AvMYB1 protein and application thereof in improving salt tolerance of plants

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to an AvMYB1 protein and application thereof in improving salt tolerance of plants. The invention provides an AvMYB1 protein, wherein the amino acid sequence of the AvMYB1 protein is as shown in SEQ ID NO. 2. The AvMYB1 protein disclosed by the invention can be used for regulating the growth and development of plants and improving the stress resistance of the plants; according to the AvMYB1 protein, Na < + > is discharged by activating an SOS pathway, so that the Na < + > content in a plant body is reduced, and the salt tolerance of the plant is improved. The AvMYB1 gene is constructed into a plant expression vector, genetic transformation is carried out through an agrobacterium tumefaciens-mediated genetic transformation method, new germplasm with the salt-tolerant characteristic can be effectively obtained, and the method has important significance for developing salt-tolerant crop breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to an AvMYB1 protein and an application thereof in improving the salt tolerance of plants. Background Art

[0002] In recent years, the agricultural ecological environment has continued to deteriorate, and high-salt stress has become more and more serious. Soil salinization has become an important problem that needs to be solved in the field of agricultural production worldwide, and has become a key stress factor affecting plant growth and yield. Breeding new salt-tolerant crop varieties is an important way to effectively utilize saline soil and increase grain production. In the process of long-term salt stress adaptive growth and evolution, salt-tolerant plants have established a series of mechanisms to reduce the harm of salt stress, and are good donors for mining excellent salt-tolerant genes.

[0003] Apocynum venetum is a plant of the genus Apocynum in the family Apocynaceae. It is named after the Lop Nur region in Xinjiang. It has strong environmental adaptability and can grow in arid areas, saline-alkali lands and even coastal tidal flats. The phloem fiber of Apocynum venetum is of good quality and was used as an industrial textile raw material when it was first discovered. Its roots, stems, leaves and flowers can all be used as medicine. In recent years, more and more studies have been conducted on the botanical classification, medicinal component composition, pharmacotoxicological analysis, salt tolerance mechanism and anabolic regulation of Apocynum venetum, which has gradually attracted great attention from the academic community. However, there are few studies on the salt tolerance genes of Apocynum venetum. Summary of the invention

[0004] The purpose of the present invention is to provide an AvMYB1 protein and its application in improving plant salt tolerance. The AvMYB1 protein of the present invention activates the SOS pathway to excrete Na + , reducing Na in plants + content, improves plant salt tolerance and can be used to create new salt-tolerant germplasm.

[0005] The present invention provides an AvMYB1 protein, the amino acid sequence of the AvMYB1 protein is shown as SEQ ID NO.2.

[0006] The present invention also provides an AvMYB1 gene, which is a gene encoding the AvMYB1 protein described in the above scheme; the cDNA sequence of the AvMYB1 gene is shown in SEQ ID NO.1.

[0007] The present invention also provides the use of the AvMYB1 protein described in the above scheme or the AvMYB1 gene described in the above scheme in regulating plant salt tolerance.

[0008] Preferably, the regulation includes: increasing the expression level of AvMYB1 protein or increasing the expression level of AvMYB1 gene to improve the salt tolerance of plants.

[0009] Preferably, the plant comprises Apocynum venetum and / or Arabidopsis thaliana.

[0010] The present invention also provides a recombinant expression vector, which comprises the AvMYB1 gene described in the above scheme.

[0011] The present invention also provides a recombinant bacterium, wherein the recombinant bacterium comprises the recombinant expression vector described in the above scheme.

[0012] The present invention also provides the use of the AvMYB1 protein described in the above scheme, or the AvMYB1 gene described in the above scheme, or the recombinant expression vector described in the above scheme, or the recombinant bacteria described in the above scheme in cultivating salt-tolerant plant varieties.

[0013] Preferably, the plant comprises Apocynum venetum and / or Arabidopsis thaliana.

[0014] The present invention also provides a method for improving plant salt tolerance, comprising: transferring the recombinant expression vector described in the above scheme or the recombinant bacteria described in the above scheme into the plant.

[0015] The present invention provides an AvMYB1 protein, the amino acid sequence of which is shown in SEQ ID NO. 2. The AvMYB1 protein of the present invention can regulate plant growth and development and improve plant stress resistance; the AvMYB1 protein can activate the SOS pathway to excrete Na + , reducing Na in plants + The results of the embodiment show that overexpression of the AvMYB1 gene can reduce Na + The accumulation of ROS and oxidative stress in cells can be reduced, and increasing the expression of AvMYB1 protein can significantly improve the salt tolerance of Arabidopsis. The AvMYB1 gene is constructed into a plant expression vector and genetically transformed by Agrobacterium-mediated genetic transformation, which can effectively obtain new germplasm with salt tolerance, which is of great significance for the breeding of salt-tolerant crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0017] Figure 1It is an identification diagram of the up-regulated expression of the AvMYB1 gene induced by salt stress in Example 1; wherein A: a cluster diagram of DEGs sub-trends of the transcriptome in the seedling stage; B: a cluster diagram of DEGs sub-trends of the transcriptome in the adult stage; C: qRT-PCR expression identification data of the AvMYB1 gene in the transcriptome sequencing samples in the seedling stage; D: qRT-PCR expression identification data of the AvMYB1 gene in the transcriptome sequencing samples in the adult stage; the blue lines in A and B represent the AvMYB1 gene;

