Application of a single base mutation of bovine DDX58 gene in antiviral infection

Abstract

The invention discloses an application of a single base mutation of a bovine DDX58 gene in anti-viral infection, and belongs to the technical field of anti-viral infection prevention and treatment. The single base mutation of the bovine DDX58 gene provided by the invention can significantly affect the replication of RNA viruses and the expression of IFNBI. When the 858th amino acid of the DDX58 protein is asparagine, the expression of IFNBI is significantly increased, thereby inhibiting the replication of RNA viruses and improving the anti-viral ability; the site is highly linked to the anti-RNA virus infection ability; the single / base / amino acid mutation of the bovine DDX58 gene provided can be used as a linkage site for bovine resistance to RNA virus infection, and is used for the genotype breeding of anti-viral dairy cow varieties, thereby simplifying the breeding method and shortening the breeding time.

Description

Technical Field

[0001] The invention relates to the technical field of antiviral infection prevention and treatment, and in particular to an application of a single base mutation of a bovine DDX58 gene in antiviral infection. Background Art

[0002] Bovine parainfluenza, also known as bovine parainfluenza, is an acute, contact-transmitted respiratory infectious disease caused by bovine parainfluenza virus type 3 (BPIV3). BPIV3 belongs to the Paramyxoviridae family and the Paramyxovirus genus. It is a single-stranded negative-sense enveloped RNA virus that mainly infects the respiratory organs of cattle, causing a decrease in the body's immune function. The disease spreads rapidly and has a high incidence rate. Sick cattle often show clinical symptoms such as loss of appetite, runny nose, cough, fever, and dyspnea. It can also be mixed with other viruses to cause bovine respiratory disease complex (BRDC), which greatly increases the mortality rate of sick animals, seriously threatening the development of the world's cattle industry and causing huge economic losses to the world's cattle industry. Discovering antiviral gene editing sites in cattle and cultivating gene-edited antiviral cattle are becoming the main research directions for the prevention and control of cattle resistance to BPIV3 in the future.

[0003] Retinoic acid inducible gene I (RIG-I, also known as DDX58) can be activated by RNA viruses to undergo conformational changes, which in turn activates downstream signaling cascades, leading to the production of type I interferon. Type I interferon is the most important type of cytokine in the host's antiviral defense response, has a broad-spectrum antiviral effect, and can interfere with the infection and replication of bovine BPIV3 virus. Summary of the invention

[0004] The purpose of the present invention is to provide an application of a single base mutation of the bovine DDX58 gene in anti-viral infection, so as to provide a site closely linked to the antiviral ability of cattle, and to provide a gene editing site for the prevention and control of bovine BPIV3 and the breeding of antiviral cattle.

[0005] To achieve the above purpose, the present invention provides an application of a single base mutation of a bovine DDX58 gene in anti-viral infection, wherein the CDS sequence of the bovine DDX58 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2, and the single base mutation is located at the 11603839th nucleotide from the 5′ end of chromosome 8 of the bovine genome ARS-UCD1.2 version reference sequence.

[0006] Preferably, the single base mutation is a missense mutation, from G to A.

[0007] Preferably, the single base mutation results in a mutation in the 858th amino acid of the bovine DDX58 protein.

[0008] Preferably, the single base mutation causes a mutation at position 858 of the bovine DDX58 protein, from serine to asparagine.

[0009] Preferably, the application is application in affecting downstream type I interferon and RNA virus replication.

[0010] The invention discloses an application of a single amino acid change of a bovine DDX58 gene in anti-viral infection, wherein the single amino acid change is that the 858th amino acid of the bovine DDX58 protein is mutated from serine to asparagine.

[0011] The application of single base mutation and single amino acid mutation in the preparation of antiviral infection preparations as described above.

[0012] As mentioned above, single base mutations and single amino acid mutations are used in the breeding of cattle resistant to viral infection.

[0013] A vector comprising the above-mentioned single base mutation or single amino acid mutation.

[0014] The present invention provides a single nucleotide missense mutation of the bovine DDX58 gene that is highly correlated with the ability to resist bovine viral infection. This site corresponds to the 11603839th nucleotide from the 5′ end on chromosome 8 of the reference sequence of the bovine genome ARS-UCD1.2 version, which is G for ordinary cattle and A for zebu cattle (variant ID: rs378387550); this mutation is a missense mutation, and the corresponding encoded amino acid is located at the 858th position of the DDX58 protein; serine for ordinary cattle and asparagine for zebu cattle. The present invention finds that the mutation can affect the activity of the DDX58 protein through phosphorylation regulation, thereby affecting the activation of the downstream innate immune pathway of DDX58, causing differences in the expression of type I interferon, and affecting the antiviral ability of cattle.

