Development of novel gene editing tool suitable for plants based on Fanzor system

Abstract

The invention discloses a Fanzor system-based gene editing tool suitable for plants. The Fanzor system-based gene editing tool comprises any one of the following units: (a) pH-SpuFz1-STU: a Ubi promoter, a SpuFz1 protein coding sequence, a connection sequence, a nuclear localization signal, PolyA, omega RNA (Ribonucleic Acid) of SpuFz1, a spacer region Spacer and an rbcS-E9 terminator; (b) a pH-GtFz1-STU: Ubi promoter, a GtFz1 protein coding sequence, a connection sequence, a nuclear localization signal, PolyA, omega RNA (Ribonucleic Acid) of GtFz1, a spacer region Spacer and an rbcS-E9 terminator; (c) a pH-NlovFz2-STU: a Ubi promoter, an NlovFz2 protein coding sequence, a connection sequence, a nuclear localization signal, PolyA, omega RNA (Ribonucleic Acid) of NlovFz2, a spacer region Spacer and an rbcS-E9 terminator; and (d) a pH-MmeFz2-STU: Ubi promoter, an MmeFz2 protein coding sequence, a connection sequence, a nuclear localization signal, PolyA, omega RNA (Ribonucleic Acid) of MmeFz2, a spacer region Spacer and an rbcS-E9 terminator. Effect protein of the Fanzor system is small in size, the protein structure is simple, and carrier construction and intercellular delivery are facilitated. And the Fanzor generates a DSB notch with a sticky tail end, so that deletion and insertion of a large fragment are facilitated. The vector is simple and efficient to assemble, and the existing plant gene editing tool box is effectively expanded and supplemented.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a novel plant gene editing tool derived from eukaryotic organisms. Background Art

[0002] The CRISPR / Cas system is a gene editing tool found in bacteria and Archaea, and has attracted widespread attention in the field of genome editing in recent years. The full name of the CRISPR / Cas system is "Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR-associated protein". As a bacterial immune system, it can recognize and cut invading foreign DNA. In recent years, scientists have used the CRISPR / Cas system for genome editing. By designing specific guide RNAs, the Cas effector protein can be guided to cut at any position in the genome, and based on this, molecular machines with different functions can be integrated to achieve gene deletion, insertion and precise modification.

[0003] The CRISPR / Cas system is widely used in agriculture, medicine, basic research and other fields due to its high efficiency, precision and relatively simple operation process. The use of the CRISPR / Cas system in plants to improve and create new germplasm has gradually become a mainstream technical means accepted by breeders, but there are still many problems to be solved in its application. For example, genome off-target effects, editing events can cause genome instability, and the host's immune response to exogenous proteins can affect editing efficiency.

[0004] In 2013, Fanzor protein was reported as a protein of IS200 / IS605 transposon superfamily in eukaryotes. The structure of Fanzor is very similar to that of TnpB and Cas12. In 2023, Zhang Feng's team first discovered the RNA-guided endonuclease Fanzor system in eukaryotes and verified its in vitro cleavage activity. As a gene editing system found in eukaryotes, the discovery of Fanzor has undoubtedly further expanded the application scope of gene editing technology.

[0005] Compared with Cas proteins, Fanzor effector proteins are smaller in size and may be easier to deliver into host cells. The activity and editing characteristics of Fanzor in plant genome editing have not yet been reported. Therefore, it is necessary to develop a new plant gene editing system based on the Fanzor system and effectively improve the editing efficiency. Summary of the invention

[0006] In order to solve the above-mentioned technical problems existing in the prior art, the present application targets the three homologous proteins in the Fanzor system, optimizes the assembly method of the relevant vectors and the processing and maturation method of ωRNA, and establishes a gene editing tool based on the Fanzor system suitable for plants.

