Use of gmstart protein to increase soybean protein content and soybean oil content

By using recombinant vectors of GmSTART protein and gene and the CRISPR/Cas9 system, the problem of regulating protein and oil content in soybeans and Arabidopsis thaliana was solved, resulting in increased protein and oil content, enhanced plant height and yield, and optimized plant quality.

CN118879771BActive Publication Date: 2026-04-21NORTHEAST AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411262887.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-10
Publication Date
2026-04-21
Estimated Expiration
2044-09-10

AI Technical Summary

Technical Problem

Existing technologies struggle to effectively regulate the protein and oil content in soybeans and Arabidopsis thaliana, and there are challenges in improving one while keeping the other unchanged. In particular, soybean genetic research is limited by multiple copies of genes and genetic redundancy, making variety improvement difficult.

Method used

By introducing GmSTART protein and gene, and using recombinant vectors and the CRISPR/Cas9 system for gene editing, the protein and oil content in soybeans and Arabidopsis thaliana can be regulated. This includes overexpression and the construction of mutants to increase protein and oil content, which are then transformed into plants via Agrobacterium.

Benefits of technology

It significantly increased the protein and oil content of soybeans and Arabidopsis thaliana, increased plant height and yield, optimized agronomic traits, achieved multiple effects, and enhanced plant quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118879771B_ABST
    Figure CN118879771B_ABST
Patent Text Reader

Abstract

This invention discloses the application of GmSTART protein in increasing the protein and oil content of soybeans, belonging to the field of plant breeding technology. To improve the quality, yield, and plant height of soybeans and Arabidopsis thaliana, this invention provides the application of GmSTART protein in increasing the protein content, oil content, total fat content, yield, and / or plant height of soybeans or Arabidopsis thaliana. This provides more options for breeding soybeans with high oil and high protein content.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant breeding technology, specifically relating to the application of GmSTART protein in increasing the protein content and oil content of soybeans. Background Technology

[0002] With the increasing global demand for high-quality soybean products, improving soybean quality is becoming increasingly important. Mature soybean grains contain approximately 40% protein and about 20% oil by dry weight. Soybean protein is characterized by excellent gelation properties and low cost, making it a viable plant-based meat substitute. Soybeans are rich in nutrients, and today's consumers are no longer solely focused on eating enough, but also on eating well. Therefore, variety improvement is crucial, and enhancing soybean quality is paramount. However, the regulation of protein and oil content is controlled by multiple genes and influenced by environmental factors; it is a quantitative trait, thus posing a greater challenge to variety improvement. Furthermore, soybean protein and oil content exhibit a negative correlation, making it extremely challenging to improve one while maintaining the other in terms of germplasm resources.

[0003] Soybean production in my country requires more effective improvement methods. Because soybeans are an ancient tetraploid crop with multiple copies of their genes, they are subject to genetic redundancy limitations. Therefore, compared to other model plant species, positive genetic research results for soybeans are limited. There is an urgent need to increase soybean protein content and cultivate soybean varieties with high protein, high oil, and high yield to meet people's daily needs.

[0004] As a model organism, Arabidopsis thaliana urgently needs to increase its protein content and develop varieties with high protein, high oil, and high yield. Summary of the Invention

[0005] The purpose of this invention is to improve the quality, yield, and plant height of soybeans and Arabidopsis thaliana.

[0006] This invention provides the application of GmSTART protein in increasing the protein content, oil content, total fat content, or yield of soybeans or Arabidopsis thaliana. The sequence of GmSTART protein is shown in SEQ ID NO.4.

[0007] This invention provides an application of the GmSTART gene in increasing the protein content, oil content, total fat content, or yield of soybeans or Arabidopsis thaliana. The sequence of the GmSTART gene is shown in SEQ ID NO.3.

[0008] This invention provides the application of a recombinant vector containing the GmSTART gene in increasing the protein content, oil content, total fat content, or yield of soybeans or Arabidopsis thaliana. The sequence of the GmSTART gene is shown in SEQ ID NO.3.

[0009] Further specifying, the starting vector for the recombinant vector is either the pGES401 vector or the pSOY1 vector.

[0010] This invention provides the application of recombinant microbial cells containing the GmSTART gene in increasing the protein content, oil content, total fat content, or yield of soybeans or Arabidopsis thaliana. The sequence of the GmSTART gene is shown in SEQ ID NO.3.

[0011] To further specify, the recombinant microbial cells are eukaryotic or prokaryotic microbial cells.