[0015] Therefore, the application of a single base mutation of the bovine DDX58 gene provided by the present invention in anti-viral infection has the following specific technical effects:

[0016] (1) The single base mutation of the bovine DDX58 gene provided by the present invention can significantly affect the replication of RNA viruses and the expression of IFNBI. When the 858th amino acid of the DDX58 protein is asparagine, the expression of IFNBI is significantly increased, the replication of RNA viruses is inhibited, and the ability to resist RNA virus infection is improved. This site is highly linked to the ability to resist RNA virus infection;

[0017] (2) The single / base / amino acid mutation of the bovine DDX58 gene provided by the present invention can be used as a linkage site for bovine resistance to RNA virus infection, and can be used for genotype selection in breeding varieties resistant to RNA virus infection, thereby simplifying the breeding method and shortening the breeding time.

[0018] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0020] Figure 1 The mutation information of the mutation to be protected by the present invention in the Bovine Genome Variation Database (BGVD);

[0021] Figure 2 This is the analysis chart of the differentiation index among all SNP sites of the DDX58 gene of common cattle and zebu cattle;

[0022] Figure 3 It is the sequencing peak graph of the 2572nd base mutation of the bovine DDX58 gene in Example 3 of the present invention, wherein A is the sequencing peak graph of the pCMV-HA-DDX58-S858N vector, B is the sequencing peak graph of the pCMV-HA-DD X58-S858D vector, and C is the sequencing peak graph of the pCMV-HA-DDX58-S858A vector. The position marked with a red box in the figure is the mutation site;

[0023] Figure 4 is a fluorescent inverted microscope photograph of the lentivirus stably transfected cell line constructed in Example 4;

[0024] Figure 5 The statistical results of IFNB1 expression after the MAC-T cell line stably transfected with bovine DDX58 wild type and its mutants was infected with bovine BPIV3 virus in Example 5;

[0025] Figure 6 is the result of detecting the virus titer by TCID50 method in Example 6, wherein A is the result of infecting MAC-T cell line with bovine BPIV3 at 0.1 moi for 36 hours in Example 6, and B is the result of inoculating cells with F48E9 at 0.1 moi for 24 hours in Example 8;

[0026] Figure 7The wild-type bovine DDX58 and its mutants were transiently transfected into HeLa cells and expressed for 24 hours in Example 7. The cells were inoculated with the Newcastle disease virulent strain F48E9 at 0.1 moi and infected for 24 hours, and the expression levels of IFNB1 and its downstream factor IFIT2 were measured. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0028] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0029] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0030] Embodiment 1

[0031] It is known that the antiviral infection ability of zebu cattle is significantly stronger than that of ordinary cattle. The present invention discovered a potential key missense mutation in the bovine DDX58 gene (the gene sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2) with a high correlation with the antiviral infection ability of cattle in the bovine genome variation database (BGVD) (the mutation information obtained in the database is shown in Figure 1 ), this mutation corresponds to the 11603839th nucleotide from the 5′ end of chromosome 8 of the ARS-UCD1.2 version of the cattle genome reference sequence, which is G in common cattle and A in zebu cattle. This mutation is a missense mutation, and the corresponding encoded amino acid is located at position 858 of the DDX58 protein: serine in common cattle and asparagine in zebu cattle. The allele frequencies of all SNP sites of the DDX58 gene of common cattle and zebu cattle were obtained in BGVD and the differentiation index between populations was calculated (see Figure 2 ), the colored dots in the figure are SNP sites of missense mutations. It can be seen that S858N is the only highly selected missense mutation of the DDX58 gene in common cattle and zebu populations.

[0032] SEQ ID NO.1

[0033]

