Plant growth promoting arachnostoma spp. Strain D1-4, bacterial fertilizer, soil conditioner and application of arachnostoma spp. Strain D1-4

Abstract

The invention provides a Conostachys aranearum strain D1-4, a bacterial fertilizer, a soil conditioner and application of the Conostachys aranearum strain D1-4, and belongs to the technical field of microorganisms. The preservation number of the spider cladostachys spp. Strain D1-4 is CGMCC (China General Microbiological Culture Collection Center) No. 41141. The arachnostoma spp. Strain D1-4 promotes agglomeration of saline-alkali soil by secreting an extracellular polymer uronic acid, so that the living environment of plants is effectively improved; in addition, the spider cladosmus sp. Strain D1-4 can also improve the stress resistance of the plant to a saline-alkali environment and effectively promote the growth of the plant; in addition, the arachnostoma spp. Strain D1-4 has relatively strong alkali resistance, can be applied to farmland with medium saline-alkali degree, and is relatively wide in application range.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a Clonostachys aranearum strain D1-4 for promoting plant growth, a bacterial fertilizer, a soil conditioner and applications thereof. Background Art

[0002] China has rich and widely distributed saline soil resources. The physical and chemical properties of saline-alkali soil are poor, and the utilization rate is low. Excessive alkaline salt makes it difficult for nutrients to be absorbed by crops, which is not conducive to plant growth. Therefore, promoting the elimination of saline-alkali obstacles and plant growth is of great significance to improving the utilization rate of saline-alkali land. At present, microorganisms are widely studied and used in improving soil and promoting plant growth. However, in the prior art, the biological activity of most microorganisms in saline-alkali environments is severely restricted and cannot play a role in saline-alkali environments. Therefore, screening strains that still have the effect of improving soil and promoting plant growth in saline-alkali environments has positive significance.

[0003] Spider fungi were originally considered to be a type of fungi pathogenic to spiders. Due to their special nutritional preferences and unique hosts, they have unique metabolites. In recent years, some valuable bioactive substances such as extracellular macromolecular polymers, very rare sterols and triterpenoid natural compounds have been found in members of spider fungi, which have high medicinal value. Clonostachys aranearum is a new species of spider fungi belonging to the genus Clonostachys. There is no record in the prior art that Clonostachys aranearum can promote plant growth and resist salt-alkali stress. Summary of the invention

[0004] The invention aims to provide a Cladosporium spiderii strain D1-4, which has strong alkali resistance and can effectively improve soil, and at the same time can also improve the stress resistance of plants to saline-alkali environment and promote plant growth.

[0005] The invention provides a Clonostachys aranearum strain D1-4, and the preservation number of the Clonostachys aranearum strain D1-4 is CGMCC No.41141.

[0006] The present invention provides a fermentation product and / or metabolite of the Cladosporium arachnoidum strain D1-4.

[0007] The invention provides a bacterial fertilizer, comprising the Cladosporium arachnoidum strain D1-4 or the fermentation product and / or metabolite and auxiliary materials.

[0008] The invention provides a soil conditioner, comprising the Cladosporium arachnoidum strain D1-4 or the fermentation product and / or metabolite and auxiliary materials.

[0009] The present invention provides the use of the Cladosporium arachnoidum strain D1-4, the fermentation product and / or metabolite, the bacterial fertilizer or the soil conditioner in improving the plant living environment and / or plant planting.

[0010] Preferably, the improving the plant living environment includes promoting soil aggregation and / or reducing the soluble ion concentration (EC) in the environment.

[0011] Preferably, the plant planting includes promoting plant growth and / or improving plant resistance to salt and alkali.

[0012] Preferably, the promoting plant growth includes promoting the growth of the above-ground part and / or underground part of the plant.

[0013] Preferably, the improving the salt-alkali resistance of plants includes at least one of the following: increasing the proline content in plant roots, promoting the excretion of sodium ions from plant roots, and increasing the chlorophyll content in plant leaves.

[0014] Preferably, the plants include food crops and / or cash crops.

[0015] Beneficial effects:

[0016] The invention provides a Clonostachys aranearum strain D1-4, with a deposit number of CGMCC No. 41141. The Clonostachys aranearum strain D1-4 has strong alkali resistance and can still maintain a high growth rate when the pH value is 10.33; the Clonostachys aranearum strain D1-4 can promote the aggregation of saline-alkali soil by secreting extracellular polymer uronic acid and promote the formation of large aggregates of saline-alkali soil; the Clonostachys aranearum strain D1-4 can reduce the sodium ion concentration in the matrix and improve the plant growth environment; the Clonostachys aranearum strain D1-4 is inoculated into the plant growth environment to improve the plant's resistance to the saline-alkali environment and promote the growth of the plant.

[0017] The present invention provides the application of the spider clematis strain D1-4, the fermentation product and / or metabolite, the bacterial fertilizer or the soil conditioner in improving the living environment of plants and / or plant planting. The present invention conducts an experiment in which the spider clematis strain D1-4 is inoculated into the soil. The results show that the inoculation of the spider clematis strain D1-4 can significantly increase the content of uronic acid in the soil, and significantly increase the proportion of large aggregates in the soil, and improve the aggregate MWD and GWD index, indicating that the clematis fungus D1-4 promotes the formation of large aggregates in saline-alkali soil by secreting extracellular polymer uronic acid. The present invention determines the effect of the spider clematis strain D1-4 on the sodium ion content in the soil environment. The results show that the spider clematis strain D1-4 can significantly reduce the soluble ion concentration and sodium ion content in the soil environment. In addition, the present invention also determines the effect of the spider cleavage mold strain D1-4 on the growth of plants in saline-alkali soil. The results show that the spider cleavage mold strain D1-4 has strong alkali resistance, can be applied to farmland with medium saline-alkali degree, has the ability to promote the growth of rice roots in a saline-alkali environment, can improve the root system and root surface area of ​​rice, and improve the stress resistance of rice by increasing the proline content. At the same time, it can optimize the composition of the cell wall of the corn root system, promote the excretion of sodium ions from the corn root system, and increase the relative content of chlorophyll (SPAD) in the leaves, thereby promoting the growth of corn. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The microstructure of Cladosporium arachnoidum strain D1-4, where the scale bar is 50 μm;

