-37a mu, whose amino acid sequence is shown in SEQ ID NO: 3; or 2 -TEV-IL-37a mu encodes, and its amino acid sequence is shown in SEQ ID NO:

4.

2. A method for preparing the plant-derived recombinant IL-37a protein according to claim 1, characterized in that: The steps include: Step 1: Double-digest the plasmid containing the recombinant gene and the plasmid containing the plant efficient expression vector, then connect them to construct a recombinant plasmid containing the recombinant gene and the plant efficient expression vector, and transform the obtained recombinant plasmid into competent Escherichia coli; Step 2: extracting the recombinant plasmid containing the recombinant gene from the Escherichia coli culture medium and transforming Agrobacterium tumefaciens; Step 3: Infect tobacco leaves with the successfully transformed Agrobacterium tumefaciens obtained in step 2 by injection; Step 4: extract total plant protein from the infected tobacco leaves, purify and dialyze to obtain recombinant immune protein, and then obtain plant-derived recombinant IL-37a protein.

3. The method for preparing the plant-derived recombinant IL-37a protein according to any one of claim 2, characterized in that: The plasmid containing the plant efficient expression vector in step 1 is the pJL-TRBO plasmid.

4. The method for preparing the plant-derived recombinant IL-37a protein according to claim 3, characterized in that: Step 2: The recombinant plasmid containing the recombinant gene is transformed into Agrobacterium tumefaciens using the freeze-thaw method.

5. The method for preparing the plant-derived recombinant IL-37a protein according to claim 4, characterized in that: Step 3 of the injection method is to inject OD 600 A 0.1-0.8% suspension of Agrobacterium tumefaciens was injected into tobacco leaves through the scratch wound on the lower epidermis of the leaves using a 1 mL syringe until the leaves became moist.

6. The method for preparing the plant-derived recombinant IL-37a protein according to claim 5, characterized in that: The purification described in step 4 is carried out by nickel column affinity chromatography, and the elution buffer used is PBS solution containing 20mM, 50mM, 80mM, 200mM, 300mM, and 500mM imidazole, pH 7.

4.

7. Use of the plant-derived recombinant IL-37a protein as claimed in claim 1 in the preparation of anti-inflammatory drugs.

8. The use of a plant-derived recombinant IL-37a protein in the preparation of an anti-inflammatory drug according to claim 7, characterized in that: The medicine is a medicine for treating psoriasis.

Images