[0007] The technical solution of the present invention is as follows:

[0008] A Fanzor system suitable for plant gene editing, the system comprising any of the following units:

[0009] (1) pH-SpuFz1-STU: maize Ubi promoter, SpuFz1 protein coding sequence, linker sequence (L), nuclear localization signal (BpNLS), PolyA, SpuFz1 ω RNA, spacer, pea rbcS-E9 terminator (E9ter, Genbank: X00806.1) arranged in sequence;

[0010] or (2) pH-NlovFz2-STU: maize Ubi promoter, NlovFz2 protein coding sequence, linker sequence (L), nuclear localization signal (BpNLS), PolyA, NlovFz2 ω RNA, spacer, pea rbcS-E9 terminator (E9ter, Genbank: X00806.1);

[0011] or (3) pH-MmeFz2-STU: maize Ubi promoter, MmeFz2 protein coding sequence, linker sequence (L), nuclear localization signal (BpNLS), PolyA, MmeFz2 ω RNA, spacer, pea rbcS-E9 terminator (E9ter, Genbank: X00806.1);

[0012] Furthermore, the nucleotide sequence of SpuFz1 in unit (1) is shown as SEQ ID NO.9, and the nucleotide sequence of ωRNA of SpuFz1 is shown as SEQ ID NO.10.

[0013] Furthermore, the nucleotide sequence of NlovFz2 in unit (2) is shown as SEQ ID NO.13, and the nucleotide sequence of ωRNA of NlovFz2 is shown as SEQ ID NO.14.

[0014] Furthermore, the nucleotide sequence of MmeFz2 in unit (3) is shown as SEQ ID NO.15, and the nucleotide sequence of the ωRNA of MmeFz2 is shown as SEQ ID NO.16.

[0015] Furthermore, the linking sequence is an SGGS linking sequence.

[0016] Further, the nucleotide sequence encoding the unit (1) is shown in SEQ ID NO. 1. The 1st bp-1992 bp of the unit (1) is the maize Ubi promoter, the 2000 bp-3913 bp is the coding sequence of the SpuFz1 protein, the 3914 bp-3925 bp is the SGGS linker sequence (L), the 3926 bp-3979 bp is the BpNLS nuclear localization signal sequence (GenBank: MP587029.1), the 3980 bp-4041 bp is the PolyA sequence, the 4042 bp-4116 bp is the ω RNA sequence, and the 4144 bp-4778 bp is the pea rbcS-E9 terminator (genbank: X00806.1).

[0017] Further, the nucleotide sequence encoding the unit (2) is shown in SEQ ID NO. 3. The 1st bp-1992 bp of the unit (2) is the maize Ubi promoter, the 2000 bp-3466 bp is the coding sequence of the NlovFz2 protein, the 3647 bp-3478 bp is the SGGS linker sequence (L), the 3479 bp-3532 bp is the BpNLS nuclear localization signal sequence (GnBank: MP587029.1), the 3533 bp-3594 bp is the PolyA sequence, the 3595 bp-3737 bp is the ω RNA sequence, and the 3764 bp-4398 bp is the pea rbcS-E9 terminator (genbank: X00806.1).

[0018] Further, the nucleotide sequence encoding the unit (3) is shown in SEQ ID NO. 4. The 1st bp-1992bp of the unit (3) is the maize Ubi promoter, the 2000bp-3433bp is the coding sequence of the MmeFz2 protein, the 3434bp-3445bp is the SGGS linker sequence (L), the 3446bp-3499bp is the BpNLS nuclear localization signal sequence (GenBank: MP587029.1), the 3500bp-3561bp is the PolyA sequence, the 3562bp-3661bp is the ω RNA sequence, and the 3689bp-4323bp is the pea rbcS-E9 terminator (genbank: X00806.1).

[0019] The amino acid sequence of the SpuFz1 protein is shown in SEQ ID NO.5, the amino acid sequence of the NlovFz2 protein is shown in SEQ ID NO.7, and the amino acid sequence of the MmeFz2 protein is shown in SEQ ID NO.8.

[0020] Furthermore, the basic vector of the system is pCAMBIA1300 vector.

[0021] Furthermore, the insertion site of the system is between the Pst I and EcoR I restriction sites.

[0022] The second object of the present invention is to provide the application of the Fanzor system in gene editing.

[0023] Furthermore, the type of gene editing is polynucleotide deletion.

[0024] Further, the application in gene editing in plants;

[0025] Further, the plant is a dicotyledon or a monocotyledon;

[0026] Furthermore, the plants are rice and wheat.