[0019] Figure 2 The phylogenetic tree of Cladosporium arachnoidum strain D1-4 constructed based on ITS sequences;

[0020] Figure 3 : The colony growth morphology of the spider cleavage mold strain D1-4 under different pH conditions, wherein a, b and c are the colony growth morphology of the spider cleavage mold strain D1-4 under pH values ​​of 8.02, 9.33 and 10.33, respectively;

[0021] Figure 4 This is a graph showing the growth of Cladosporium arachnoidum strain D1-4 on saline-alkali soil substrate;

[0022] Figure 5 The diagrams are the growth conditions of rice in saline-alkali soil in different treatment groups of Example 5, wherein the left diagram is the growth condition diagram of rice in the blank control group, and the right diagram is the growth condition diagram of rice in the experimental group;

[0023] Figure 6 The growth condition diagrams of corns in saline-alkali soil of different treatment groups in Example 6 are shown in Figures 1, 2 and 3 are the growth condition diagrams of blank control corns, and Figures 4, 5 and 6 are the growth condition diagrams of corns in the experimental group;

[0024] Figure 7 This is the non-damage micro-measurement data of sodium ions in the roots of corn in different treatment groups in Example 6.

[0025] Biomaterial Deposit Information

[0026] The Clonostachys aranearum strain was deposited in the General Microbiology Center of the China Culture Collection Administration on April 2, 2024. The abbreviation of the unit is Institute of Microbiology, Chinese Academy of Sciences, and the address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC No.41141 and the strain number is D1-4. DETAILED DESCRIPTION

[0027] The invention provides a Clonostachys aranearum strain D1-4, whose deposit number is CGMCC No.41141.

[0028] In the present invention, the spider claudiceae strain D1-4 is isolated from the saline-alkali land of Songnen Plain in Northeast China. The spider claudiceae strain D1-4 grows on potato dextrose agar (PDA) medium, and the colonies formed are white, with irregular edges and underdeveloped aerial hyphae. The microstructure is shown in FIG. Figure 1After culturing and maturing, the surface of the colony has wrinkles. The ITS sequence of the strain D1-4 is as shown in SEQ ID NO: 1 (GAGGGGATTCCGAAGTTTTCACTCCCAACCCATGTGAACATACCTACTGT TGCTTCGGCGGGATTGCCCCGGGCGCCTCGTGTGCCCCGGATCAGGCGCCCGCCTAGGAAACTTAACTCTTGTTTTATTTTGGAATCTTCTGAGTAGTTTTTACAAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGC The results of morphological characteristics and molecular identification showed that the strain D1-4 was Clonostachys aranearum.

[0029] The present invention provides a fermentation product and / or metabolite of the Cladosporium arachnoidum strain D1-4.

[0030] In the present invention, the fermented product is preferably prepared by the following method: the spider clematis strain D1-4 is inoculated into a potato dextrose agar (PDA) medium for static culture to obtain an activated mycelium block, and the activated mycelium block is cultured in potato dextrose water (PD) to obtain a fermented product. The temperature of the static culture and the culture is preferably 23-28°C, more preferably 24-26°C, and most preferably 25°C, and the time is independently preferably 3-8d, more preferably 4-6d, and most preferably 5d. The components of the PDA medium preferably include 180-220g of potatoes, 18-22g of glucose, and 18-22g of agar per 1000mL of deionized water, and more preferably include 200g of potatoes, 20g of glucose, and 20g of agar; the pH value of the PDA medium is preferably 6-9, more preferably 6.5-8, and most preferably 7. The components of the PD are preferably based on the components of the PDA medium without agar. The metabolite is preferably prepared by the following method: filtering the fermented product and separating the liquid phase, wherein the liquid phase is the metabolite. The effective viable count of the spider schizont strain D1-4 per milliliter of the fermented product is preferably not less than 10 4 The copy number is preferably 10 5 ~10 8 The copy number is preferably 10 6 Copy number.

[0031] The spider cloverleaf mold strain D1-4 of the present invention has strong alkali resistance and can still maintain a high growth rate when the pH value is 10.33; the spider cloverleaf mold strain D1-4 can promote the agglomeration of saline-alkali soil by secreting extracellular polymer uronic acid, and promote the formation of large agglomerates of saline-alkali soil; the spider cloverleaf mold strain D1-4 is inoculated into a matrix, so as to reduce the sodium ion content in the matrix and improve the plant growth environment; the spider cloverleaf mold strain D1-4 is inoculated into a plant growth environment, so as to improve the stress resistance of the plant to the saline-alkali environment and promote the growth of the plant.

[0032] Based on the property of strain D1-4 in promoting plant growth, the present invention provides a bacterial fertilizer, comprising the Cladosporium arachnoidum strain D1-4 or the fermentation product and / or metabolite and auxiliary materials.

[0033] In the present invention, the effective viable count of the spider schizont strain D1-4 per gram of the bacterial fertilizer is preferably not less than 10 4 The copy number is preferably 10 5 ~10 8 The copy number is preferably 10 6The number of copies; the preparation method of the bacterial fertilizer is not particularly limited, and the preparation scheme of the bacterial fertilizer well known in the art can be used, for example, the activated and expanded spider schizont strain D1-4 is mixed with auxiliary materials. The present invention does not specifically limit the components of the auxiliary materials, and the auxiliary materials of the bacterial fertilizer well known in the art can be used, such as macroelements, secondary elements, trace elements, and components that promote soil aggregate formation, reduce soil compaction, etc.