[0012] This invention provides an application of soybean containing a mutant GmSTART gene in improving the height of soybean or Arabidopsis thaliana plants. The sequence of the mutant GmSTART gene is shown in SEQ ID NO.12.

[0013] This invention provides the application of soybeans or Arabidopsis thaliana containing the GmSTART gene overexpression in increasing the protein content, oil content, or total fat content of soybeans or Arabidopsis thaliana. The sequence of the GmSTART gene is shown in SEQ ID NO.3.

[0014] This invention provides a method for increasing the protein content, oil content, total fat content, or yield of soybeans or Arabidopsis thaliana, wherein the steps of the method are as follows:

[0015] (1) The amplified gene sequence shown in SEQ ID NO.3 is inserted into an overexpression vector;

[0016] (2) The vector obtained in step (1) is introduced into Agrobacterium, and Agrobacterium is used to transfer it into soybean or Arabidopsis to obtain transgenic soybean or Arabidopsis;

[0017] (3) Identification steps (2) The transgenic soybeans obtained are positive transgenic soybeans or Arabidopsis thaliana.

[0018] This invention provides a method for increasing the plant height of soybean or Arabidopsis thaliana, the steps of which are as follows:

[0019] (1) The amplified sgRNA sequence is inserted into a vector; the sgRNA sequence is shown in SEQ ID NO.9 and SEQ ID NO.10;

[0020] (2) The vector obtained in step (1) is introduced into Agrobacterium, and Agrobacterium is used to transfer it into soybeans to obtain transgenic soybeans or Arabidopsis thaliana;

[0021] (3) Identification steps (2) The transgenic soybeans obtained are positive transgenic soybeans or Arabidopsis thaliana.

[0022] Beneficial effects: GmSTART The mutant strain exhibits pleiotropic effects on protein and oil content. Analysis of protein content, fatty acid content, and its components revealed that, compared to the control group, GmSTART The mutant had a 1.67% reduction in protein content and a significant 4.9% reduction in total fat content. The T3 generation mutant plants had a 2.4% reduction in grain length, a 6.4% reduction in grain width, a 29.9% increase in plant height, an 11.4% increase in the number of nodes, an average reduction of 1-2 branches, and a 13.8% reduction in 100-grain weight.

[0023] Overexpression of GmSTART had pleiotropic effects on protein and oil content. Protein content analysis revealed that compared to the control group, the protein content of START-OE1 and START-OE2 increased by 4.6% and 3.3%, respectively; the total fatty acid content of START-OE1 increased by 4.2%, and that of START-OE2 increased by 1.2%; the grain length and width of GmSTART-OE1-overexpressing plants were significantly increased compared to WT, with START-OE1 and START-OE2 grain length increasing by 2.9% and 1.1%, respectively, and grain width increasing by 1.6% and 5.0%, respectively. Plant height, number of branches, number of pods per plant, number of grains per plant, and grain weight per plant significantly decreased by 10.6%, 20.8%, 36.3%, 39.4%, and 35.9%, respectively; the 100-grain weight significantly increased by 8.41%; the number of nodes had no significant effect. Attached Figure Description

[0024] Figure 1 To GmSTART A graph showing the results of gene tissue-specific expression analysis; the horizontal axis represents tissue, and the vertical axis represents expression level.

[0025] Figure 2 for GmSTART Image of gene PCR amplification product results; M: Trans 2K DNA molecular weight standard; 1-5: PCR amplification results;

[0026] Figure 3 for GmSTARTFigure 1 shows the PCR detection results of bacterial culture constructed with gene vectors; A represents the detection results of the entry vector; B represents the detection results of the expression vector; M: Trans 2K DNA molecular weight standard; 1-6: PCR amplification results;

[0027] Figure 4 The image shows the PCR detection results of overexpressing soybean plants; M: Trans 2K DNA molecular weight standard; 1-2: Recipient DN50; 3-8: Transgenic plants;

[0028] Figure 5 Image showing qRT-PCR identification of overexpressing soybean plants;

[0029] Figure 6 Figure 1 shows the PCR amplification results for the SgRNA target; M: DL2K Plus DNA molecular weight standard; 2-8: PCR amplification results; 1: water;

[0030] Figure 7 Figure 1 shows the PCR amplification results of pGES401-NFS1 plasmid transformed into E. coli; M: DL2K Plus DNA molecular weight standard; 1-10: PCR amplification results;

[0031] Figure 8 Figure 1 shows the PCR amplification results of pGES401-NFS1 plasmid transformed into EHA105; M: DL2K Plus DNA molecular weight standard; 1-4: PCR amplification results;