[0034] SEQ ID NO.2

[0035] MTAEQRRNLHAFRDYVRKILDPTYILSYMTPWFRDDVVQHIQAKKNNKGPMEAASLFLQVLLELQEEGWFRGFLDALQQAGYSGLYEAIESWDFQKLEKLEEYRLLLKRLQPEFKTTINPEDILPEISGCLLNQECEEIIQISSNKGLMAGAEKMVECLLRSDKENWPKTLKLALEKEESKFSELWMVEKGAENVQMKDLEDDEMKTLDVHIVYKEEPESQNLSQNSCSSEVPPTYSPLKPRNYQLELALPAQKGKNTIICAPTGCGKTFVSLLICEHHLKKFPQGRKGKVVVFAVQVPLYEQQKSVFSEYFERFGYKVSGISGETADNISVEQIVENNDIIILTPQILVNSLKDGTIPSLSIFTLMIFDECHNTNKHHPYNMIMFHYLDQKLGGSSDSLPQVIGLTASVGVGDAKNTAEATEYICKLCASLDTAVVTTVRDNLEELEEVVYKPQKFFRKVESRTTDRFKRIISQLMAETEALAKSIFEELGTVTLENLSRIQNRNFGTQKYEQWIIAVQKACMVFQMPDKEEESRICKALFLYTSHLRKYNDALIINEDARMKDALNYLKNFFKNVRAAGFDAIEQDLTQRFEEKLLELEGISMDPSNENAKLKDLCFILQEEYHLNPETRTILFVKTRALVDALKNWIEENPKLSFLKPGILTGRGRTNQTMGMTLPAQKCALDAFRTNRDSKILIATSVADEGIDIAQCNLVILYEYVGNVIKMIQTRGRGRARGSKCFLLTSNADVIEKEKLNICQEKMMNESISRLQGWNEAVFKEKIRQIQIQEKLIRDSQGKVKPVVDKKNKKLLCGKCKTFACYTADIRVVEECHFTVVRDAFRECFVTKLHPRPKKFGSFDKKAKIFCARKDCLHDWGIHMKYKTFEIPVIKIESFVVEDVATGAQTLYAKWKDFNFEKIPFDAAEMSPWAQDLNLQGVDGLE

[0036] Example 2

[0037] Construct the bovine bDDX58-WT vector as follows:

[0038] S2.1. Extraction of RNA from bovine lung tissue

[0039] (1) Place fresh fetal bovine lung tissue in a thermos bottle containing saline solution and send it to the laboratory within 4 hours. Disinfect it with 75% alcohol for 3-5 seconds and wash it three times with 37℃ saline solution.

[0040] (2) Place the tissue in a clean bench that has been sterilized with ultraviolet light in advance, take some of the lung tissue of the bovine fetus and put it into a 1.5 mL EP tube, transfer it into a sterilized mortar filled with liquid nitrogen (clean the mortar, dry it, pour in anhydrous ethanol and ignite it for sterilization, seal it with sterile aluminum foil immediately after the fire is extinguished, and start the experiment after it cools to room temperature). Mix the tissue and liquid nitrogen and grind it into powder. Transfer it into a 1.5 mL EP tube, add 1 mL of Trizol, shake and mix well, and let it stand at room temperature for 5 min.

[0041] (3) Add 200 μL of chloroform per tube and shake vigorously for 15 seconds. After the tube is fully emulsified, place it on ice for 5 minutes.

[0042] (4) Centrifuge at 4°C, 12,000 rpm / min for 15 min. Transfer 400 μL of the upper aqueous phase into a new RNase-free 1.5 mL EP tube.

[0043] (5) Add 400 μL of 4°C precooled isopropanol to each tube, invert 10 times, and place on ice for 10 min.

[0044] (6) Centrifuge at 4°C, 12,000 rpm / min for 10 min and discard the supernatant.

[0045] (7) Add 1 mL of 4°C precooled RNase-free 75% ethanol to each tube and gently pipette for 1 min.

[0046] (8) Centrifuge at 4°C, 7500 rpm / min for 5 min, discard the alcohol, and dry the RNA precipitate at room temperature.

[0047] (9) Add 20 μL of DEPC H2O to dissolve the RNA precipitate.

[0048] (10) Use a spectrophotometer to detect RNA concentration, and use electrophoresis to detect whether RNA is degraded; if 260 / 280 is between 1.8 and 2.0, it indicates no degradation.

[0049] S2.2. Reverse transcription of RNA obtained in step S1.1 into cDNA

[0050] (1) Using the system shown in Table 1, maintain at 42°C for 2 min to remove genomic DNA from RNA.

[0051] Table 1

[0052] Reagents volume <![CDATA[RNase-Free H2O]]> Up to 16 μL RNA 1 μg 4×gDNA wiper Mix 4μL

[0053] (2) Use a reverse transcription kit according to the attached instructions to reverse transcribe the RNA from which the genomic DNA has been removed into cDNA.

[0054] S2.3, using the obtained cDNA as a template for PCR amplification

[0055] The amplification template is the cDNA of bovine lung tissue obtained in step S2.2, the upstream primer sequence is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4. The reaction system is shown in Table 2, and the reaction conditions are shown in Table 3.