[0034] Based on the property of strain D1-4 in improving the plant growth environment, the present invention provides a soil conditioner, comprising the spider cleavage mold strain D1-4 or the fermentation product and / or metabolite and auxiliary materials.

[0035] In the present invention, the effective viable count of the spider schizont strain D1-4 per gram of the soil conditioner is preferably not less than 10 4 The copy number is preferably 10 5 ~10 8 The copy number is preferably 10 6 The present invention has no special restrictions on the preparation method of the soil conditioner, and the soil conditioner preparation scheme known in the art can be adopted, for example, the activated and expanded Cladosporium arachnoidum strain D1-4 is mixed with auxiliary materials to obtain the soil conditioner.

[0036] The present invention provides the use of the Cladosporium arachnoidum strain D1-4, the fermentation product and / or metabolite, the bacterial fertilizer or the soil conditioner in improving the plant living environment and / or plant planting.

[0037] In the present invention, the plants preferably include food crops and / or cash crops. The food crops preferably include any one of the following: wheat, rice, corn, oats, rye, barley, millet, sorghum and highland barley. The cash crops preferably include any one of the following: vegetable crops, fiber crops, oil crops, sugar crops, beverage crops and medicinal crops. The pH value of the plant's living environment or planting matrix is ​​preferably 5 to 9.2, more preferably 8 to 9.1, and most preferably 9. The salt content of the plant's living environment or planting matrix preferably includes 0.05% to 0.2%, more preferably 0.08% to 0.12%, and most preferably 0.1%.

[0038] In the present invention, the improving the plant living environment preferably includes promoting soil aggregation and / or reducing the concentration of soluble ions in the environment.

[0039] In the present invention, the matrix of the plant living environment preferably includes ordinary soil or saline-alkali soil. The saline-alkali soil preferably contains the following components: total nitrogen 0.45-0.5g / kg, alkaline nitrogen 40-50mg / kg, available phosphorus 15-20mg / kg, available potassium 140-160mg / kg, organic matter 10-11g / kg, salt concentration 0.9-1.1g / kg, pH=8.5-9.5; more preferably: total nitrogen 0.47g / kg, alkaline nitrogen 46.50mg / kg, available phosphorus 17.50mg / kg, available potassium 153mg / kg, organic matter 10.58g / kg, salt concentration 1.08g / kg, pH=9.16.

[0040] One embodiment of the present invention determines the effect of spider clematis strain D1-4 on soil agglomeration, and the results show that compared with the control, spider clematis strain D1-4 significantly increases the proportion of large aggregates in the soil, and improves the aggregate MWD and GWD indexes, indicating that the inoculation of spider clematis strain D1-4 has a significant effect on promoting soil agglomeration. The present embodiment further determines the content of extracellular polymers in the soil after inoculation of spider clematis strain D1-4. The results show that compared with the control, spider clematis strain D1-4 can significantly increase the content of uronic acid in the soil, indicating that the strain promotes the formation of large aggregates in saline-alkali soil to a certain extent by secreting extracellular polymer uronic acid. One embodiment of the present invention determines the sodium ion content in the environment of spider clematis strain D1-4, and the results show that compared with the control, spider clematis strain D1-4 can significantly reduce the soluble ion concentration and sodium ion content in the environment.

[0041] In the present invention, the promoting of plant planting preferably includes promoting plant growth and / or improving plant resistance to salt and alkali. The promoting of plant growth preferably includes promoting the growth of the above-ground part and / or underground part of the plant.

[0042] In the present invention, the improving of the salt-alkali resistance of plants preferably includes at least one of the following: increasing the proline content in plant roots, promoting the discharge of sodium ions from plant roots, and increasing the chlorophyll content in plant leaves.

[0043] One embodiment of the present invention determines the effect of spider cleavage mold strain D1-4 on rice growth in saline-alkali soil. The results show that the root length, root surface area, root volume, and root tip number of rice inoculated with spider cleavage mold strain D1-4 are significantly increased compared with the control group, and the fresh weight of the aboveground part of rice, the fresh weight of the root, and the plant height are extremely significantly increased, indicating that spider cleavage mold strain D1-4 can increase the biomass of plants in saline-alkali environments. Compared with the control group, the proline and malondialdehyde contents of rice roots inoculated with spider cleavage mold strain D1-4 are extremely significantly increased, indicating that spider cleavage mold strain D1-4 increases the osmotic pressure of the cell sap of the rice root system and enhances its salt-alkali resistance.

[0044] In one embodiment of the present invention, the effect of spider cleavage mold strain D1-4 on the growth of corn in saline-alkali soil was determined. The results showed that the spider cleavage mold strain D1-4 group can significantly promote the growth of corn plants and the chlorophyll content therein compared with the control group. The increase in chlorophyll content can enhance the plant's antioxidant and anti-mutation capabilities, thereby adapting corn to growth in a saline-alkali environment; compared with the control group, the sodium ion efflux of the spider cleavage mold strain D1-4 was significantly greater than the internal absorption, which can enhance the sodium excretion ability of the corn root system in a saline-alkali soil environment and improve the growth of rice in saline-alkali soil; compared with the control group, the cellulose of corn root cells in the spider cleavage mold strain D1-4 group increased by 24.21%, the lignin decreased by 25.32%, and the total pectin increased by 33.38%, indicating that the spider cleavage mold strain D1-4 can optimize the composition of the corn root cell wall.