[0032] Figure 9 For the CRISPR / Cas9 system GmSTART Figure showing the construction results of gene knockout mutants;

[0033] Figure 10 It is a conservative structural domain of AT1G0523;

[0034] Figure 11 The image shows the PCR identification results of homozygous Arabidopsis mutants; M: Trans 2K DNA molecular weight standard; 1-10: PCR amplification results; H2O: water; WT: wild-type Col-0; SALK_127828.4700.X: Arabidopsis mutant;

[0035] Figure 12 Image showing the screening results of transgenic Arabidopsis thaliana Basta;

[0036] Figure 13Figure 1 shows the identification results of transgenic Arabidopsis thaliana; A: PCR of the Bar gene in transgenic Arabidopsis thaliana; B: PCR of the GmSTART gene in transgenic Arabidopsis thaliana, M: Trans 2K DNA molecular weight standard; 1-7: PCR amplification results, WT: wild-type Col-0; 2-4: PCR detection of Arabidopsis thaliana overexpression plants; 5-7: PCR detection of Arabidopsis thaliana mutant replacement plants; C: Bar test strip detection;

[0037] Figure 14 The image shows the qRT-PCR identification results of transgenic Arabidopsis thaliana.

[0038] Figure 15 Figure 1 shows the phenotypic identification results of transgenic Arabidopsis thaliana; * indicates a significant difference compared with WT (*, 0.05>P≥0.01 and **, P<0.01); where A is the result of fatty acid content in transgenic Arabidopsis thaliana; B is the result of total nitrogen content in transgenic Arabidopsis thaliana.

[0039] Figure 16 Figure 1 shows the agronomic trait analysis results of T3 mutant soybean plants; where a is the plant height of T3 mutant soybean plants; b is the 100-seed weight of T3 mutant soybean plants; c is the number of seeds per plant of T3 mutant soybean plants; d is the seed weight per plant of T3 mutant soybean plants; e is the number of nodes of T3 mutant soybean plants; f is the branching of T3 mutant soybean plants; g is the seed weight per plant of T3 mutant soybean plants; and h is the plant height phenotype of T3 mutant soybean plants.

[0040] Figure 17 Figures show the agronomic trait analysis results of T4 mutant soybean plants; where a represents the plant height of T4 mutant soybean plants; b represents the 100-seed weight of T4 mutant soybean plants; c represents the number of seeds per plant of T4 mutant soybean plants; d represents the seed weight per plant of T4 mutant soybean plants; e represents the number of nodes of T4 mutant soybean plants; f represents the branching of T4 mutant soybean plants; g represents the seed weight per plant of T4 mutant soybean plants; h represents the plant height phenotype of T4 mutant soybean plants; i represents the seed length of T4 mutant soybean plants; and j represents the seed width of T4 mutant soybean plants.

[0041] Figure 18Figures show the agronomic traits of T3-overexpressing soybean plants. Specifically, a) shows the plant height of T3-overexpressing soybean plants; b) shows the weight per 100 seeds of T3-overexpressing soybean plants; c) shows the number of seeds per plant of T3-overexpressing soybean plants; d) shows the seed weight per plant of T3-overexpressing soybean plants; e) shows the number of nodes of T3-overexpressing soybean plants; f) shows the branching of T3-overexpressing soybean plants; g) shows the seed weight per plant of T3-overexpressing soybean plants; h) shows the plant height phenotype of T3-overexpressing soybean plants; i) shows the seed length of T3-overexpressing soybean plants; and j) shows the seed width of T3-overexpressing soybean plants.

[0042] Figure 19 for GmSTART Figure showing the analysis results of oil and protein content in mutant seeds; where 'a' is... GmSTART Figure 1 shows the results of the seed oil content analysis of the mutant; b is... GmSTART Figure showing the results of protein content analysis in mutant seeds;

[0043] Figure 20 for GmSTART The results of the analysis of oil and protein content in overexpressed seeds are shown in the figure; where 'a' is... GmSTART The results of the analysis of seed oil content by overexpression are shown in Figure b; GmSTART Figure showing the results of protein content analysis in overexpressed seeds;

[0044] Figure 21 This is a transmission electron microscope image of soybean seed development. Detailed Implementation

[0045] Example 1. Soybeans GmSTART Gene expression patterns

[0046] GmSTART Analysis of gene tissue specificity and dinopil expression levels at different developmental stages: The qRT-PCR reaction system and procedure are shown in Table 1. After the reaction, the average of the three replicates was taken, and the difference was calculated. The 2-1 of the difference was then calculated. ΔCt .