[0018] Figure 2 The expression levels of the AvMYB1 gene in different tissues of Apocynum venetum in Example 2; wherein A: a sampling example of the construction of a cDNA library of Apocynum venetum tissue; B: the relative expression levels of the AvMYB1 gene in different tissues;

[0019] Figure 3 The spatiotemporal expression pattern and subcellular localization analysis diagram of the AvMYB1 gene in Example 3, wherein A to D are diagrams showing the expression of the AvMYB1 gene in various tissues of Arabidopsis thaliana; E to G are diagrams showing the localization of the AvMYB1 protein in the nucleus;

[0020] Figure 4 Figure 4 is a diagram for identifying the salt tolerance phenotype of the AvMYB1 overexpressing plants; A is the identification of the expression level of AvMYB1 in transgenic plants; B is the root length phenotype of WT, AvMYB1-OE#4 and AvMYB1-OE#7 on 1 / 2MS medium; C is the root length phenotype of WT, AvMYB1-OE#4 and AvMYB1-OE#7 on 1 / 2MS medium supplemented with 100mM NaCl; D is the seedling phenotype of WT, AvMYB1-OE#4 and AvMYB1-OE#7 on the seedling medium; E is the root length phenotype of WT, AvMYB1-OE#4 and AvMYB1-OE#7 on the seedling medium supplemented with 150mM NaCl. Seedling phenotypes of WT, AvMYB1-OE#4 and AvMYB1-OE#7 on NaCl seedling medium; F is the root length statistics of the control group and the treatment group; G is the coverage area statistics of the seedlings of the control group and the treatment group; lowercase letters in FG indicate that the traits of each plant in the control group are significantly different, uppercase letters indicate that the traits of each plant in the treatment group are significantly different, ** indicates that the traits of the same plant in the treatment group and the control group are significantly different, P<0.05;

[0021] Figure 5 is the Na content of WT, AvMYB1-OE#4 and AvMYB1-OE#7 plants under normal growth conditions and salt stress conditions in Example 5 + , K + and ROS content detection diagram; A is K + Content diagram; B is Na + Content map; C is K + / Na +Ratio graph; D is the result graph of NBT staining to detect ROS content; E is the result graph of DAB staining to detect ROS content. Data statistical analysis was performed using one-way analysis of variance (ANOVA) and Tukey's-test. Lowercase letters indicate significant differences, P<0.05;

[0022] Figure 6 The AvMYB1 protein regulates the AtSOS2 and AtSOS3 genes in Arabidopsis thaliana in Example 6; wherein A is Na + Expression levels of genes related to influx and efflux pathways; B is the verification of transcriptional activation of AvMYB1 protein in Apocynum venetum; C is the enrichment analysis of the original "TTAGGG" of AvMYB1 combined with Arabidopsis AtSOS2 and AtSOS3 gene promoters, * indicates significant difference, P<0.05; ** indicates significant difference, P<0.01;

[0023] Figure 7 The SOS pathway validation diagram of the VIGS-treated and untreated groups of Apocynum venetum leaves in Example 7; A is the expression level of the relevant gene, ** indicates that the expression level of the gene in the untreated sample and the VIGS-induced sample under salt stress is significantly different; B is Na + Content detection diagram, lowercase letters represent Na in VIGS treated samples and untreated samples under salt stress conditions + The content was significantly different, P<0.05. DETAILED DESCRIPTION

[0024] The present invention provides an AvMYB1 protein. The amino acid sequence of the AvMYB1 protein is shown in SEQ ID NO.2: MGIDPVTHKPKSDALLSSDGQTKHAANLSHMAQWESARLEAEARLVRQSKLRSNSFQNPLASPEFSSPSSPLSKPVVPPRCLDILKAWNGVWTKPNESSAASASTTAPVSVPGLGRDLESPTSTLSYSENAPQLSSSGIGDNSTAFIVIVGNSSGSCEGGIMKEEGDGEEDWKGFGSSTNNLVEYKDGIENSMSFTSGLHDLTIPLDTDNVPFVEKFTDLLLSTSSGGTDRGFSEGCDESDNGTGISGNGNGSGSSTSEYLEDNKNYWNSILNLVNSSPSGSAMF.

[0025] The present invention also provides an AvMYB1 gene, which is a gene encoding the AvMYB1 protein described in the above scheme; the cDNA sequence of the AvMYB1 gene is shown in SEQ ID NO.1, and the end is a stop codon, which is as follows:

[0026] 5′-ATGGGAATAGATCCAGTGACCCACAAGCCCAAGAGTGATGCACTGTTGTCCAGT -3′.