[0056] Table 2

[0057] Reagents Volume (unit: μL) cDNA 5μL pCMV-HA-bDDX58-WT-F (10 nM / μL) 1μL pCMV-HA-bDDX58-WT-R (10 nM / μL) 1μL dNTP Mixture 4μL <![CDATA[5X PrimeSTAR Buffer(Mg 2+ Plus)]]> 10μL PrimeSTAR HS DNA Polymerase(2.5U / μL) 0.5μL <![CDATA[ddH2O]]> Up to 50 μL

[0058] Table 3

[0059]

[0060] SEQ ID NO.3: GTCGACCATGACGGCAGAGCAGC

[0061] SEQ ID NO.4: GGTACCTCATTCAAGGCCATCC

[0062] S2.4. Recover and identify the amplified product obtained in step S2.3

[0063] (1) Use the PCR amplification product gel recovery kit to perform gel excision and recovery. Under UV irradiation of the gel imaging system, cut the target band gel within 40 seconds and transfer it into a 2 mL EP tube according to the instructions attached to the kit;

[0064] (2) Detect the concentration of the recovered product and use the enzyme digestion reaction system shown in Table 4 to perform double digestion of the pCMV-HA empty vector with SalⅠ and KpnI.

[0065] Enzyme digestion reaction procedure: incubate at 37°C for 1 hour in a PCR instrument, then perform agarose electrophoresis, use a kit to cut and recover the band of 2841 bp, and use a spectrophotometer to detect the DNA concentration after gel recovery.

[0066] Table 4

[0067] Reaction system Dosage pCMV-HA empty plasmid 2μg Sal1 1μL Kpn1 1μL 10× Enzyme Digestion Buffer 5μL <![CDATA[ddH2O]]> Make up to 50 μL

[0068] S2.5. Use a ligation kit to connect the target fragment obtained in step S2.4 to construct the pCMV-HA-bDDX58-WT vector. The ligation system is shown in Table 5. After ligation at 4°C overnight, transform into Escherichia coli, select monoclonal colonies after ampicillin screening, extract the plasmid and send it to the company for sequencing. After sequencing is correct, it will be retained.

[0069] Table 5

[0070]

[0071]

[0072] Embodiment 3

[0073] The zebu mutant pCMV-HA-DDX58-S858N vector of the 858 locus of the bovine DDX58 gene, as well as the constitutively phosphorylated mutant pCMV-HA-DDX58-S858D vector and the constitutively non-phosphorylated mutant pCMV-HA-DDX58-S858A vector were constructed as follows:

[0074] S3.1. Primer design

[0075] Taking the construction of the zebu mutant pCMV-HA-DDX58-S858N vector of the 858 site of the bovine DDX58 gene as an example, according to the CDS sequence of the bovine DDX58 protein reported by NCBI and the steps of overlap extension PCR, primers need to be designed. First, primers at both ends of the full-length CDS region of bovine DDX58 are required, which are pCMV-HA-bDDX58-WT-F and pCMV-HA-bDDX58-WT-R (sequence shown in S1.3). Then, two complementary primers are designed according to the location of the mutation site, and the mutation site is ensured to be between the two primers. The two primers are named pCMV-HA-bDDX58-S858N-F (sequence shown in SEQ ID NO.5) and pCMV-HA-bDDX58-S858N-R (sequence shown in SEQ ID NO.6).

[0076] SEQ ID NO.5: GACCGAAGAAGTTTGGGAATTTTGACAAGAAAGCTAA

[0077] SEQ ID NO.6: TTAGCTTCTTGTCAAAATTCCCAAACTTCTTCGGTC

[0078] The primer sequences designed for the constitutive phosphorylation mutant pCMV-HA-DDX58-S858D vector and the constitutive non-phosphorylation mutant pCMV-HA-DDX58-S858A vector according to the mutation sites are as follows:

[0079] pCMV-HA-bDDX58-S858D-F (sequence shown in SEQ ID NO.7),

[0080] pCMV-HA-bDDX58-S858D-R (sequence shown in SEQ ID NO.8),

[0081] pCMV-HA-bDDX58-S858A-F (sequence shown in SEQ ID NO.9),

[0082] pCMV-HA-bDDX58-S858A-R (the sequence is shown in SEQ ID NO. 10).

[0083] SEQ ID NO.7: GACCGAAGAAGTTTGGGGATTTTGACAAGAAAGCTAA

[0084] SEQ ID NO.8: TTAGCTTCTTGTCAAAATCCCCAAACTTCTTCGGTC

[0085] SEQ ID NO.9: GACCGAAGAAGTTTGGGGCTTTTGACAAGAAAGCTAA

[0086] SEQ ID NO.10: TTAGCTTCTTGTCAAAAGCCCCAAACTTCTTCGGTC

[0087] S3.2. Plasmid extraction and site mutation using overlap extension PCR

[0088] Taking the construction of the zebu mutant pCMV-HA-DDX58-S858N vector of the 858 site of the bovine DDX58 gene as an example, PCR was performed using the pCMV-HA-bDDX58-WT vector constructed in S2.5 as a template to amplify the bDDX58-S858N gene fragments P1 and P2. The amplification system and reaction conditions were the same as step S2.3 of Example 2.