[0047] Table 1 qRT-PCR reaction system and procedure

[0048]

[0049] qRT-PCR primers:

[0050] QRT-START-F: AGTTGCACCGATTCAACAGGC (SEQ ID NO.1);

[0051] QRT-START-R: CCATGCGATGTGGTTCCATCT (SEQ ID NO.2);

[0052] RNA was extracted from 14 organs (roots, stems, leaves, flowers, pods, and seeds) of *Sui Nong* and reverse transcribed into cDNA. The cDNA was then identified by qRT-PCR. Figure 1 ) ,GmSTART It is expressed in all tissues and organs, with extremely low expression in roots, relatively high expression in stems, leaves, and flowers, even higher expression in pods, and the highest expression in seeds, reaching a relative multiple of more than 5 times.

[0053] Example 2. Construction of soybean overexpression GmSTART Gene carrier

[0054] 1. GmSTART Gene cloning

[0055] Retrieved from the phytozome database GmSTART A 2190 bp full-length CDS sequence was used as a template. CDS primers were designed at both ends of the CDS sequence of this gene (excluding terminators). Enzyme restriction sites in the gene sequence were avoided, and a pair of primers with restriction sites (SpeI and BamHI) from the entry vector were selected. The gene was first cloned using SN14 leaf cDNA as a template using the CDS primers. GmSTART The CDS sequence of the gene is obtained, and then this product is used as a template for PCR with primers containing restriction enzyme sites to obtain a gene with restriction enzyme sites at both ends. GmSTART Gene products. Gene products containing restriction enzyme sites were recovered using a gel extraction kit, and the results are as follows: Figure 2 The target band shown is correct and can be saved for subsequent experiments.

[0056] GmSTART

[0057] GmSTART Protein (SEQ ID NO.4):

[0058] MFQPNLMDALEMGQNTPESEIPRIREDEFDSATKSGSENHEGASGEDQDPRPNKKKRYHRHTQHQIQEMEAFFKECPHPDDKQRKELSRELGLEPLQVKFWFQNKRTQMKTQHERHENTNLRTENEKLRADNMRYREALSNASCPNCGGPTAIGEMSFDEHHLRLENARLREEIDRISAIAAKYVGKPVVNYSNISPSLPPRPLEIGVGGAGFGGQPGIGVDMYGAGDLLRSISGPTEADKPIIIELAVAAMEELIGMAQMGEPLWLTTLDGTSTMLNEDEYIRSFPRGIGPKPSGFKCEASRETAVVIMNHVNLVEILMDVNQWSTVFSGIVSRAMTLEVLSTGVAGNYNGALQVMTAELQLPTPLVPTRESYFVRYCKQHGDGTWAVVDVSLDNLRPSPSARCRRRPSGCLIQEMPNGYSKVTWVEHVEVDDRGVHNLYKQLVSSGHAFGAKRLVATLDRQCERLASAMATNIPTVDVGVITNQEGRKSMMKLAERMVISFCAGVSASTAHTWTTLSGTGADDVRVMTRKSVDDPGRPPGIVLSAATSFWLPVPPKRVFDFLRDENSRNEWDILSNGGVVQEMAHIANGRDTGNCVSLLRVNSANSSQSNMLILQESCTDSTGSFVIYAPVDIVAMNVVLNGGDPDYVALLPSGFAILPDGTTSHGSGGGVIGETSPSSGSLLTVAFQILVDSVPTAKLSLGSVATVNNLIACTVERIKASLSGEPA。

[0059] 2. Construction of the entry vector

[0060] The empty Fu28 vector and the gel recovery product containing the target gene with restriction enzyme sites were digested with restriction endonucleases (SpeI and BamHI), purified, and ligated together using Solution I ligase. The ligation product was transformed into competent *E. coli* DH5α cells and cultured in chloramphenicol-resistant plates until single colonies appeared. Single colonies were picked, and the activated bacterial culture was identified by PCR using CDS primers. Electrophoresis band detection was performed as follows. Figure 3 The A-axis indicates that the target band appears at 2187 bp, meaning the introductory vector has been successfully implemented. Fu28-GmSTART The construction of ) can be saved for subsequent experiments.