[0027] The present invention also provides the use of the AvMYB1 protein described in the above scheme or the AvMYB1 gene described in the above scheme in regulating plant salt tolerance. As an embodiment, the regulation of the present invention includes: increasing the expression level of AvMYB1 protein or increasing the expression level of AvMYB1 gene to improve plant salt tolerance.

[0028] As another embodiment, the plant of the present invention includes Apocynum venetum and / or Arabidopsis thaliana. In a specific embodiment, the plant may be Apocynum venetum or Arabidopsis thaliana.

[0029] The present invention also provides a recombinant expression vector, which comprises the AvMYB1 gene described in the above scheme.

[0030] The present invention also provides a recombinant bacterium, wherein the recombinant bacterium comprises the recombinant expression vector described in the above scheme.

[0031] The present invention also provides the use of the AvMYB1 protein described in the above scheme, or the AvMYB1 gene described in the above scheme, or the recombinant vector described in the above scheme, or the recombinant bacteria described in the above scheme in cultivating salt-tolerant plant varieties.

[0032] As an embodiment, the plant of the present invention includes Apocynum venetum and / or Arabidopsis thaliana. In a specific embodiment, the plant may be Apocynum venetum or Arabidopsis thaliana.

[0033] The present invention also provides a method for improving plant salt tolerance, comprising: transferring the recombinant expression vector or the recombinant bacteria described in the above scheme into a plant. As an embodiment, the plant includes Apocynum venetum and / or Arabidopsis thaliana. In a specific embodiment, the plant can be Apocynum venetum or Arabidopsis thaliana.

[0034] To further illustrate the present invention, an AvMYB1 protein provided by the present invention and its application in improving plant salt tolerance are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0035] Example 1

[0036] AvMYB1 gene is upregulated by salt stress

[0037] 6-week-old Apocynum venetum seedlings were selected and treated with a 200 mM NaCl solution. The treatment method was as follows: pouring the NaCl solution into the Apocynum venetum seedling bottom plate, allowing the plug plate to slowly absorb the solution, and after 4 hours, when the NaCl solution in the bottom plate no longer decreases, pouring out the excess NaCl solution in the bottom plate. Apocynum venetum leaves were taken for transcriptome sequencing at 0 min, 15 min, 30 min, 1 h and 4 h of treatment, respectively, and recorded as CK, 15 min, 30 min, 1 h and 4 h, respectively.

[0038] During the adult stage of Apocynum venetum, potted Apocynum venetum with basically the same growth potential were randomly divided into two groups. One group was treated with 200 mM NaCl solution for salt stress, recorded as the treatment group, and the other group was watered with an equal amount of water as the control group. On the 0th day, 7th day and 18th day of the treatment, leaves from the same leaf position of Apocynum venetum in the control group and the treatment group were taken for transcriptome sequencing, which were recorded as CK-0d, CK-7d, CK-18d, NaCl-7d and NaCl-18d, respectively.

[0039] The differentially expressed genes (DEGs) obtained by the above two groups of transcriptome sequencing were subjected to sub-trend cluster expression analysis. The results are shown in Figure 1 .according to Figure 1 It can be seen that a subcluster subcluster_2 and subcluster_7 were identified in the transcriptome data of Apocynum venetum seedling stage and adult plant stage, respectively. Figure 1 (A and B in Figure 3), the expression levels of DEGs in these two subclusters were significantly upregulated when subjected to salt stress, indicating that these genes may be involved in the response process to salt stress.

[0040] Through gene annotation, it was found that the AvMYB1 gene existed in both subclusters subcluster_2 and subcluster_7. Then, the expression level of the AvMYB1 gene in each sample was further identified by qRT-PCR experiment. The primer sequences of AvMYB1 in the qRT-PCR experiment are shown in SEQ ID NO.3 and SEQ ID NO.4, and the internal reference gene is the Apocynum EF1α gene, and the primer sequences of the Apocynum EF1α gene are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0041] AvMYB1-F: 5′-TGTGGACCAAACAAATGAATCC-3′ (SEQ ID NO. 3);

[0042] AvMYB1-R: 5′-AATAACTAAGTGTAGAAGTAGGCG-3′ (SEQ ID NO. 4);

[0043] EF1α-F: 5′-TGAGAGGTCTACCAACCTTGA-3′ (SEQ ID NO. 5);

[0044] EF1α-R: 5′-TTGGGCTCAGAAATCAGGTCAA-3′ (SEQ ID NO. 6).

[0045] The qRT-PCR system is 20 μL, including 2×ChamQ SYBR qPCR Master Mix 10 μL, 10 μM forward primer (F) 0.4 μL, 10 μM reverse primer (R) 0.4 μL, 50×ROX Reference Dye 10.4 μL, cDNA template 1 μL, ddH2O is added to 20 μL, and 3 technical replicates are set; the cDNA template in the system is cDNA obtained by reversing 1 μg RNA.

