Ester-producing pichia kudriavzevii as well as isolated culture method and application thereof

Abstract

The invention discloses ester-producing pichia kudriavzevii as well as an isolated culture method and application thereof, and belongs to the technical field of microorganisms. According to the invention, a high-ester-yield pichia kudriavzevii strain is screened from white wine pit mud, and the preservation number of the pichia kudriavzevii strain is CGMCC (China General Microbiological Culture Collection Center) No.31683. The strain provided by the invention can produce ester substances through metabolism, and in addition, the strain can be subjected to mixed fermentation with strains of different types, so that the purpose of increasing aroma substances of fruit wine is achieved; when being applied to fruit wine fermentation, the fruit wine can generate various volatile flavor substances, has proper pH, is suitable for both low and high alcoholic strength, is mellow and rich in fruit aroma and wine aroma and mellow and tasty in taste, and can improve the content of esters in the fruit wine and increase flavor substance components.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to an ester-producing Pichia kudriavzevii yeast and a separation and culture method and application thereof. Background Art

[0002] Fruit wine is made from various fruits. During the fermentation process, the nutrients such as vitamins, minerals, amino acids, polyphenols, etc. in the fruits are retained to a great extent. After fermentation, various alcohols, esters, organic acids and other substances will be produced in the fruit wine. Fruit wine is rich in nutrients, rich in various amino acids, minerals, trace elements and vitamins, such as zinc, copper, selenium, manganese, vitamin A, vitamin B5, vitamin C, vitamin D, etc. Studies have shown that compared with fruits, the vitamins in fruit wine are more easily absorbed by the human body. Long-term moderate drinking of fruit wine can resist aging, prevent arteriosclerosis, hypertension, cardiovascular and cerebrovascular diseases, etc., and can also regulate emotions. In addition, compound fruit wine has gradually become a new trend. It uses the advantages and disadvantages of different fruits, retains the nutritional value and flavor of various fruits, diversifies its flavor and taste, and enhances the comprehensive utilization of my country's fruit resources. Therefore, making fruit into fruit wine can increase the economic value of fruit.

[0003] Citrus is the world's largest fruit category, and my country ranks first in the world in terms of citrus planting and production. At present, my country's citrus fruits are mainly sold as fresh fruits, with a processing rate of less than 10%, and the processing form is single. Citrus includes four categories: tangerine, orange, orange, and grapefruit. They are popular among the people because of their good taste and high water content. In addition, citrus also has extremely high nutritional value. In addition to high content of nutrients such as vitamins, carbohydrates, and organic acids, it is also rich in flavonoids, limonin and other functional ingredients that are beneficial to the body, and has the effects of beauty, enhancing immunity, and eliminating fatigue. In addition to being eaten fresh, citrus can also be processed into juice, fruit wine, preserved fruit, jam, dried fruit, and fruit vinegar. Citrus wine is a low-alcohol fruit wine made from citrus fruits through processes such as juicing, fermentation, brewing, blending, filtering, sterilization, and filling. During the fermentation process of citrus wine, yeast converts the fructose in the fruit into alcohol and reacts with organic acids to synthesize a variety of alcohols, aldehydes, and esters, giving the wine unique nutrients and flavor. It can promote blood circulation and metabolism in the human body, control cholesterol levels in the body, and improve cardiovascular and cerebrovascular function. It is a healthy product with great development prospects.

[0004] Aroma is crucial to fruit wine and determines the quality of fruit wine. It is mainly composed of the aroma components retained by the fruit itself and the aromatic substances produced during the fermentation process, which often give the fruit wine a fresh and sweet taste. After qualitative analysis of the aroma components of fruit wine using gas chromatography-mass spectrometry (GC-MS), it was found that its aroma components are complex, including various esters, alcohols, acids, phenols, mushrooms, etc., which interact with each other to present a rich and diverse aroma. Among them, esters are the most important substances that determine the aroma. Existing studies have shown that esters are also the most abundant aroma compounds found in fruit wine, including acetate and ethyl esters, which are formed by yeast through different metabolic mechanisms, but have a similar fruit aroma. In addition, the aroma of fruit wine is affected by many factors such as fermentation process, fermentation strain, nitrogen source, etc. At present, many fruit wines have the problems of weak aroma and insufficient typical flavor, which restricts the improvement of fruit wine quality and the development of the fruit wine industry.