[0061] 3. Construction of expression vector

[0062] extract Fu28-GmSTART and pSOY1 The vector plasmid was recombined using the LR reaction, and the product was transformed into competent E. coli DH5α cells. The cells were cultured in spectinomycin-resistant plates until single colonies appeared. Single colonies were picked, and the bacterial culture was identified by PCR using CDS primers. Electrophoresis band detection was performed as follows. Figure 3 B in the image shows that the target band appears at 2187 bp, and the sequencing alignment result is consistent with... GmSTART The gene sequences are completely identical, meaning the expression vector has been completed. pSOY1-GmSTART The bacterial culture was constructed and preserved for subsequent experiments.

[0063] Example 3. Obtaining overexpression GmSTART Genetic plants

[0064] 1. Use the transformation method to convert overexpression ( pSOY1-GmSTART The plasmid was transferred into EHA105 Agrobacterium competent cells and cultured on plates containing the corresponding antibiotics until a single colony grew. The single colony was then used for PCR identification.

[0065] 2. PCR detection of overexpressing plants

[0066] The expression vector (pSOY1-) was transformed into soybean cotyledonary nodes using Agrobacterium-mediated transformation. GmSTART The transgene was transferred into the recipient variety Dongnong 50 to obtain overexpressing regenerated plants, which were used for subsequent propagation of transgenic plants and data collection. The seeds of the T3 generation overexpressing plants were sown, and DNA was extracted from the leaves of the transgenic plants for analysis of the target gene. GmSTART and BarPCR of the gene (Bar-F: CCAGCTGCCAGAAACCCACG, SEQ ID NO.5; Bar-R: CGACGGGGGATCTACCATG, SEQ ID NO.6; GmSTART-F: ATAACTAGTATGTTCCAGCCGAACC, SEQ ID NO.7; GmSTART-R: ATAGGATCCAGCAGGTTCACCAGA), SEQ ID NO.8; and electrophoresis was performed on a 1.5% agarose gel (…). Figure 4 The results showed that at 516 bp (Bar gene) and 2187 bp ( GmSTART The presence of a band at the gene indicates that the verified plant is a transgenic soybean plant. The transgenic soybean (overexpressing plant 35S:) was then used to further verify this. GmSTART Plants were grown under the same conditions as the control plant Dongnong 50. Total RNA was extracted from young leaves and reverse transcribed into cDNA. The target gene was then tested by qRT-PCR. GmSTART The expression status of the gene was observed. Results showed that the gene expression was observed in both OE-1 and OE-2 plants. GmSTART If the expression level of the gene is higher than that of the control plant, then the gene can be verified. GmSTART Transformation into soybean plants ( Figure 5 ).

[0067] Example 4. Mutation GmSTART Gene vector construction

[0068] 1. SgRNA target design

[0069] Designed via CRISPR-GE website GmSTART - SgRNA target sites in the CDS sequence. Two relatively promising target sequences were ultimately identified on the CDS sequence: TGAGATTCCTCGAATCCGTGAGG (SEQ ID NO. 9); CCTCCTCGTCCATTAGAAATTGG (SEQ ID NO. 10). PCR amplification of the designed targets yielded a target band at approximately 260 bp. Figure 6 As shown.

[0070] 2. GmSTART Constructing CRISPR / Cas9 vectors

[0071] The pGES401 empty vector was digested with Bsa I restriction endonuclease and ligated using T4 ligase, constructing both target sites onto a single vector. The ligation product was transformed into DH5α, and single colonies were picked from plates containing the corresponding antibiotics for expansion culture followed by PCR amplification. The PCR amplification products were then sent to bioengineering sequencing. The detection results are as follows: Figure 7As shown: the target sequence was finally detected at around 1000 bp. Combined with the company's sequencing results, it was preliminarily confirmed that the specific SgRNA target was successfully transformed into the pGES401 vector. The target editing status was then verified through genetic transformation.

[0072] Example 5. Obtaining GmSTART mutant

[0073] 1. The knockout vector (pGES401-) was converted using a chemical transformation method. GmSTART The plasmid was transformed into EHA105 Agrobacterium competent cells and cultured on plates containing the corresponding antibiotic until a single colony grew. This single colony was then used for PCR identification. The results are as follows: Figure 8 As shown: the detection results appear at around 1000 bp in electrophoresis, indicating that the knockout vector was successfully transferred into Agrobacterium tumefaciens.

[0074] 2. PCR detection of mutant plants

[0075] Transgenic soybeans were planted in the nursery of the North Campus of Northeast Agricultural University. When the first trifoliate leaf unfolded, DNA was extracted from the leaves. Receptor DN50 and water were used as negative controls, and PCR detection was performed on two target sites. The PCR products were electrophoresed for 10-15 minutes to determine if the bands were correct. PCR products with correct bands were sent to Sangon Biotech for sequencing. After receiving the sequencing results, DNAMAN and SnapGene were used for sequence alignment and peak diagram comparison to determine whether the target site had been edited and whether the resulting plants were homozygous.