[0046] The qRT-PCR amplification adopts a two-step method, and the reaction procedure is pre-denaturation at 95°C for 30 seconds; then 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds; then run the melting curve stage: 95°C for 15 seconds, 60°C for 1 minute, and 95°C for 15 seconds. After the reaction is completed, a melting curve analysis is performed.

[0047] The transcriptome data and qRT-PCR data were analyzed, and the results are shown in Figure 1 C and D in. According to Figure 1 As shown in C and D, the expression pattern of AvMYB1 in the seedling and adult stages was basically consistent with the transcriptome, which further indicated that AvMYB1 may be involved in the salt stress response of Apocynum venetum and may play an important role in the salt tolerance of Apocynum venetum.

[0048] Example 2

[0049] In order to analyze the expression pattern of AvMYB1 gene in different tissues of Apocynum venetum, different tissues and organs of Apocynum venetum in seedling and adult stages were collected, and the tissues and organs were a: mature leaves in the middle of seedlings; b: young leaves of seedlings; c: senescent leaves of seedlings; d: young stems of seedlings; e: roots of seedlings; f: senescent leaves in adult stage; g: mature leaves in adult stage; h: young leaves at the tip of stem in adult stage; i: flowers; j: roots of adult plants; k: one-week-old fruit pods; l: phloem in adult stage; m: pod skin of 2-3 week-old fruit pods; n: pod skin of mature pods; o: contents of 2-3 week-old fruit pods; p contents of mature fruit pods (see Figure 2A in the figure). The cDNA library was constructed by collecting different tissues and organs of Apocynum venetum. In the 16 selected tissue samples, the expression level of AvMYB1 gene in the middle mature leaves of the seedlings (a) was used as a reference standard to detect the expression level of AvMYB1 gene. The method for determining the expression level of AvMYB1 gene and the sequence information were the same as those in Example 1. The detection results are shown in Tables 1 and Figure 2 B in.

[0050] Table 1 Expression of AvMYB1 gene in different tissues and organs of Apocynum venetum

[0051] Location a b c d e f g h Expression 1 2.2 5.9 1.2 0.8 8.3 9.5 8.9 Location i j k l m n o p Expression 0.85 0.85 0.9 3.8 4.3 4.1 0.4 0.8

[0052] According to Table 1 and Figure 2 From B in the figure, we can see that AvMYB1 has a very high expression level in leaves (including b: seedling leaves; c: seedling senescent leaves; f: adult plant senescent leaves; g: adult plant mature leaves; h: adult plant stem tip young leaves) and phloem tissues (including d: seedling stems; l: adult plant phloem; m: 2-3 week fruit pod skin; n: mature pod skin). Some studies [ZongchangXu, et al. Comparative transcriptome analysis reveals the molecular mechanism of salt tolerance inApocynum venetum, Plant Physiology and Biochemistry 167 (2021) 816-830] pointed out that under salt stress conditions, the leaves and stems of Apocynum venetum are Na + The main storage organ of Na. + The accumulation positions are very consistent, further suggesting that the AvMYB1 transcription factor is involved in the regulation of the salt stress response of Apocynum venetum.

[0053] Example 3

[0054] In order to analyze the spatiotemporal expression pattern of AvMYB1 transcription factor, the pAvMYB1:GUS vector was constructed and transformed into the model plant Arabidopsis thaliana.

[0055] The construction process of pAvMYB1:GUS vector: PBI101-GUS vector was used as the basic vector (purchased from BioVector NTCC Typical Culture Collection Center, product number: pBI101 vetor), and the vector was linearized by single restriction enzyme digestion with Xba I; the cDNA of young leaves of Apocynum venetum was used as a template, and the AvMYB1 gene fragment was obtained using amplification primers AvMYB1-GUS-F and AvMYB1-GUS-R; under the action of homologous recombinase, the AvMYB1 gene fragment was connected with the linearized vector to obtain the pAvMYB1:GUS recombinant vector.

[0056] AvMYB1-GUS-F (SEQ ID NO.7):

[0057] 5′-AAAAAGCAGGCTTTGACTTTATGGGAATAGATCCAGTGACC-3′;

[0058] AvMYB1-GUS-R (SEQ ID NO.8):

[0059] 5′-AAGCTGGGTCTAGAGACTTTTTAGAACATTGCTGAACCAGAAG-3′.

[0060] The pAvMYB1:GUS vector obtained in the above step was transformed into Agrobacterium GV3101 to obtain the GV3101 Agrobacterium strain carrying the pAvMYB1:GUS vector. The GV3101 Agrobacterium strain carrying the pAvMYB1:GUS vector was streaked on the LB medium, and a single clone was selected to shake the bacteria. When the OD value of the bacterial solution reached about 0.5, it was centrifuged, the supernatant was discarded, and the bacteria were resuspended in a resuspension solution to obtain a resuspension solution, wherein the resuspension solution was composed of sucrose with a final concentration of 5% (w / v) and Silwet with a final concentration of 0.02% (v / v). After soaking the blooming Arabidopsis inflorescence in the resuspension solution for 30s, it was cultured in the dark for 12h, and after harvesting the seeds, positive plants were screened using a hygromycin medium with a final concentration of 15mg / L.