[0089] The bDDX58-S858N gene fragment p1 was amplified by primers pCMV-HA-bDDX58-WT-F and pCMV-HA-bDDX58-S858N-R, and the fragment p2 was amplified by primers pCMV-HA-bDDX58-S858N-F and pCMV-HA-bDDX58-WT-R. After the amplification, agarose gel electrophoresis was performed, and the p1 and p2 fragments with fragment lengths of 2598bp and 281bp were gel-recovered using a kit. Both p1 and p2 fragments contain mutation sites. Then, the upstream primer pCMV-HA-bDDX58-WT-F of the p1 fragment and the downstream primer pCMV-HA-bDDX58-WT-R of the 2 fragments were used as PCR primers, and the bDDX58-S858N fragment was amplified using the p1 and p2 fragments as substrates. During amplification, 60 ng of fragment P1 and 20 ng of fragment P2 were added, and the rest of the amplification system and reaction conditions were the same as S2.3. After amplification, agarose gel electrophoresis was performed, and the bDDX58-S858N fragment with a length of 2841 bp was recovered by gel using a kit, and base A was added to the end.

[0090] S3.3. pMD-19T cloning of target gene

[0091] The purified PCR product with base A added to the end was connected to the T vector, and the connection system is shown in Table 6. Then it was transformed into Escherichia coli, and a single clone was selected by ampicillin screening and expanded in LB culture medium supplemented with ampicillin.

[0092] Table 6

[0093] Reaction system Volume (μL) T Vector pMD 19(Simple) 0.5μL DNA Ligation Kit 5μL <![CDATA[bDDX58-S858N Snippet ]]> 4.5μL

[0094] S3.4. Sequencing and comparison analysis of mutation sites

[0095] Take the fresh bacterial liquid within 7 hours, centrifuge it at 1000g for 5 minutes, discard the supernatant, and extract the plasmid according to the instructions of SanPrep column-based plasmid DNA small-scale extraction kit. The detection concentration is ≥100ng / μL, and send it to the company for sequencing. The sequencing results are analyzed by SnapGene for sequencing peaks and sequence alignment.

[0096] The construction methods of the constitutive phosphorylation mutant pCMV-HA-DDX58-S858D vector and the constitutive non-phosphorylation mutant pCMV-HA-DDX58-S858A vector are the same as above. Figure 3As shown in the figure, it shows that in the pCMV-HA-DDX58-S858N vector, the base G mutated to A, the codon AGT mutated to AAT, and the corresponding amino acid mutated from S to N; in the pCMV-HA-DDX58-S858D vector, the base AG mutated to GA, the codon AGT mutated to GAT, and the corresponding amino acid mutated from S to D; in the pCMV-HA-DDX58-S858A vector, the base AG mutated to GC, the codon AGT mutated to GCT, and the corresponding amino acid mutated from S to A, indicating that the recombinant plasmid was successfully constructed.

[0097] S3.5. Construction of eukaryotic expression vector of bovine DDX58 mutant with HA tag

[0098] At the same time, the target fragment and expression vector pCMV-HA were digested with SalⅠ and KpnI. The digestion system and reaction conditions are shown in S2.4. After agarose gel electrophoresis, the target fragment was cut and recovered, and ligated. The ligation system was the same as S2.5 and placed in a 4℃ refrigerator for 16h. The ligation product was transformed into DH5α Escherichia coli. After plating, picking single clones and shaking the bacteria, the plasmid was extracted and sent to the company for sequencing. If the sequencing result was correct, the culture was expanded and the endotoxin-free plasmid was extracted and stored at -20℃.

[0099] Embodiment 4

[0100] The bovine mammary epithelial cell (MAC-T) cell line stably expressing the mutants of the bovine DDX58 protein at site 858 was constructed by lentiviral infection. The specific steps are as follows:

[0101] (1) Construction and preparation of plasmids related to lentivirus packaging: Using the pCMV-HA-DDX58 vector constructed above as a template, the bovine DDX58 gene with HA tag and each mutant were connected to the pCDH-CMV-MCS-EF1-copGFP-T2A-Puro vector, named pCDH-copGFP-HA-DDX58-WT, pCDH-copGFP-HA-DDX58-S858N, pCDH-copGFP-HA-DDX58-S858D, and pCDH-copGFP-HA-DDX58-S858A. At the same time, the purchased auxiliary plasmids for lentivirus packaging: psPAX2 and pMD2.G were mixed according to the system shown in Table 7 (the mass ratio was approximately the reciprocal of the plasmid base comparison), with a total amount of 8 μg.