[0076] Gene design via CRISPR-P online software GmSTART The knockout target is located in the CRISPR / Csa9 vector and GmSTART -sgRNA (5'-TTTTTTGTTTTAGAGCTTC-3', SEQ ID NO.11). Through propagation of transgenic materials and sequencing to detect mutation sites, a mutation type was obtained in one line, namely a single-base insertion at the 281st base of the CDS sequence, leading to premature termination at the 73rd amino acid. Figure 9 ).

[0077]

[0078] Example 6. Obtaining Arabidopsis mutants

[0079] 1. Selection of Arabidopsis mutants

[0080] Using the BLAST function on the Phytozome website (https: / / phytozome.jgi.doe.gov / ), the target crop was selected as Arabidopsis thaliana, and the gene sequence was... GmSTART -CDS sequence was used to obtain homologous genes of this gene in Arabidopsis thaliana. AT1G05230 And the homologous genes of Arabidopsis thaliana AT1G05230 Predicting conserved functional domains in Arabidopsis thaliana AT1G05230 The three conservative structure fields START_ArGLABRA2_like, Homeobox, and MreC super family are related to... GmSTART The structural domains are similar, both having START_ArGLABRA2_like, see Table 1 and Figure 10 .

[0081] Search on the Tair10 website AT1G05230 The mutants were screened, and finally SALK_127828.4700.x was ordered. GmSTART The Arabidopsis mutant material SALK_127828.4700.x is an Arabidopsis mutant material with a Col-0 background, in which a 186bp base sequence was inserted into the coding region via T-DNA insertion mutagenesis.

[0082] Table 1 AT1G0523 Gene function annotation

[0083]

[0084] 2. PCR identification of Arabidopsis mutants

[0085] The Arabidopsis mutant material SALK_127828.4700.x and the wild-type Arabidopsis control material Col-0 were planted. DNA was extracted from their rosette leaves. PCR was performed using LP+RP and LP+BP primer combinations (SALK-LP: GCTTGCCAATTTCAGCATAC, SEQ ID NO. 13; SALK-RP: TGTCTCCTCCTCCTCTTCCTC, SEQ ID NO. 14; SALK-BP: ATTTTGCCGATTTCGGAAC, SEQ ID NO. 15). The PCR product length of LP+RP was 1170 bp, and the product length of LP+BP was 578-878 bp. PCR and 1.5% agarose gel electrophoresis showed that the mutant was homozygous. Figure 11 ).

[0086] 3. Basta screening of Arabidopsis thaliana replacement and overexpression plants

[0087] Construction of Arabidopsis mutant complementation and wild-type Col-0 overexpression:

[0088] (1) Arabidopsis thaliana cultivation and plant conversion preparation

[0089] The control group Col-0 and the mutant material (Arabidopsis mutant material SALK_127828.4700.x) were planted. After the Arabidopsis bolted, the bolts were cut off to increase the number of bolts. When the bolts grew to a uniform height and only the upper flowers were not yet open, transformation could be prepared.

[0090] (2) Preparation of Agrobacterium

[0091] Remove the contents containing the expression vector (pSOY1-) at -80℃ GmSTART Agrobacterium tumefaciens was inoculated into 10 mL of LB liquid medium containing spectinomycin and cultured overnight at 28°C and 160 rpm. 100 µL of the culture was transferred to 100 mL of fresh YEP liquid medium containing spectinomycin and cultured at 28°C and 200 rpm until OD600 = 0.8. The culture was centrifuged at 4000 rpm for 10 min at room temperature, the supernatant was discarded, and the cells were resuspended in 100 mL of a resuspension of 5% sucrose and 0.01% Silwet-L77. The cells were then incubated at room temperature for 1–3 h for Agrobacterium infection experiments.

[0092] (3) Arabidopsis thaliana flower-dipping transformation

[0093] Remove Arabidopsis thaliana plants that have reached a suitable bolting height and produced numerous inflorescences from the greenhouse after long-day growth. Remove any flower buds and pods that have formed. Immerse the unflowered plants in Agrobacterium resuspension for 30 seconds. Wrap the Agrobacterium-infected Arabidopsis thaliana in plastic wrap and place them in a dark chamber for 24 hours. Remove them from the dark chamber. Perform a second transformation one week later to improve transformation efficiency. Harvest the seeds after the plants have matured.