[0061] The positive plants obtained in the above steps were subjected to GUS staining to observe the expression of AvMYB1 gene in Arabidopsis. The GUS staining results can be found in Figure 3 According to A~D. Figure 3 From A to D in the figure, we can see that the AvMYB1 gene is expressed in cotyledons, hypocotyls in the seedling stage, leaves, flowers and filaments in the adult stage of Arabidopsis, which is basically consistent with the expression in the main tissues.

[0062] The pAvMYB1:AvMYB1:GFP overexpression vector was further constructed, and the pCAMBIA1301-EGFP vector was used as the basic vector, and the linearized vector was double-digested with Pst I and Kpn I; the cDNA of young leaves of Apocynum venetum was used as a template, and the AvMYB1 gene fragment containing the promoter was obtained using amplification primers pAvMYB1:AvMYB1:GFP-F (SEQ ID NO.9) and pAvMYB1:AvMYB1:GFP-R (SEQ ID NO.10); under the action of homologous recombinase, the AvMYB1 gene fragment containing the promoter was connected with the linearized vector to obtain the pAvMYB1:AvMYB1:GFP recombinant vector.

[0063] pAvMYB1:AvMYB1:GFP-F (SEQ ID NO.9):

[0064] 5′-TTTACACTTTATGCTTCCGGCTATGGGAATAGATCCAGTGACC-3′;

[0065] pAvMYB1:AvMYB1:GFP-R (SEQ ID NO.10):

[0066] 5′-ACAAGTAAAGCGGCCGCGACTCTAGATTAGAACATTGCTGAACCAGAAG-3′.

[0067] The pAvMYB1:AvMYB1:GFP recombinant vector obtained in the above steps was transformed into Agrobacterium LBA4404, and the leaves of Nicotiana benthamiana were infected by the Agrobacterium transient transformation system. The AvMYB1 protein was observed under a laser confocal microscope. The results are shown in Figure 3 The results showed that AvMYB1 protein was localized in the nucleus, which is consistent with the region where transcription factors function.

[0068] Example 4

[0069] ① Screening of transgenic overexpression strains

[0070] The pCAMBIA1301-EGFP vector was used as a basic vector, and the linearized vector was double-digested with BamHI and Kpn I; cDNA of young leaves of Apocynum venetum was used as a template, and amplification primers pAvMYB1:AvMYB1:GFP-F1 (SEQ ID NO.11) and pAvMYB1:AvMYB1:GFP-R (SEQ ID NO.10) were used to obtain the AvMYB1 gene fragment; under the action of homologous recombinase, the AvMYB1 gene fragment was connected with the linearized vector to obtain a 35S:AvMYB1 overexpression vector.

[0071] pAvMYB1:AvMYB1:GFP-F1 (SEQ ID NO.11):

[0072] 5′-CGAACGATAGCCATGGTACCaATGGGAATAGATCCAGTGACC-3′.

[0073] The 35S:AvMYB1 overexpression vector was infected with Arabidopsis thaliana, and the infection method was the same as in Example 3. Arabidopsis positive seedlings were obtained by resistance plate screening, and the resistance plate contained hygromycin at a final concentration of 15 mg / L; the expression level of the AvMYB1 gene in the transgenic plants was identified by qRT-PCR, and the determination method and sequence information of the qRT-PCR were the same as in Example 1. Stable genetic transgenic overexpression lines AvMYB1-OE#4 and AvMYB1-OE#7 (see Figure 4 A).

[0074] ②Verification of root length phenotype of transgenic overexpression lines

[0075] NaCl with a final concentration of 100 mM was added to 1 / 2MS plant culture medium as the experimental group, and the culture medium without NaCl was used as the control group. Arabidopsis wild type (WT) and transgenic overexpression lines AvMYB1-OE#4 and AvMYB1-OE#7 were planted to verify the root length phenotype.

[0076] The Arabidopsis thaliana in the experimental group and the control group were cultured for 3 weeks and the root growth of Arabidopsis thaliana was observed. Figure 4 B, C and F in the figure. The results showed that the root length of the two transgenic overexpression lines AvMYB1-OE#4 and AvMYB1-OE#7 grown for 3 weeks in the control group was significantly longer than that of the WT ( Figure 4 In the experimental group with NaCl added, the root length of the two transgenic overexpression lines was also significantly longer than that of WT ( Figure 4 C, F); Statistical analysis results showed that there was no significant difference in root length between the two transgenic overexpression lines in the experimental group and the control group, while the root length growth of the experimental group WT was significantly inhibited compared with the control group ( Figure 4 F), which indicates that overexpression of the AvMYB1 gene can enhance the salt tolerance of Arabidopsis seedlings.