[0045] In the present invention, the method for using the spider clematis strain D1-4, the fermentation product and / or metabolite, the bacterial fertilizer or the soil conditioner in improving the plant living environment and / or plant planting is preferably: applying the fermentation product and / or metabolite of the spider clematis strain D1-4, the bacterial fertilizer or the soil conditioner to the roots of plants. The effective viable bacterial count of the spider clematis strain D1-4 is preferably not less than 10 4 The number of copies / g is preferably 10 5 ~10 8 The number of copies / g is preferably 10 6 Copy number / g.

[0046] To further illustrate the present invention, the spider cleavage mold strain D1-4, bacterial fertilizer, soil conditioner and application thereof provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0047] Medium composition and preparation of mycelial blocks

[0048] Preparation of potato dextrose agar (PDA) medium: 200 g of potato, 20 g of glucose and 20 g of agar were included in every 1000 mL of deionized water.

[0049] Preparation method of mycelium block of spider cleavage mold strain D1-4: pick up mycelium of spider cleavage mold strain D1-4 in a clean bench and place it in a PDA plate culture medium with pH 7.0 for activation, and culture it upright at 25° C. in the dark for 5 days, and use a puncher of corresponding size to punch holes to obtain mycelium blocks.

[0050] Preparation method of blank agar block: Pour the prepared PDA culture medium into the culture dish, and after condensation, an agar block with a thickness of 0.3 cm is obtained. The PDA flat culture dish is cultured upright at 25°C in the dark for 5 days to obtain a blank agar block. Use a puncher of corresponding size to punch holes to obtain a blank agar block.

[0051] Preparation method of Laburnicola dactylidis D1-1 mycelium block: the same as the preparation method of the mycelium block of the spider cleavage mold strain D1-4, the only difference is that the mycelium picked is the Laburnicola dactylidis D1-1 mycelium block. The Laburnicola dactylidis D1-1 strain was isolated from saline-alkali soil and preserved for a long time by the farmland productivity green regulation and functional fertilizer research group of the College of Resources and Environment of Henan Agricultural University.

[0052] Example 1

[0053] Screening method for Cladosporium arachnoidum strains

[0054] The strain D1-4 was isolated from the saline-alkali land of Songnen Plain in Northeast China by the traditional dilution plate method, and all the culture media used for the isolation were red Bengal culture media.

[0055] The microscopic structure of strain D1-4 is shown in Figure 1 The colonies of strain D1-4 were white with irregular edges and underdeveloped aerial hyphae. After maturity, the colony surface had wrinkles.

[0056] Molecular identification of strain D1-4: DNA of strain D1-4 was extracted and amplified by PCR using ITS-F and ITS-R primers. The ITS sequence was obtained by sequencing as shown in SEQ ID NO: 1 (GAGGGGATTCCGAAGTTTTCACTCCCAACCCATGTGAACATACCTACTGT TGCTTCGGCGGGATTGCCCCGGGCGCCTCGTGTGCCCCGGATCAGGCGCCCGCCTAGGAAACTTAACTCTTGTTTTATTTTGGAATCTTCTGAGTAGTTTTTACAAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCTGAGCG The phylogenetic tree was constructed by BLAST comparison with the sequence in the GenBank database using the neighbor-joining method in Mega 7 software. The phylogenetic tree is shown in the figure. Figure 2 shown.

[0057] Combined with phylogenetic tree analysis, morphological analysis and physiological and biochemical characteristics of the strain, strain D1-4 was identified as Clonostachys aranearum. Clonostachys aranearum strain D1-4 was sent to the General Microbiological Center of China Microbiological Culture Collection on April 2, 2024, with the deposit number CGMCC No.41141. The address of the collection center is Institute of Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0058] Example 2

[0059] Growth rate of Cladosporium arachis strain D1-4 at different pH values

[0060] 1) Make plates with different pH values

[0061] Prepare the culture medium with the supernatant of different saline-alkali soils to obtain culture medium with different pH values. The specific operation is: select 200g of soda-alkali soil with low, medium and high salinity, add it to 1500mL of distilled water, stir for 30 minutes, and filter the supernatant. Use the supernatant to prepare PDA culture medium. The formula is as follows: 200g of potato, 20g of glucose, 20g of agar, and obtain culture medium with pH values ​​of 8.02, 9.33, and 10.33. Pack it in a triangular bottle, mark and classify it, seal it with sealing film and newspaper, and sterilize it with high-pressure steam at 121℃ for 15 minutes. In the clean bench, pour the culture medium with different pH values ​​into a 70mm diameter plate, control the thickness of the culture medium to be basically consistent, and cool it until solidified.

[0062] 2) Inoculation of Cladosporium arachidum strain

[0063] A mycelium block of the spider dactylidis strain D1-4 with a diameter of 0.8 cm was inoculated into the center of a culture medium with different pH values ​​and cultured upright at 25°C in the dark. Three replicates were made for each treatment. The mycelium block of Laburnicola dactylidis D1-1 was used as the control for the D1-1 strain. When the colony was about to fill the plate, its diameter was measured, and the culture time was recorded to calculate the growth rate of the bacteria. SPSS20.0 statistical software was used for analysis. The experimental data were expressed as "mean ± standard error". Tukey sb (K) was used to test the homogeneity of the data. The colony morphology of the spider dactylidis strain D1-4 under different pH conditions is shown in Figure 2. Figure 3 , the statistical results of mycelium growth rate under different pH conditions are shown in Table 1. As can be seen from Table 1, the spider clover strain D1-4 has a higher growth rate under alkaline conditions, which is about 3 times that of the D1-1 strain control. Even though its growth rate decreases with the further increase of pH value, compared with the culture environment of pH 8.02, the mycelium growth rate in the pH 9.33 environment decreases by 7.19%, and the mycelium growth rate in the pH 10.33 environment decreases by 18.66%. This shows that the spider clover strain D1-4 has a strong alkali resistance and can be used in farmland with medium saline-alkali levels.