[0027] As a comparative example different from the technical solution of the present invention, the present invention further provides a Fanzor system, the system comprising unit (2) pH-GtFz1-STU: a maize Ubi promoter, a GtFz1 protein coding sequence, a linker sequence (L), a nuclear localization signal (BpNLS), PolyA, a GtFz1 ω RNA, a spacer, and a pea rbcS-E9 terminator (E9ter, Genbank: X00806.1) arranged in sequence;

[0028] Furthermore, the nucleotide sequence of GtFz1 in unit (2) is shown as SEQ ID NO.11, and the nucleotide sequence of ωRNA of GtFz1 is shown as SEQ ID NO.12.

[0029] Further, the nucleotide sequence encoding the unit (2) is shown in SEQ ID NO. 2. The 1st bp-1992 bp of the unit (2) is the maize Ubi promoter, the 2000 bp-4069 bp is the coding sequence of the GtFz1 protein, the 4070 bp-4084 bp is the SGGS linker sequence (L), the 4082 bp-4135 bp is the BpNLS nuclear localization signal sequence (GenBank: MP587029.1), the 4136 bp-4197 bp is the PolyA sequence, the 4198 bp-4337 bp is the ω RNA sequence, and the 4365 bp-4999 bp is the pea rbcS-E9 terminator (genbank: X00806.1).

[0030] Furthermore, the amino acid sequence of the GtFz1 protein is shown in SEQ ID NO.6.

[0031] The rest of the construction and application of the system are the same as those of the present invention.

[0032] The Chinese meanings of the abbreviations of the relevant components of the present invention are as follows:

[0033] Ubip: maize Ubi1 promoter (GenBank: S94464.1);

[0034] L: connection sequence;

[0035] BpNLS: nuclear localization signal (GenBank: MP587029.1);

[0036] PolyA: PolyA termination signal;

[0037] ωRNA: A unique RNA sequence in the Fanzor system that guides the Fanzor protein to achieve targeted recognition;

[0038] E9t: Pea rbcS-E9 terminator (genbank: X00806.1).

[0039] Compared with the existing CRISPR / Cas gene editing technology, the technical solution of this application has the following beneficial effects:

[0040] Similar to the TnpB system, the Fanzor system effector protein is small in size (400aa-700aa) and has a relatively simple protein structure, which is conducive to the construction of the vector and the completion of intercellular delivery. The vector assembly method involved in this scheme is simple and efficient, which is a good expansion and supplement to the existing plant gene editing toolbox. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Schematic diagram of the STU vector assembly of four Fanzor proteins, among which, Figure 1 A is pH-SpuFz1-STU, Figure 1 B is pH-GtFz1-STU, Figure 1 C is pH-NlovFz2-STU, Figure 1 D is pH-MmeFz2-STU;

[0042] Figure 2 Analysis of editing products of the four Fanzor systems. DETAILED DESCRIPTION

[0043] The following embodiments of the present invention are described in conjunction with the accompanying drawings. It should be noted that the following embodiments are only used to illustrate exemplary implementations of the present invention, and are not intended to limit the present invention in any way. Those skilled in the art may make certain equivalent changes and obvious improvements to the present invention.

[0044] In the absence of other specific instructions, the operations in the following specific embodiments are all carried out by conventional operations commonly used in the art. Those skilled in the art can easily obtain guidance on such conventional operations from the prior art, and the medicinal raw materials, reagents, materials, etc. used in the following examples are all commercially available products unless otherwise specified.

[0045] Example 1

[0046] The codons of four Fanzor proteins were optimized for the rice genome. The expression of recombinant proteins was improved by changing the codons of the genes. The main principle is that different species have different codon preferences for encoding a certain amino acid, and the tRNA abundance corresponding to amino acids in different species is different. By eliminating rare codons, the expression abundance of exogenous Cas proteins in rice cells was increased. Four Fanzor protein encoding nucleic acid sequences were constructed, which are the nucleotide sequences shown in SEQ ID NO.9 to SEQ ID NO.16, respectively. First, four Fanzor-related vectors were constructed based on the STU vector. The combination of the four units that can be included in the Fanzor system is as follows: Figure 1 As shown:

[0047] Unit (1) pH-SpuFz1-STU: corn Ubi promoter, SpuFz1 coding sequence, linker sequence (L), nuclear localization signal (BpNLS), PolyA, ω RNA, spacer, pea rbcS-E9 terminator (E9ter, Genbank: X00806.1) arranged in sequence; the nucleotide encoding the unit (1) is synthesized according to the sequence shown in SEQ ID NO.1. This unit and the following units are single transcription element vectors, that is, a corn ubiquitin promoter drives Fanor protein and ω RNA skeleton.