[0077] ③Salt stress treatment

[0078] WT, AvMYB1-OE#4 and AvMYB1-OE#7 Arabidopsis thaliana grown in the seedling medium for 2 weeks were treated with 150mM NaCl and recorded as the treatment group. The control group was watered with the same amount of water. After another 2 weeks of growth, the growth of Arabidopsis thaliana was observed and the coverage area of ​​Arabidopsis thaliana seedlings was counted. The results are shown in Figure 4 D, G in. According to Figure 4 As shown in D and G, in the control group, AvMYB1-OE#4 and AvMYB1-OE#7 were larger than WT, and the seedling coverage area was significantly higher than WT; in the treatment group, the seedling coverage area of ​​WT, AvMYB1-OE#4 and AvMYB1-OE#7 was significantly lower than that of the corresponding untreated group ( Figure 4 G), but the seedling coverage area of ​​OE#4 and OE#7 in the treatment groups was significantly higher than that of WT ( Figure 4 This indicates that overexpression of AvMYB1 can also improve the salt tolerance of Arabidopsis thaliana in the seedling medium.

[0079] Example 5

[0080] Salt stress usually causes Na + The Na content of leaves of WT, AvMYB1-OE#4 and AvMYB1-OE#7 plants under normal growth conditions and salt stress was measured. + , K + and ROS content were measured.

[0081] Na + , K + Determination method: Take 2g of Apocynum venetum leaves and keep them in an oven at 120℃ for 30min, then place them in an oven at 80℃ overnight to dry them to constant weight. Grind the dried Apocynum venetum leaves into powder and pass them through a 0.5mm sieve to obtain Apocynum venetum powder. Take 0.25g of Apocynum venetum powder, digest it with 5mL HNO3, keep it at 110℃ until it becomes a colorless liquid (about 6h), then cool the liquid mixture to room temperature and make up to 10mL with deionized water. Use a Perkins-Elmer 360 atomic absorption spectrophotometer to determine the Na of the supernatant. + , K + Concentration, results see Figure 5 A~C in.

[0082] ROS content: The content of ROS in Apocynum venetum leaves was detected by DAB and NBT staining. The results are shown in Figure 5 D, E in.

[0083] according to Figure 5 As shown in A to C, under normal growth conditions, the K values ​​of WT and two transgenic overexpression lines AvMYB1-OE#4 and AvMYB1-OE#7 were + 、Na + There was no significant difference in the content ( Figure 5A, B); K of salt stress treatment groups WT, AvMYB1-OE#4 and AvMYB1-OE#7 + There was no significant difference, but the content was significantly lower than that of the control group ( Figure 5 Under salt stress, Na + The content of Na in AvMYB1-OE#4 and AvMYB1-OE#7 was significantly higher than that in the control group, reaching 4.09 times that of the control group. + Although the contents were also significantly higher than those in the control group, which were 2.59 and 2.46 times of those in the control group, the Na + The contents decreased by 34.59% and 38.55% respectively ( Figure 5 B); thus, under salt stress conditions, Na + / K + The ratio was also significantly lower than that of WT ( Figure 5 This indicates that overexpression of the AvMYB1 gene in Arabidopsis can reduce the intracellular Na + content.

[0084] NBT and DAB staining results showed that under salt stress, transgenic plants AvMYB1-OE#4 and AvMYB1-OE#7 produced less ROS than WT ( Figure 5 D, E), indicating that the AvMYB1 gene can also reduce the level of oxidative stress in cells.

[0085] Example 6

[0086] ①Related gene testing

[0087] Na in transgenic Arabidopsis plants under salt stress + The content decreased significantly ( Figure 5 B), which may be Na + Therefore, further investigation on the Na + Inflow, Na + The expression levels of efflux and other salt stress response and antioxidant enzyme genes were identified by qRT-PCR. The detected genes and primers used are shown in Table 1.

[0088] Table 1 qRT-PCR detection primer sequences

[0089]

[0090]

[0091] The gene expression in WT was used as the reference standard, and the qRT-PCR test results were shown in Figure 6According to the test results, the internal rectification K + The channel protein gene AtAKT2 and superoxide dismutase gene AtSOD1 were significantly upregulated in transgenic plants. More importantly, Na + The expression of AtSOS2 and AtSOS3, key genes in the efflux pathway, was also significantly upregulated.

[0092] ②Verification of the transcriptional activity of AvMYB1 protein

[0093] Then, the AvMYB1-pGBKT7 vector was constructed and the transcriptional activity of the AvMYB1 protein was verified using the yeast system.

[0094] The pGBKT7 vector was used as the basic vector and the linearized vector was cut with EcoR I. The cDNA of young leaves of Apocynum venetum was used as a template and the amplification primers AvMYB1-pGBKT7-F and AvMYB1-pGBKT7-R were used to obtain the AvMYB1 gene fragment. Under the action of homologous recombinase, the AvMYB1 gene fragment was connected with the linearized vector to obtain the pAvMYB1:GUS recombinant vector.