[0102] (2) Cell plating and transfection: 293T cells were cultured in a 5 mL T25 culture flask, subcultured the day before, and transfected when the confluence reached 70% on the same day.

[0103] The transfection reagent is PEI, and the transfection system is as shown in Table 7. Replace with 5 mL of serum-free DMEM for 3 h before transfection. Mix the transfection system in the table below and let it stand at room temperature for 15 min, then add it to 293T cells and collect the supernatant after transfection at 37°C for 72 h.

[0104] Table 7

[0105]

[0106] (3) Virus collection:

[0107] During the virus attack, the cell supernatant in the T25 culture flask was aspirated with a 10 mL syringe, and then filtered into a 15 mL centrifuge tube with a 0.45 μm filter (to filter out cell debris), and the packaged lentivirus was frozen in a -80°C refrigerator.

[0108] (4) Lentiviral infection process

[0109] First, the minimum lethal concentration of target cell screening drugs was identified. Puromycin was added to blank MAC-T cells at concentrations of 1, 3, 5, 7, and 10 μg / mL and cultured for 48 hours. The minimum lethal concentration of MAC-T cells was screened to be 3 μg / mL.

[0110] MAC-T cells were plated in a six-well plate in advance, and lentivirus infection was performed when the cell confluence reached 80%. The lentivirus collected in step (3) was taken out from the -80°C refrigerator and dissolved in an ice bath. The lentivirus was mixed with 10% complete cell culture medium at a volume ratio of 1:1 and added to the six-well plate. After 24 hours, 3 μg / mL Puromycin was added. New culture medium containing 3 μg / mL Puromycin was replaced every day. The screening was repeated for 4-5 days. After the cells were fully grown, the cells were passaged and observed under a fluorescent inverted microscope. The results were as follows: Figure 4 As shown, the bovine DDX58-WT and its mutant stable transfection cell lines screened by Puromycin all emitted green fluorescence, proving that the lentiviral stable transfection cell line was successfully constructed.

[0111] Embodiment 5

[0112] The effects of common bovine DDX58 and three mutants on the expression of type I interferon (IFNB1) were investigated by infecting bovine BPIV3 virus. The specific steps are as follows:

[0113] S5.1. Bovine BPIV3 virus expansion and infection sampling

[0114] The original bovine BPIV3 virus was obtained from the research group of Yang Zengqi from Northwest Agriculture and Forestry University. The bovine MDBK cell line was plated one day in advance, and the original virus was inoculated when the cell confluence reached 80%. After 48 hours of infection, the cell culture supernatant was collected and the virus titer was detected by TCID50 method. The virus titer was 1.99×10 9 pfu / mL.

[0115] S5.2. Virus infection steps

[0116] (1) Cell plating: The stably transfected MAC-T cell line constructed in Example 3 was plated into a 12-well plate one day before the challenge. The next day, the cells were challenged when the confluence reached 90%.

[0117] (2) Virus attack step: The bovine BPIV3 virus collected in the virus expansion step was taken out of the -80°C refrigerator in advance and thawed in an ice bath. After thawing, the cells were infected at an MOI of 0.1. The number of cells was counted by a hemocytometer and 4×10 5 / well, then the virus solution required for each well of cells is 0.02μL / well. Mix the serum-free DMEM culture medium with the virus solution and add it to the cell culture dish and incubate at 37℃ for 1 hour. During the incubation period, take out the cells and shake them once every 15 minutes. After incubation, wash them with PBS and add 2% DMEM to continue culturing until 36 hours before collecting samples.

[0118] (3) Sample collection step: Collect the cell culture medium into a 1.5 mL centrifuge tube and freeze at -80°C. Wash the cells three times with PBS and add 1 mL of TRIZOL to the cells. Lyse the cells at room temperature for 5 min and transfer the lysate to an RNase-free 1.5 mL tube.

[0119] Add 200 μL of chloroform and shake vigorously for 10 seconds, then let stand at room temperature for 2 minutes. Centrifuge at 12000g and 4°C for 15 minutes to separate the solution into layers. The upper layer is the aqueous phase, the middle layer is the DNA, and the lower layer is the organic phase. Carefully transfer 400 μL of the upper aqueous phase to a new RNase-free 1.5 mL EP tube.