[0048] Unit (2) pH-GtFz1-STU: corn Ubi promoter, GtFz1 coding sequence, linker sequence (L), nuclear localization signal (BpNLS), PolyA, ω RNA, spacer, pea rbcS-E9 terminator (E9ter, Genbank: X00806.1) arranged in sequence; the nucleotide encoding the unit (2) was synthesized using the sequence shown in SEQ ID NO.2 as a comparative example.

[0049] Unit (3) pH-NlovFz2-STU: corn Ubi promoter, NlovFz2 coding sequence, linker sequence (L), nuclear localization signal (BpNLS), PolyA, ω RNA, spacer, pea rbcS-E9 terminator (E9ter, Genbank: X00806.1) arranged in sequence; the nucleotides encoding the unit (3) are synthesized according to the sequence shown in SEQ ID NO.3.

[0050] Unit (4) pH-MmeFz2-STU: corn Ubi promoter, MmeFz2 coding sequence, linker sequence (L), nuclear localization signal (BpNLS), PolyA, ω RNA, spacer, pea rbcS-E9 terminator (E9ter, Genbank: X00806.1) arranged in sequence; the nucleotides encoding the unit (4) are synthesized according to the sequence shown in SEQ ID NO.4.

[0051] Example 2 Detection of editing efficiency of endogenous editing target sites in rice

[0052] According to the gene sequences of OsCDC48, OsDEP1, OsSWEET11, OsGIF1, OsGRF4, OsPDS, and OsACC in the rice genome data, editable targets (containing specific TAM sequences) that can be recognized by the Fanzor system were selected in the exon regions of the genes. The target sequences and related information are shown in Table 1.

[0053] Table 1 Rice endogenous target sequences selected for testing vector assembly formats

[0054]

[0055]

[0056] *The underlined TAM sequence is recognized by Fanzor protein

[0057] First, four reported Fanzor proteins were selected for testing. The Fanzors in the four units of Example 1 were optimized according to rice codons, and their nucleotide sequences were shown in SEQ ID NO.9, NO.11, NO.13, and NO.15, and their amino acid sequences were shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8.

[0058] The above four units were inserted into the Pst I and EcoR I restriction sites of the pCAMBIA1300 vector to construct four Fanzor systems. The connecting primers used to insert the four units into the pCAMBIA1300 vector using homologous recombinase were:

[0059] Primer F with homologous sequence upstream of the Pst I restriction site of the pCAMBIA1300 vector: CAAGCTTGCATGCCTGCAGTGCAGCGTGACCCGGTCG (SEQ ID NO. 26);

[0060] The R primer has a homologous sequence downstream of the EcoR I restriction site of the pCAMBIA1300 vector: AGCTATGACATGATTACGAATTCGTTGTCAATCAATTGGCAAGTCATAAAATGC (SEQ ID NO. 27).

[0061] The above four vector construction methods were validated for endogenous targets in rice protoplasts (Nipponbare). The experimental method was as follows: protoplasts were isolated from the japonica rice variety Nipponbare; plasmids were extracted using the Wizard Plus Midipreps DNA (Promega, Wisconsin, USA) purification system; 10 micrograms of each STU plasmid was transferred into the protoplasts by PEG-mediated transfection, and the average transformation efficiency measured by a hemocytometer was 30-45%. The transformed protoplasts were incubated at 30°C, centrifuged after 48 hours, and genomic DNA was extracted for amplicon deep sequencing to verify the editing efficiency.

[0062] The results of the second generation sequencing showed that the editing efficiencies of the NlovFz2 system including unit (3) and the MmeFz2 system including unit (4) reached 7.29% and 2.10%, respectively (the average efficiencies were 3.51% and 0.83%, respectively). The efficiency of the SpuFz1 system including unit (1) reached 2.26% (the average efficiency was 1.43%), while the GtFz1 system including unit (2) caused almost no significant editing (average 0.07%).

[0063] The editing efficiency was evaluated by Amplicon deep sequencing (Figure 1). In general, similar to their editing performance in human cells, the NlovFz2 system including unit (3) had the highest editing efficiency in rice protoplasts, while the GtFz1 system including unit (2) had almost no editing effect in rice protoplasts.