[0095] AvMYB1-pGBKT7-F (SEQ ID NO.44):

[0096] 5′-GCATATGGCCATGGAGGCCGAATTCATGGGAATAGATCCAGTGACC-3′;

[0097] AvMYB1-pGBKT7-R (SEQ ID NO.45):

[0098] 5′-CAGGTCGACGGATCCCCGGGAATTCTTAGAACATTGCTGAACCAGAAG-3′.

[0099] The constructed AvMYB1-pGBKT7 vector and the empty vector pGBKT7 were transformed into Y2H Gold yeast cells, respectively, to obtain AvMYB1-pGBKT7 vector-transformed strains and pGBKT7 vector-transformed strains. The AvMYB1-pGBKT7 vector-transformed strains and the pGBKT7 vector-transformed strains were cultured separately to obtain strain mother solutions, recorded as 1×, and the strain mother solutions obtained in the above steps were diluted 10 times (10×) and 1000 times (1000×), respectively.

[0100] The AvMYB1-pGBKT7 vector-transfected strains and the pGBKT7 vector-transfected strains were cultured at different dilution concentrations on yeast single-deficient medium lacking Trp (tryptophan) and yeast double-deficient medium lacking Trp (tryptophan) + His (histidine). Cultivating strains at different dilution concentrations can further confirm the accuracy of the experiment and exclude false positives. The pGBKT7 vector can synthesize Trp in yeast. Since AvMYB1 has transcriptional activation activity, the AvMYB1-pGBKT7 vector can synthesize His in addition to Trp, so it can grow on double-deficient (-Trp-His) medium. In other words, the growth of yeast colonies on double-deficient (-Trp-His) medium indicates that AvMYB1 has transcriptional activation activity. The test results are as follows: Figure 6 As shown in Figure B, both the empty vector pGBKT7 and the AvMYB1-pGBKT7 vector grew colonies on the SD / -Trp medium, while only the yeast transformed with the AvMYB1-pGBKT7 vector could grow on the SD / -Trp / His medium, indicating that the AvMYB1 protein has transcriptional activation activity. + The above results suggest that the AvMYB1 gene is likely to activate the SOS pathway to excrete Na + To reduce Na + content, thereby improving the salt tolerance of plants.

[0101] ③Verification of SOS pathway activation by AvMYB1 gene

[0102] The pCAMBIA1301-CFP vector is used as a basic vector, and a MYC tag is inserted between the BamHI and Kpn I sites, and the sequence information of the MYC tag is shown in SEQ ID NO. 46. The linearized vector is cut with Kpn I; the cDNA of young leaves of Apocynum venetum is used as a template, and the AvMYB1 gene fragment is obtained using amplification primers pAvMYB1:AvMYB1:GFP-F1 (SEQ ID NO. 11) and AvMYB1-MYC-R (SEQID NO. 47); the AvMYB1 gene fragment is connected with the linearized vector under the action of a homologous recombinase to obtain a 35S::MYC-MYB1 recombinant vector.

[0103] MYC tag (SEQ ID NO.46):

[0104] 5′-ATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGCAAAAGCTC ATTTCTGAAGAGGACTTGAATGAAATGGAGCAAAAGCTTTCTGAAGAGGACTTGAATGAAATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGAGCTTGGGCGACCTCACCATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAA-3;

[0105] AvMYB1-MYC-R (SEQ ID NO.47):

[0106] 5′-GATGAGTTTCTGCTCGGTACCTTAGAACATTGCTGAACCAGAAG-3′.

[0107] The 35S::MYC-MYB1 recombinant vector obtained above was transferred into Arabidopsis to obtain an Arabidopsis overexpression strain containing a fusion of AvMYB1 protein and MYC tag, and leaves were collected for ChIP-seq analysis.

[0108] A series of qPCR primers were designed based on the MYB protein binding element "TTAGGG", and the qPCR primers are shown in SEQ ID NOs. 48 to 51:

[0109] AtSOS2-PF: 5′-CACGAGCCTTTAGGGTTCCCTA-3′ (SEQ ID NO. 48);

[0110] AtSOS2-PR: 5′-ATTCCCCTAACTGGAATTGCGAT-3′ (SEQ ID NO. 49);

[0111] AtSOS3-PF: 5′-ATCTCGTGTTAGGGCCAAAATATG-3′ (SEQ ID NO. 50);

[0112] AtSOS3-PR: 5′-TAGGCAACCCCTAAAGTTTGTCAC-3′ (SEQ ID NO. 51);

[0113] ChIP-qPCR was used to verify the enrichment of AtSOS2 and AtSOS3 gene promoters. The results are shown in Figure 6 According to C. Figure 6As can be seen from C, primers containing the "TTAGGG" element detected significant enrichment in the promoter sequences of AtSOS2 and AtSOS3, further illustrating the possibility that AvMYB1 protein improves plant salt tolerance by activating the SOS pathway.