[0120] After adding 400 μL of isopropanol and 1 μL of glycogen, mix by inversion. Place at 4°C to precipitate RNA for 1 hour, centrifuge at 4°C and 12000g for 10 minutes. Discard the supernatant, wash with 75% ethanol prepared with DEPC, centrifuge to remove ethanol after washing, dry at room temperature until the white precipitate just turns transparent, add 20 μL of DEPC water, dissolve to obtain RNA solution, test the concentration, and store at -80°C.

[0121] (4) Detection of IFNB1 expression

[0122] Take the RNA solution obtained in step (3), use the kit to perform reverse transcription according to the attached instructions, and use the product diluted 16 times as a template, and use the kit to perform quantitative PCR (qPCR) according to the attached instructions. The qPCR program is: 95℃30s, 95℃5s, 60℃30s, after 35 cycles, obtain the amplification curve and CT value, and use 2 -ΔΔCt The expression changes of IFNB1 and its downstream factor IFIT2 relative to GAPDH were compared by Figure 5 As shown, A is the expression of IFNB1 in MAC-T cell lines stably transfected with bovine DDX58 gene and its mutants under BPIV3 virus infection, and B is the expression of IFIT2. As can be seen from the figure, after the 858 site of bovine DDX58 protein mutated from S to N, the expression levels of IFNB1 and IFIT2 increased significantly. At the same time, when the phosphorylation mutation D at the 858 site of bovine DDX58 protein mutated into the non-phosphorylation mutation A, the expression level of IFNB1 also increased significantly. This shows that the bovine DDX58 protein S858N mutation regulates the activity of DDX58 through phosphorylation, thereby increasing the expression of IFNB1.

[0123] Embodiment 6

[0124] The effects of the common bovine DDX58 vector and three mutants on the replication of bovine BPIV3 virus were investigated. The specific steps are as follows:

[0125] (1) The cell culture supernatant collected in step (3) of Example 5 was diluted ten-fold in series.

[0126] (2) The diluted cell culture supernatant was inoculated into a 96-well culture plate, with 8 replicates per well for each gradient.

[0127] (3) The confluent MAC-T cells were digested with trypsin and dispersed into a single cell suspension.

[0128] (4) Add 100 μL of cell suspension to each well to increase the cell volume to 2 to 3 × 10 5 Pieces / mL.

[0129] (5) Normal cells not infected with the virus were used as controls.

[0130] (6) Observe and record the cell fusion status daily for 7 consecutive days.

[0131] (7) Calculate the virus titer (TCID50) according to the Karber method.

[0132] The results are as follows Figure 6As shown in A, when the 858th amino acid of the bovine DDX58 protein mutated from S to N, the BPIV3 virus titer was significantly reduced, indicating that the S858N mutation of the bovine DDX58 protein can inhibit viral replication by affecting the expression of IFNB1.

[0133] Embodiment 7

[0134] The effects of the common bovine DDX58 vector and three mutants constructed in Examples 2 and 3 on the expression of type I interferon (IFNB1) under Newcastle disease virus (F48E9 virus) infection were investigated. The specific steps are as follows:

[0135] S7.1. Expanding the F48E9 virus

[0136] The F48E9 virus was derived from the Xiao Sa research group at Northwest Agriculture and Forestry University. Fresh 9-day-old chicken embryos were used to expand the virus. The chicken embryos were placed in a 37°C incubator before the experiment. The specific steps are as follows:

[0137] (1) Prepare a punch needle (can be replaced by scissors), wax block, iodine cotton, egg lamp, syringe, and dilute the original poison 1000 to 10000 times.

[0138] Before inoculation, place the egg with the big end facing up, use an egg lamp to find the location of the air chamber and mark it, and mark and punch holes on the opposite side of the embryo's head and 0.5 cm above the air chamber. After the embryo is placed in the biosafety cabinet, disinfect all the air chambers with iodine cotton and then deiodinate with alcohol, then use scissors or a hole puncher to punch holes at the marked locations, and do not use too much force to avoid breaking the eggshell.

[0139] (2) Use a 1mL syringe to inhale the diluted virus, insert the syringe vertically into the hole on the eggshell, be careful not to pierce the chicken embryo, push the syringe to inject the virus into the allantoic cavity of the chicken embryo, and the virus inoculation volume is 0.1mL. After the inoculation is completed, burn the wax block on an alcohol lamp to seal the hole on the eggshell, and then place the chicken embryo in a 37℃ constant temperature box for incubation.

[0140] (3) Observe every 12 hours after infection. If the chicken embryo dies within 24 hours, it may be caused by being pricked by the needle when infected. Discard it. If it is not dead within 24 hours, collect the poison after 3 days.