[0064] It can be seen that not every Fanzor system can effectively improve the efficiency of plant gene editing.

[0065] Analysis of editing events of different Fanzor proteins revealed that the main cause was polynucleotide deletion in rice protoplasts ( Figure 2). These results suggest that the eukaryotic Fanzor system has the potential to be developed into a new genome editing tool. Considering that Fz2 proteins exhibit better performance and a more compact structure than Fz1 proteins, they have greater potential in plant genome editing and cell delivery.

[0066] Example 3 Feasibility analysis of Fanzor system in rice genetic transformation

[0067] In order to verify the editing performance of Fanzor system in rice genetic transformation, 6 rice endogenous genes and a total of 7 target sites were selected for testing. Since GtFz1 had almost no efficiency in rice protoplast test, this implementation test only targeted the other 3 Fz proteins. All T0 generation mutants were identified by amplicon sequencing. Each transformation group targeting OsPDS gene was sequenced and the albino phenotype was observed at the same time. The results showed that the editing events triggered by Fanzor were mainly multinucleotide deletions, with the highest efficiency reaching 43.3%. The results showed that all three Fanzor systems could produce editing in rice callus, among which NlovFz2 had the best relative editing effect, and SpuFz1 and MmeFz2 also triggered comparable editing events, with the highest of 33.6% and 25.9%, respectively (Table 2). The editing activity of Fanzor system in rice regenerated plants was slightly higher than that in rice protoplasts, indicating that the editing of Fz protein in plant callus is a continuous process.

[0068] Table 2 Editing efficiency and editing event statistics of the three Fanzor systems in regenerated rice plants

[0069]

[0070] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A Fanzor system suitable for plant gene editing, characterized in that: The system includes any of the following units: (1) pH-SpuFz1-STU: maize Ubi promoter, SpuFz1 protein coding sequence, linker sequence (L), nuclear localization signal (BpNLS), PolyA, SpuFz1 ω RNA, spacer, pea rbcS-E9 terminator (E9ter, Genbank: X00806.1) arranged in sequence; or (2) pH-NlovFz2-STU: maize Ubi promoter, NlovFz2 protein coding sequence, linker sequence (L), nuclear localization signal (BpNLS), PolyA, NlovFz2 ω RNA, spacer, pea rbcS-E9 terminator (E9ter, Genbank: X00806.1); Or (3) pH-MmeFz2-STU: the maize Ubi promoter, MmeFz2 protein coding sequence, linker sequence (L), nuclear localization signal (BpNLS), PolyA, MmeFz2 ω RNA, spacer, and pea rbcS-E9 terminator (E9ter, Genbank: X00806.1) are arranged in sequence.

2. The Fanzor system according to claim 1, characterized in that The nucleotide sequence of SpuFz1 in unit (1) is shown as SEQ ID NO.9, and the nucleotide sequence of ωRNA of SpuFz1 is shown as SEQ ID NO.

10.

3. The Fanzor system according to claim 1, characterized in that The nucleotide sequence of NlovFz2 in unit (2) is shown in SEQ ID NO.13, and the nucleotide sequence of ω RNA of NlovFz2 is shown in SEQ ID NO.

14.

4. The Fanzor system according to claim 1, characterized in that The nucleotide sequence of MmeFz2 described in unit (3) is shown in SEQ ID NO.15, and the nucleotide sequence of the ω RNA of MmeFz2 is shown in SEQ ID NO.

16.

5. The Fanzor system according to claim 1, characterized in that The linking sequence is an SGGS linking sequence.

6. The Fanzor system according to claim 1, characterized in that The nucleotide sequence encoding the unit (1) is shown in SEQ ID NO.

1.

7. The Fanzor system according to claim 1, characterized in that The nucleotide sequence encoding the unit (2) is shown in SEQ ID NO.

3.

8. The Fanzor system according to claim 1, characterized in that The nucleotide sequence encoding the unit (3) is shown in SEQ ID NO.

4.

9. The Fanzor system according to claim 1, characterized in that The basic vector of the system is pCAMBIA1300 vector.

10. The Fanzor system according to claim 9, characterized in that The insertion site of the system is between the Pst I and EcoR I restriction sites.

11. Use of the Fanzor system of claim 1 in gene editing.

Images