[0114] Example 7

[0115] Previous studies [Zongchang Xu, et al. Comparative transcriptome analysis reveals the molecular mechanism of salt tolerance in Apocynum venetum, Plant Physiology and Biochemistry 167 (2021) 816-830] showed that under salt stress, Na + It is mainly enriched in the leaves and stems of Apocynum venetum and encodes the Na + / H + Antiporters and V-type H + The genes of ATPase and other proteins are upregulated, and Na + The AvMYB1 gene is stored in the vacuole, thereby improving the salt tolerance of the plant. Since the stable genetic transformation system of Apocynum venetum had not been established in the early stage of the work, the model plant Arabidopsis thaliana was used to preliminarily confirm that the AvMYB1 gene effluxes Na by regulating the SOS pathway + After enhancing the mechanism of plant salt tolerance, we further constructed the pTRV-AvMYB1 silencing expression vector and transiently transformed the leaves of Apocynum venetum seedlings, which were then subjected to stress treatment with 200 mM NaCl solution.

[0116] The pTRV1 vector was used as the basic vector, and the linearized vector was cut with EcoR I and Kpn I. The cDNA of young leaves of Apocynum venetum was used as a template, and the amplification primers AvMYB1-pTRV-F and AvMYB1-pTRV-R were used to obtain the AvMYB1 gene fragment. Under the action of homologous recombinase, the AvMYB1 gene fragment was connected with the linearized vector to obtain the pTRV-AvMYB1 recombinant vector.

[0117] AvMYB1-pTRV-F (SEQ ID NO. 52): 5′-TCTGTGAGTAAGGTTACCGAATTCATGGGAATAGATCCAGTGACC-3′;

[0118] AvMYB1-pTRV-R (SEQ ID NO. 53): 5′-GAGACGCGTGAGCTCGGTACCTTAGAACATTGCTGAACCAGAAG-3′.

[0119] The pTRV-AvMYB1 recombinant vector was used to transiently transform the leaves of Apocynum venetum seedlings, and then 200 mM NaCl solution was given for stress, which was recorded as the VIGS treatment group, VIGS-NaCl.

[0120] The Apocynum venetum seedlings were given 200 mM NaCl solution for stress, which was recorded as the untreated group, NaCl.

[0121] One week later, leaves from the VIGS-treated and untreated groups were taken for Na + Content detection and Na content detection of AvMYB1 and Apocynum SOS2 and SOS3 + The expression levels of transport-related genes were detected by qRT-PCR. + The content detection method is the same as in Example 5, and the detection results are shown in Figure 7 B in the figure, the genes and primer sequences detected by qRT-PCR are shown in Table 2, and the detection results are shown in Figure 7 A in.

[0122] Table 2 qRT-PCR detection gene primer sequences

[0123]

[0124] according to Figure 7 As shown in A, the expression of AvMYB1 gene in the VIGS treatment group was significantly downregulated, and the expression of SOS2 and SOS3 genes also decreased significantly, but AvNHX1 and Av-VtypeH + -ATPase1 gene expression did not change significantly; however, Na + The content increased significantly, about 17% higher than that of the untreated group ( Figure 7 These results indicate that when subjected to salt stress, the dominant salt tolerance mode adopted by Apocynum venetum is to convert Na + transported to the vacuole for compartmentalized storage, while on the other hand, the SOS pathway is activated to transfer part of the Na + Excreted from the body, reducing Na + The above results further confirmed that AvMYB1 cooperates with SOS3-SOS2 to efflux Na + Mechanisms for enhancing salt tolerance in Apocynum venetum.

[0125] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An AvMYB1 protein, the amino acid sequence of the AvMYB1 protein is shown in SEQ ID NO.

2.

2. An AvMYB1 gene, wherein the AvMYB1 gene is a gene encoding the AvMYB1 protein according to claim 1; the cDNA sequence of the AvMYB1 gene is shown in SEQ ID NO.

1.

3. Use of the AvMYB1 protein according to claim 1 or the AvMYB1 gene according to claim 2 in regulating plant salt tolerance.

4. The use according to claim 3, wherein the regulation comprises: Increasing the expression level of AvMYB1 protein or increasing the expression level of AvMYB1 gene can improve plant salt tolerance.

5. The use according to claim 3 or 4, characterized in that: The plants include Apocynum venetum and / or Arabidopsis thaliana.

6. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the AvMYB1 gene according to claim 2.

7. A recombinant bacterium, characterized in that: The recombinant bacteria comprises the recombinant expression vector according to claim 6.

8. Use of the AvMYB1 protein according to claim 1, the AvMYB1 gene according to claim 2, the recombinant expression vector according to claim 6, or the recombinant bacteria according to claim 7 in cultivating salt-tolerant plant varieties.

9. The use according to claim 8, characterized in that the plant comprises Apocynum venetum and / or Arabidopsis thaliana.

10. A method for improving plant salt tolerance, characterized in that: include: The recombinant expression vector according to claim 6 or the recombinant bacteria according to claim 7 is introduced into a plant.

Images