[0064] Table 1 Mycelial growth rate under different pH conditions

[0065] deal with D1-4 mycelium growth rate mm / h D1-1 mycelium growth rate mm / h pH 8.02 0.207±0.010c 0.088±0.009c pH 9.33 0.192±0.003b 0.067±0.013b pH 10.33 0.168±0.005a 0.060±0.050a

[0066] Note: Different letters represent significant differences at the P=0.05 level.

[0067] Example 3

[0068] Effect of Cladosporium arachis strain D1-4 on promoting aggregate formation in saline-alkali soil

[0069] Preparation of soil matrix: Saline-alkali soil with a pH value of 9.16 was passed through a 100-mesh sieve, and corn stalks were passed through a 75-mesh sieve and sterilized with high-pressure steam. The sterilized saline-alkali soil and corn stalks were mixed in a clean bench at a mass ratio of 100:1, and distributed onto flat plates (15 g per plate). The moisture content was adjusted to 60% to simulate field water holding capacity to obtain the soil matrix.

[0070] Experimental group: A 1-cm-diameter agar mycelium block of Cladosporium fungus D1-4 was inoculated in the center of the soil matrix, 0.5 mL of PD culture solution was dripped around the mycelium block, and cultured under sterile constant temperature conditions of 25°C.

[0071] Blank control: The treatment method was the same as the experimental group, the only difference being that the soil matrix was not sterilized during preparation, and a blank agar block was implanted in the center of the non-sterilized soil matrix containing the indigenous microbial community.

[0072] D1-1 strain control: The treatment method was the same as the experimental group, the only difference being that a Laburnicoladactylidis D1-1 agar mycelium block was inoculated in the center of the soil matrix.

[0073] The growth of Cladosporium arachis strain D1-4 on saline-alkali soil substrate is shown in Figure 4 .

[0074] Twenty plates were used for each treatment, and the soil aggregate content and the amount of extracellular polymers produced in each treatment group were measured after 20 days of cultivation.

[0075] The determination method of soil aggregate content in each treatment group is as follows:

[0076] After 20 days of cultivation, 15 plates were randomly selected from each treatment group for natural air drying. The air-dried soil culture medium was randomly divided into three groups and placed in ziplock bags for aggregate component screening. The method was as follows: 50.00 g of soil sample was accurately weighed, placed on a 1 mm sieve, and distilled water was added to cover the soil sample and then allowed to stand for 3 min. The soil sample was vibrated for 2 min with an amplitude of 3 cm, and the sieve was moved up and down once, with a frequency of 30 times / min. Then the soil sample on the sieve was transferred, and then sieved and transferred through 0.25 mm and 0.053 mm sieves in turn (the above operation was repeated three times in parallel). The sieved components were dried and weighed, and the data were recorded. The average weight diameter was calculated according to formula I, and the geometric mean diameter was calculated according to formula II.

[0077]

[0078] Where MWD is the mean weight diameter, is the average diameter of the i-th level soil aggregates (mm); W i is the mass percentage (%) of the corresponding size aggregates in the total aggregates; n is the number of separated aggregates.

[0079]

[0080] Where GWD is the geometric mean diameter, is the average diameter of soil aggregates of the ith particle size (mm); W i is the mass percentage (%) of the corresponding size aggregates in the total aggregates; n is the number of separated aggregates.

[0081] SPSS20.0 statistical software was used for analysis, and the experimental data were expressed as "mean ± standard error". The results of soil aggregate content determination in each treatment group are shown in Table 2. As shown in Table 2, the proportion of large aggregates in the experimental group increased by 73.0% compared with the D1-1 strain control. At the same time, the average mass diameter (MWD) and geometric mean diameter (GWD) of aggregates in the experimental group increased significantly compared with the blank control and the D1-1 strain control, indicating that the inoculation of the genus Cladosporium D1-4 has a significant effect on promoting soil aggregation.

[0082] Table 2 Determination of soil aggregate content in each treatment group

[0083]

[0084] Note: Different small letters represent significance at the p≤0.05 level.

[0085] The method for determining the extracellular polymer production capacity of each treatment group is as follows:

[0086] (1) Extraction of extracellular polymers: After 20 days of cultivation, 3 g of fresh soil samples from 5 plates were taken from each treatment group and placed in a 50 mL polypropylene centrifuge tube. 30 mL of 0.1 M CaCl 2 The solution was mixed evenly to remove soluble organic matter in the soil. The centrifuge tube was placed in ice, vibrated back and forth at 120 rpm for 2 hours, centrifuged at 3200 g for 30 minutes, and the supernatant was discarded. 15.98 g of sodium ion exchange resin CER and 25 mL of buffer were added to the precipitate, vibrated back and forth at 120 rpm for 2 hours, and then centrifuged at 4000 g for 30 minutes. The supernatant containing extracellular polymers was transferred to a new test tube, quickly frozen in liquid nitrogen, and stored at -80 °C for later use. Three sets of parallel experiments were repeated.

[0087] The preparation method of the buffer solution is to contain 0.76g Na 3 PO 4 12H 2 O, 0.552 g NaH 2 PO 4 ·H 2O, 0.526 g NaCl, 0.0746 g KCl, adjust the pH to 7.0 with 1 M HCl solution, and precool at 4 °C.