[0094] T0 seeds transformed from Arabidopsis mutants and wild-type Arabidopsis Col-0 overexpression were planted. After two leaves emerged, Basta reagent was sprayed three times every other day. It was found that a large number of Arabidopsis plants withered and stopped growing, and only a few Arabidopsis plants continued to grow. They were preliminarily identified as transgenic Arabidopsis plants transformed from mutants and overexpressed (Figure 12).

[0095] 4. Bar strip detection and PCR identification of Arabidopsis thaliana supplemented and overexpressing plants

[0096] For Arabidopsis thaliana plants that had undergone replanting and overexpression (T1, T2, and T3 generations), leaves were taken into centrifuge tubes and the extraction solution was added. The leaves were then crushed with a small pestle, and a Bar test strip was inserted into the centrifuge tube in the specified direction. The results are as follows: Figure 13 The appearance of two horizontal lines on the Bar test strip confirms that the Arabidopsis thaliana is a transgenic Arabidopsis thaliana (transformed by mutant replacement and wild-type Col-0 overexpression). T1, T2, and T3 generation plants of the replacement and overexpression strains were planted, and DNA was extracted from rosette leaves for analysis of the target gene. GmSTART and Bar PCR of the gene was performed, followed by 1.5% agarose gel electrophoresis. The results showed that the gene was 516 bp (…). Bar (gene) and 2187 bp ( GmSTART A band is found at the gene site, indicating that transgenic Arabidopsis thaliana has been obtained (mutant replacement transformation of Arabidopsis thaliana and wild-type Col-0 overexpression transformation of Arabidopsis thaliana).

[0097] 5. qRT-PCR identification of T3 generation transgenic Arabidopsis thaliana

[0098] Transgenic Arabidopsis thaliana (overexpressing 35S:) was used. GmSTART And mutant replacement plants 35S: GmSTART The mutant plant SALK_127828.4700.X (SALK_127828.4700.X) and control plants Col-0, as well as the mutant plant SALK_127828.4700.X, were planted under the same conditions. Total RNA was extracted from their rosette leaves and reverse transcribed into cDNA. The target gene was then detected by qRT-PCR. GmSTART The expression situation. The result is as follows. Figure 14 Display: Genes GmSTARTThe gene is not expressed in wild-type and mutant plants, but it is expressed in mutant replacement plants and overexpression plants. The expression level of this gene is higher in overexpression plants than in mutant replacement plants, indicating that the gene... GmSTART It is transformed and introduced into Arabidopsis thaliana.

[0099] Example 7.

[0100] 1. Determination of total nitrogen content in T3 generation transgenic Arabidopsis seeds

[0101] Transgenic Arabidopsis thaliana (overexpressing 35S:) was used. GmSTART And mutant replacement plants 35S: GmSTART The transgenic Arabidopsis thaliana T3 generation pods (SALK_127828.4700.X), wild-type Col-0, and mutant SALK_127828.4700.X were planted under the same conditions. Mature pods were collected from different lines, and seeds were obtained and dried. The total nitrogen content of Arabidopsis thaliana seeds was determined by the Kjeldahl method.

[0102] The results are as follows Figure 15 As shown, when determining the phenotypes of the mutant and wild-type control materials, in terms of protein content, the total nitrogen content of the mutant replacement plants was significantly increased, showing a significant difference compared with the control material; the total nitrogen content of the overexpressing plants was significantly higher than that of the wild-type plants. The results indicate that the gene... GmSTART The effects on the accumulation of protein and oil in Arabidopsis seeds showed that it promoted fatty acid content to a certain extent, but had a more significant effect on protein content.

[0103] 2. Agronomic traits of T3 and T4 generation transgenic soybean plants

[0104] To prove GmSTART To assess the impact on soybean plant phenotype, we conducted a series of phenotypic tests on T3 and T4 generation mutant plants. Compared with the control group, the T3 generation mutant plants showed a 2.4% reduction in grain length. Figure 16 i), the particle width decreased by 6.4% ( Figure 17 j), plant height increased by 29.9% ( Figure 16 a) The number of sections increased by 11.4% ( Figure 16 e), on average, 1-2 branches are reduced ( Figure 16 f), the number of pods per plant, the number of seeds per plant, and the weight of seeds per plant did not change significantly ( Figure 16 c, 16d), 100-grain weight decreased by 13.8% ( Figure 16 b).