[0141] When collecting the virus, the chicken embryo wax seal was opened and the allantoic fluid was drawn with a syringe. After filtering through a 0.25 μm filter, the virus titer was measured by the TCID50 method and was 1.1×10 7 pfu / mL, and then stored at -80°C. During storage, different eggs were collected and the virus titer was measured.

[0142] S7.2. Virus infection and sample collection

[0143] (1) Cell plating: Human cervical cancer cell line (HELA cells) was used for the challenge experiment, and the cell culture was carried out using a 12-well plate 1 mL culture system. The wild-type and mutant vectors constructed in Examples 2 to 3 were transfected into HELA cells and challenged 24 hours later.

[0144] (2) Virus challenge: The venom obtained in the virus expansion step was taken out in advance at -80°C, dissolved and infected with cells at an MOI of 0.1. The number of cells was counted by a hemocytometer and was 1.3×10 5 / well, then the virus solution required for each well of cells is 1.2μL / well. Mix the serum-free DMEM culture medium with the virus solution and add it to the cell culture dish and incubate at 37℃ for 1 hour. During the incubation period, take out the cells and shake them once every 15 minutes. After incubation, wash them with PBS and add 2% DMEM to continue culturing until 24 hours before collecting samples.

[0145] (3) Virus collection: Collect the supernatant of cell culture into a 1.5 mL centrifuge tube and freeze at -80°C. Wash the cells three times with PBS, add 1 mL of TRIZOL to the cells, lyse at room temperature for 5 min, and transfer the lysate to an RNase-free 1.5 mL EP tube. The method for extracting RNA and investigating the expression of IFNB1 is exactly the same as in Example 4. The results are shown in Figure 7 shown.

[0146] Depend on Figure 7 As can be seen from A and B, the zebu mutation at site 858 of the bovine DDX58 protein leads to increased expression of IFNB1 and IFIT2 in cells, and the non-phosphorylation mutation SA also increases the expression of IFNB1 and IFIT2 in cells compared with the phosphorylation mutation SD. These results indicate that the zebu mutation at site 858 of the bovine DDX58 protein and the phosphorylation degree of this site can affect the expression of type I interferon, thereby affecting the antiviral ability of cells.

[0147] Embodiment 8

[0148] The effects of the common bovine DDX58 vectors and three mutants constructed in Examples 2 and 3 on the replication of the F48E9 virus were investigated. The specific steps were exactly the same as those in Example 6. The results were as follows: Figure 6 As shown in B, when the 858th amino acid of the bovine DDX58 protein mutated from S to N, the F48E9 virus titer was significantly reduced, indicating that the S858N mutation of the bovine DDX58 protein can inhibit viral replication by affecting the expression of IFNB1.

[0149] Therefore, the single base mutation of the bovine DDX58 gene provided by the present invention can significantly inhibit the replication of RNA viruses and the expression of IFNBI. When the 858th amino acid of the DDX58 protein is asparagine, the expression level of IFNBI is significantly increased, thereby inhibiting the replication of RNA viruses. This site is highly linked to the ability to resist RNA virus infection. The single / base / amino acid mutation of the bovine DDX58 gene provided can be used as a linkage site for bovine resistance to RNA virus infection, and can be used for genotype selection in breeding varieties resistant to RNA virus infection, thereby simplifying the breeding method and shortening the breeding time.

[0150] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Use of a single base mutation reagent of bovine DDX58 gene in the preparation of an antiviral infection preparation, characterized in that: The CDS sequence of the bovine DDX58 gene is shown as SEQ ID NO.1, and the encoded amino acid sequence is shown as SEQ ID NO.

2. The single base mutation is located at the 11603839th nucleotide from the 5′ end of chromosome 8 of the bovine genome ARS-UCD1.2 version reference sequence; the single base mutation is a missense mutation, from G to A; the single base mutation causes a mutation in the 858th amino acid of the bovine DDX58 protein, from serine to asparagine; the reagent is an overlapping extension PCR primer; and the virus is bovine parainfluenza virus type 3 and Newcastle disease virus.

2. Application of a single base mutation of the bovine DDX58 gene in the breeding of bovine varieties resistant to viral infection, characterized in that: The CDS sequence of the bovine DDX58 gene is shown as SEQ ID NO.1, and the encoded amino acid sequence is shown as SEQ ID NO.

2. The single base mutation is located at the 11603839th nucleotide from the 5′ end of chromosome 8 of the ARS-UCD1.2 version reference sequence of the bovine genome; the single base mutation is a missense mutation, from G to A; the single base mutation causes a mutation in the 858th amino acid of the bovine DDX58 protein, from serine to asparagine; and the viruses are bovine parainfluenza virus type 3 and Newcastle disease virus.

Images