[0088] (2) Determination of extracellular polymer uronic acid: Take 200 μL of the supernatant containing extracellular polymers, add 1.2 mL of 0.0125 M sodium tetraborate solution (prepared with concentrated sulfuric acid), and vortex for 45 seconds. Place in a 100°C water bath for 5 minutes and cool on ice. After 3 minutes, add 20 μL of 0.15% (v / v) m-m-hydroxybiphenyl solution (the solvent is 0.5% sodium hydroxide solution). Shake gently to mix the solution and let it stand for 4 minutes. Take a sample of 200 μL and use an ELISA reader to measure the absorbance at 520 nm.

[0089] Method for preparing the standard curve: 0, 4, 20, 60, 100 and 200 μL of 25 μg / mL D-glucronic acid stock solution were respectively drawn, and the volume was supplemented to 200 μL with deionized water for reaction and colorimetry.

[0090] (3) Determination of extracellular polymer humic acid: prepare two plates, marked as A and B plates. Add 100 μL of the supernatant containing extracellular polymers to each well of plate A, then add 100 μL of solution A, and mix the solution by vertically aspirating with a pipette; add the same volume of solution B to plate B, and perform other operations the same as plate A. Repeat 3 times for each sample in plates A and B. After placing the two plates in a dark environment for 10 minutes, immediately add 100 μL of Folin reagent to terminate the reaction to reduce time error. After standing for 30 minutes, use an ELISA reader to measure the absorbance at 750 nm.

[0091] Prepare Folin solution: 2N Folin solution, dilute 10 times with deionized water for later use. Prepare Solution A: weigh 3.5 g of copper sulfate pentahydrate and dissolve it in 100 mL of water to obtain Solution (a); weigh 7.0 g of potassium sodium tartrate and dissolve it in 100 mL of water to obtain Solution (b); weigh 70 g of sodium carbonate and dissolve it in 1 L of 0.35 N sodium hydroxide solution to obtain Solution (c); mix Solution (a), Solution (b) and Solution (c) in a ratio of 1:1:100 (5 mL, 5 mL, 500 mL) to obtain Solution A.

[0092] Prepare Solution B by mixing 5 mL, 5 mL and 500 mL of deionized water, Solution (b) and Solution (c).

[0093] The humic acid content was calculated according to formula III.

[0094] Humic acid content = 1.25Abs B-0.25Abs A Formula III

[0095] Where Abs B represents the absorbance of plate B, and AbsA represents the absorbance of plate A.

[0096] Method for preparing humic acid standard curve: 0.04g humic acid was diluted to 100mL with deionized water. Three replicates were set for each group. 0μL, 25μL, 50μL, 75μL, and 100μL of bovine serum albumin solution and humic acid solution were added to different wells of two plates, and the buffer was added to 100μL. The other steps were repeated for the sample determination, and the reaction and colorimetry were performed.

[0097] SPSS20.0 statistical software was used for analysis, and the experimental data were expressed as "mean ± standard error". The results of the determination of the extracellular polymer content of each group are shown in Table 3. As shown in Table 3, after the inoculation of the spider schizont strain D1-4, the content of uronic acid in the soil was significantly higher than that of the blank control and the D1-1 strain control, with an increase of 26.9-33.3%; while the humic acid content was not significantly different from that of the blank control and the D1-1 strain control, indicating that the bacteria promoted the formation of large aggregates in saline-alkali soil to a certain extent by secreting extracellular polymer uronic acid.

[0098] Table 3 Determination of extracellular polymer content in soil of each treatment group

[0099] deal with Uronic acid content (mg / kg) Humic acid content (mg / kg) Experimental Group 72.75±8.40a 159.98±16.94a Blank control 57.34±0.60b 171.35±18.73a D1-1 strain control 54.56±7.13b 163.67±12.78a

[0100] Note: Different small letters represent significance at the p≤0.05 level.

[0101] Example 4

[0102] Function of Cladosporium arachis strain D1-4 in alleviating soil salinity and alkali stress

[0103] Preparation of liquid soil matrix: The soil sample was selected from Northeast saline-alkali soil, with a total nitrogen content of 0.47 g / kg, alkaline nitrogen content of 46.50 mg / kg, available phosphorus content of 17.50 mg / kg, available potassium content of 153 mg / kg, organic matter content of 10.58 g / kg, pH = 9.16, and soil salt content of 1.08 g / kg. Pass through a 20-mesh sieve, weigh 40 g of soil sample, put it into a 250 ml conical flask, add 100 ml of sterile water, seal the upper opening with sealing film and newspaper, and sterilize it with high-pressure steam at 121°C for 5 minutes.

[0104] Experimental group: The agar mycelium block of Cladosporium arachnoides strain D1-4 was inoculated into the prepared soil liquid culture medium with an inoculation shovel. After sealing, the flask was shaken for ten seconds and placed on the table at room temperature of 25°C for 13 days, with three replicates.

[0105] Blank control: The treatment method is the same as the experimental group, the only difference is that the blank agar block is inoculated into the prepared soil liquid culture medium with an inoculation shovel.

[0106] D1-1 strain control: The treatment method was the same as the experimental group, except that the Laburnicola dactylidis D1-1 agar mycelium block was inoculated into the prepared soil liquid culture medium with an inoculation shovel.

[0107] After the culture of each treatment group was completed, the supernatant in the culture medium was carefully collected in a clean bench, and its pH value, EC and sodium ion content were determined. The sodium ion content was determined by a flame photometer. After collecting the supernatant, the triangular flask was sealed with a sealing film to obtain the saline-alkali soil improved by D1-4, the saline-alkali soil treated blank and the saline-alkali soil improved by D1-1 for use.