[0105] Compared with the control group, the T4 generation mutant plants maintained similar agronomic traits to the T3 generation, with a 5.2% reduction in grain length. Figure 17 i), the particle width decreased by 5.0% ( Figure 17j), plant height increased by 14.2% ( Figure 17 a), the number of sections increased by 21.5% ( Figure 17 b); Number of branches ( Figure 17 c) Number of pods per plant ( Figure 17 e), Number of grains per plant ( Figure 17 f) and grain weight per plant ( Figure 17 g) decreased significantly by 24.7%, 17.8%, 7.5%, and 14.3%, respectively. Therefore, it can be concluded that... GmSTART Reducing seed weight has a significant impact on the 100-seed weight of soybeans (a decrease of 7.7%).

[0106] A series of phenotypic assays were performed on the T3 generation overexpressing plants, and compared with the control group, GmSTART -OE1 overexpressing plants showed significantly increased grain length and width compared to WT plants. START - OE1 and START - OE2 grain length increased by 2.9% and 1.1% respectively. Figure 18 i), the particle width increased by 1.6% and 5.0% respectively. Figure 18 j). Plant height ( Figure 18 a) Number of branches ( Figure 18 c) Number of pods per plant ( Figure 18 e), Number of grains per plant ( Figure 18 f) and grain weight per plant ( Figure 18 g) decreased significantly by 10.6%, 20.8%, 36.3%, 39.4%, and 35.9%, respectively; while the 100-grain weight increased significantly by 8.41% ( Figure 18 d); The number of sections has no significant impact. GmSTART -OE2 overexpression plant height ( Figure 18 a) Number of branches ( Figure 18 c) Number of pods per plant ( Figure 18 e), Number of grains per plant ( Figure 18 f) and grain weight per plant ( Figure 18 g) decreased significantly by 6.0%, 22.15%, 28.2%, 30.8%, and 26.8%, respectively; while the 100-grain weight increased significantly by 5.7% ( Figure 18 d); The number of sections has no significant impact.

[0107] 3. Phenotypic identification of protein oil from T3 and T4 generation transgenic soybeans

[0108] To further prove GmSTART It participated in the accumulation of protein and oil in soybeans, and we constructed [a process / mechanism] in soybeans. GmSTART The mutant plants were propagated to the T3 generation and stabilized. GmSTART The mutant strain exhibits pleiotropic effects on its protein and oil content. Measurements of protein content revealed that, compared to the control group, GmSTARTThe mutant's protein content was reduced by 1.67% ( Figure 19 (b) Total fat content decreased significantly by 4.9% ( Figure 19 a).

[0109] In T4 generation mutant seeds, compared with the control group, GmSTART The mutant's protein content was reduced by 1.8% (e.g. Figure 19 (b) Total fat content decreased significantly by 5.5% ( Figure 19 a). Indicates GmSTART There is a significant correlation between transcriptional abundance and oil content and protein content.

[0110] 4. We constructed [a process] in soybeans. GmSTART Overexpressing plants were found to stabilize after the material was propagated to the T3 generation. GmSTART Overexpression of [a specific substance] has pleiotropic effects on its protein and oil content. Analysis of protein content revealed that, compared to the control group, [the following was observed]. START -OE1 and START The protein content of -OE2 increased by 4.6% and 3.3%, respectively. Figure 20 b) START -OE1 increases total fatty acids by 4.2%. START The total fatty acid content of -OE2 increased by 1.2% ( Figure 20 a).

[0111] 5. Observe the seeds during their developmental stages using transmission electron microscopy (TEM). Figure 21 During mid-stage seed development (MM stage), the number of oil bodies and protein bodies in mutant and overexpression seeds was not significantly different from that in the control group. However, in late-stage seed development (LM and DS stages), the number of oil bodies in mutant seeds decreased dramatically, with only a small number of oil bodies distributed around the cell wall, and the number of vacuoles for protein storage was significantly reduced. In contrast, the number of oil bodies in overexpression seeds increased significantly, and the number of vacuoles for protein storage was significantly increased. This suggests... GmSTART It is possible that the balance of seed oil and protein is synergistically regulated through the interaction of genes related to the accumulation of certain seeds' oil and protein. However, the balance of the mutated seeds is disrupted, resulting in a significant decrease in protein and oil content.

Claims

1. Contains GmSTART The application of mutant genes in soybeans to improve soybean plant height is characterized by, The aforementioned GmSTART The sequence of the mutated gene is shown in SEQ ID NO.12.

Citation Information

Patent Citations

  • Methods and compositions for increasing protein and / or oil content and altering oil properties in plants

    CN118843637A

  • Methods and compositions for increasing protein and / or oil content and modifying oil profile in a plant

    WO2023154887A1