[0108] SPSS20.0 statistical software was used for analysis, and the experimental data were expressed as "mean ± standard error". The pH value, EC and sodium ion content of the filtrate of each treatment group are shown in Table 4. As shown in Table 4, compared with the blank control, after inoculation with the spider clematis strain D1-4, the EC value and sodium ion content of the filtrate decreased significantly, among which the EC value of the filtrate decreased by 14.53% and the sodium ion content decreased by 16.3%. Based on this analysis, inoculation with the spider clematis strain D1-4 can reduce the sodium ion content in the living environment to a certain extent.

[0109] Table 4 pH value, EC and sodium ion content of the supernatant in each treatment group

[0110] deal with pH <![CDATA[Na + Content (cmol / kg)]]> EC(μs / cm) Experimental Group 7.86±0.15a 410.31±35.55b 1780.33±47.74b Blank control 8.03±0.01a 490.26±28.55a 2083.00±20.52a D1-1 strain control 7.98±0.03a 478.34±26.73a 1967.00±89.76a

[0111] Note: Different small letters represent significance at the p≤0.05 level.

[0112] Example 5

[0113] Effects of Cladosporium arachnoidum bacterial inoculant on rice growth in saline-alkali soil

[0114] Disinfection and germination of rice: Select Songliao 186 rice, select 50 rice seeds, soak and disinfect them in 30% hypochlorous acid for 10 minutes, and rinse them with sterile water 5 times. Completely wash away the residual hypochlorous acid solution. Soak the rice seeds in distilled water for 3 days at 37 degrees and avoid light for germination.

[0115] Experimental group: The germinated rice seeds were planted in the saline-alkali soil improved by D1-4 in Example 4 and cultured in a clean bench, with 3 plants in each bottle.

[0116] Blank control: The treatment method is the same as the experimental group, the only difference is that the germinated rice seeds are planted and cultured in the saline-alkali soil treated with the blank in Example 4.

[0117] D1-1 strain control: The treatment method is the same as the experimental group, except that the germinated rice seeds are planted in the saline-alkali soil improved by D1-4 in Example 4 for cultivation.

[0118] After sealing, each treatment group was placed in a constant temperature incubator for cultivation, with the daytime setting of 16 h, 28 ° C, and a light intensity of 30,000 lm (level 10, 30,000 lumens); the night was set to 8 h, 20 ° C, and darkness for 14 days. After 3 days of cultivation, the seedlings were removed and only one was left. After 14 days of cultivation, the root system was scanned, plant height, aboveground biomass, root proline, root malondialdehyde, root catalase, and root superoxide dismutase were determined. The superoxide dismutase, malondialdehyde, catalase, and proline contents of rice roots were determined using superoxide dismutase, malondialdehyde, catalase, and proline kits, respectively (Suzhou Keming Biotechnology Co., Ltd.).

[0119] The growth status of rice in each treatment group is shown in Figure 5 . The scanning results of the rice root system in each treatment group are shown in Table 5. According to Table 5, the root length, root surface area, root volume and root tip number of the experimental group of rice are significantly higher than those of the blank control and the D1-1 strain control. The results of rice biomass in each treatment group are shown in Table 6. It can be seen from Table 6 that the aboveground fresh weight, root fresh weight and plant height of the experimental group are significantly higher than those of the blank control and the D1-1 strain control, indicating that the spider cleavage mold strain can increase the plant biomass in saline-alkali environment. The content of rice root stress resistance indexes in each treatment group is shown in Table 7. It can be seen from Table 7 that the proline and malondialdehyde contents in the rice roots in the experimental group are significantly higher than those in the blank control and the D1-1 strain control, indicating that the spider cleavage mold strain increases the osmotic pressure of the rice root cell sap and enhances its salt-alkali resistance.

[0120] Table 5. Scanning results of rice roots in each treatment group

[0121]

[0122] Note: Different small letters represent significance at the p≤0.05 level.

[0123] Table 6 Rice biomass parameters of each treatment group

[0124] deal with Root fresh weight (g) Fresh weight of aboveground parts (g) Plant height(cm) Experimental Group 0.108±0.029a 0.147±0.007a 23.550±1.096a Blank control 0.069±0.018b 0.101±0.015b 20.850±0.883b D1-1 strain control 0.099±0.027ab 0.117±0.020b 21.276±0.231ab

[0125] Note: Different small letters represent significance at the p≤0.05 level.

[0126] Table 7 Contents of rice root stress resistance indexes in each treatment group

[0127]

[0128]

[0129] Note: Different small letters represent significance at the p≤0.05 level.

[0130] Example 6

[0131] Effects of Cladosporium arachnoidum strain D1-4 on the growth of corn in saline-alkali soil

[0132] Place a filter paper cut to the same size as the bottom of each potted plant, and fill it with 255g of saline-alkali soil that has passed 20 mesh. Wash the corn seed coating of the salt-alkali sensitive rice variety Xianyu 335 with clean water, water the soil thoroughly, place the corn endosperm side up on the moist soil, and then cover the surface of the seeds with sieved air-dried soil to a thickness of 2cm, then move the potted plants to a large constant temperature pot for cultivation. When the corn buds grow to 2 to 3 cm in height, remove the seedlings and keep only one.

[0133] Experimental group: After removing the seedlings, the mycelium blocks of the spider schizont strain D1-4 were inoculated into the roots of the corn. During this period, water was applied in time to keep the soil surface moist. Three parallel groups were set up.

[0134] Blank control: The treatment method is the same as the experimental group, the only difference is that the blank agar block is implanted into the root of corn.

[0135] After 42 days of cultivation at room temperature, each treatment group was subjected to root scanning, plant height, leaf SPDA, and non-damage sodium ion micro-testing. The specific detection methods are as follows.

[0136] The sodium ion flow of corn root system is detected by non-destructive micro-testing: the living plant is taken out from the pot, and care is taken not to damage the root system of the plant as much as possible. The soil on the root is cleaned with water, and the root tip parts of the same length and thickness with different treatments are cut. First, 8 to 9 layers of filter paper cut to an appropriate size are placed in a plate, and then the taken roots are placed on the filter paper and adjusted to a suitable position so that the root tip is about 3 mm above the filter paper. Then two-thirds of the test liquid is added to the plate, and the sodium ion flow of 5 to 30 μm at the outer edge of the corn root is measured by non-destructive micro-testing technology. The measurement position used in the present invention is 700 μm away from the root tip, and the detection time is 10 min. Each corn seedling should select tender roots of uniform thickness for measurement to avoid contingency.

[0137] The root system was scanned using a root scanner, and the aboveground biomass was measured using the oven-drying weighing method.

[0138] The contents of cellulose, hemicellulose, lignin, total pectin, and protein in the cell wall of maize roots were determined using cellulose, hemicellulose, lignin, total pectin, and protein kits, respectively, which were purchased from Beijing Box Biotechnology Co., Ltd.

[0139] SPSS statistical software was used for analysis, and the experimental data were expressed as "mean ± standard deviation". The growth status of corn in each treatment group is shown in Figure 6, the results of the growth potential and root cell wall composition of corn in each treatment group are shown in Tables 8 and 9. As shown in Table 8, the plant height of corn in the experimental group was significantly higher than that of the blank control, and the amount of chlorophyll contained in its leaves was significantly increased compared with CK, indicating that the spider claudication strain D1-4 can significantly promote the growth of corn plants and the chlorophyll content inside them. The increase in chlorophyll content indicates that the D1-4 strain promotes the absorption of nitrogen by corn in saline-alkali soil, thereby promoting the adaptation of corn to grow in saline-alkali environments. As shown in Table 8, the spider claudication strain D1-4 has a significant promoting effect on promoting the growth of corn in saline-alkali soil. The non-damage micro-measurement data of sodium ions in the roots of corn in each treatment group are shown in Figure 7 .Depend on Figure 7 It can be seen that the blank control ( Figure 7 The sodium ion internalization and externalization of the corn root zone in the experimental group ( Figure 7 Middle B) The sodium ion efflux from the rice root zone was significantly greater than the internalization, indicating that inoculation with the spider schizont strain D1-4 can enhance the sodium excretion capacity of the corn root system in saline-alkali soil environment, which is beneficial to improving the growth of rice in saline-alkali soil.

[0140] As shown in Table 9, the inoculation of Cladosporium spider mold strain D1-4 had different degrees of influence on the cell wall components of corn roots. Compared with the blank control, cellulose increased by 24.21%, lignin decreased by 25.32%, total pectin increased by 33.38%, and hemicellulose and protein had no significant changes, indicating that the inoculation of Cladosporium spider mold strain D1-4 can optimize the chemical composition of the corn root cell wall.

[0141] Table 8 Determination of corn growth potential in each treatment group

[0142] deal with Corn plant height / cm* SPAD** Experimental Group 61.40±2.93 41.79±2.13 Blank control 51.97±6.39 38.34±1.20

[0143] Note: N = 3, Note: "*" represents significant difference at P = 0.05 level. "**" represents significant difference at P = 0.01 level.

[0144] Table 9 Determination of cell wall components of corn roots in each treatment group

[0145]

[0146] Note: N=3, Note: " * "Indicates that the difference is significant at the P = 0.05 level." ** ” means that the difference reached significance at the P=0.01 level.

[0147] The results of the examples show that the spider clover strain D1-4 has a strong alkali resistance and can be applied to farmland with moderate salinity. It has a significant contribution to reducing the sodium ion content and soil EC content in saline-alkali soil. The spider clover strain D1-4 has the ability to promote the growth of rice roots grown in saline-alkali soil environments, can improve the root system and surface area of ​​rice, and improve the resistance of rice to stress by increasing the proline content. At the same time, it can optimize the composition of corn root cell walls, promote the discharge of sodium ions from corn roots, and increase the content of SPAD in leaves.

[0148] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A Clonostachys aranearum strain D1-4, characterized in that The deposit number of the Cladosporium arachnoidum strain D1-4 is CGMCC No.41141.

2. A fermentation product and / or metabolite of the Cladosporium arachnoidum strain D1-4 according to claim 1.

3. A bacterial fertilizer, characterized in that: The method comprises the Cladosporium arachnoidum strain D1-4 according to claim 1 or the fermentation product and / or metabolite and auxiliary materials according to claim 2.

4. A soil conditioner, characterized in that: The method comprises the Cladosporium arachnoidum strain D1-4 according to claim 1 or the fermentation product and / or metabolite and auxiliary materials according to claim 2.

5. Use of the spider cleavage mold strain D1-4 according to claim 1, the fermentation product and / or metabolite according to claim 2, the bacterial fertilizer according to claim 3 or the soil conditioner according to claim 4 in improving the living environment of plants and / or plant planting.

6. The use according to claim 5, characterized in that: The improving the plant living environment includes promoting soil aggregation and / or reducing the concentration of soluble ions in the environment.

7. The use according to claim 5, characterized in that: The plant planting includes promoting plant growth and / or improving plant resistance to salt and alkali.

8. The use according to claim 7, characterized in that: The promoting plant growth includes promoting the growth of the above-ground part and / or the underground part of the plant.

9. The use according to claim 7, characterized in that: The method of improving the salt-alkali resistance of plants includes at least one of the following: increasing the proline content in plant roots, promoting the discharge of sodium ions from plant roots, and increasing the chlorophyll content in plant leaves.

10. The use according to any one of claims 5 to 9, characterized in that: The plants include food crops and / or cash crops.

Images