[0005] Saccharomyces cerevisiae has good fermentation performance and can produce good flavor, but the widespread use of a single commercial Saccharomyces cerevisiae will reduce the complexity of wine flavor. With the deepening of the understanding of yeast diversity, many beneficial properties of non-saccharomyces cerevisiae have attracted widespread attention from researchers. Non-saccharomyces cerevisiae has low fermentation performance, but its aroma production performance is good. It can produce a variety of extracellular enzymes, thereby increasing the content of ester compounds and other volatile aroma components, which has a positive effect on the aroma of wine. Usually, general commercial yeasts are used for fruit wine fermentation. There are no special fermentation strains for fruit wines of different types and different raw materials, and there are few reports on the use of ester-producing yeasts from liquor sources in fruit wine fermentation; while liquor has rich flavor and excellent quality, and there are many ester-producing microorganisms in the cellar mud and koji. Therefore, ester-producing microorganisms are screened from liquor samples and used in the fermentation of citrus wine, giving citrus wine unique aroma characteristics. In addition, different types of strains can be used for mixed fermentation to achieve the purpose of improving the aroma substances of citrus wine. Summary of the invention

[0006] In view of the problem that there is currently a lack of ester-producing fermentation strains for fruit wine, which leads to a weak aroma and insufficient typical flavor in the fruit wine, the present invention selects and cultivates an ester-producing Pichia kudriavzevii from liquor cellar mud. The yeast has the characteristics of mild fermentation conditions, simple fermentation raw materials, short culture time, etc. The yeast can ferment and metabolize to produce ester substances alone or in a mixed manner with other strains, thereby increasing the types and contents of aroma substances in the fruit wine and improving the quality of the fruit wine.

[0007] To achieve the above-mentioned purpose, the present invention first provides an ester-producing Pichia kudriavzevii, whose strain is named Pichia kudriavzevii Y44, which has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on August 19, 2024, and its deposit number is CGMCC No.31683.

[0008] The ITS sequence of the ester-producing Pichia kudriavzevii is shown in SEQ ID NO:1.

[0009] SEQ ID NO: 1 ITS sequence of an ester-producing Pichia kudriavzevii strain:

[0010] CCTGCGGAAGGATCATTACTGTGATTTAGTACTACACTGCGTGAGCGGAACGAAAACAACAACACCTAAAATGTGGAATATAGCATATAGTCGACAAGAGAAATCTACGAAAAAACAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCTCGG CATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCATCTTGCGCGTGCGCAGAGTTGGGGGAGCGGAGCGGACGACGTGTAAAGAGCGTCGGAGCTGCGACTCGCCTGAAAGGGAGCGAAGCTGGCCGAGCGAACTAGACTTTTTTTCAGGGACGCTTGGCGGCCGAGAGCGAGTGTTGCGAGACAACAAAAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAA.

[0011] Among them, the biological characteristics of the above-mentioned ester-producing Pichia kudriavzevii are: when cultured on YPD solid culture at 30°C for 1 to 2 days, the colonies are round, milky white in color, 0.5 to 5 mm in size, and have a dry and smooth surface.

[0012] The present invention also provides a method for isolating and culturing the above-mentioned ester-producing Pichia kudriavzevii, which comprises the following steps: adding liquor pit mud to a YPD liquid culture medium, culturing at a constant temperature of 28 to 30° C. with shaking for 20 to 30 minutes, taking the supernatant and inoculating it into a YPD liquid culture medium, culturing at a constant temperature of 28 to 30° C. with shaking for 2 to 3 days to prepare a bacterial suspension; using a YPD liquid culture medium to dilute the bacterial suspension to a concentration of 10 -2 , 10 -3 , 10 -4 and 10 -5 , take each concentration of dilution and evenly spread it on YPD solid culture medium, then culture it at a constant temperature of 28-30℃ for 24-48h, streak it to purify it into single colonies, identify the ester production ability of each single bacteria, and screen out the ester-producing Pichia pastoris Y44.

[0013] Among them, in the above-mentioned isolation and culture method of ester-producing Pichia kudriavzevii, the white wine cellar mud is Luzhou-flavor white wine cellar mud.

[0014] Among them, in the above-mentioned isolation and culture method of ester-producing Pichia kudriavzevii, white wine cellar mud is added to the YPD liquid culture medium at a mass volume ratio of 1g:8-10ml.

[0015] Among them, in the above-mentioned isolation and culture method of ester-producing Pichia kudriavzevii, the supernatant is taken and inoculated into YPD liquid culture medium at a volume ratio of 1 μL:0.5-1 mL.

[0016] The ester-producing Pichia kudriavzevii provided by the present invention can not only hydrolyze tributyrin to produce esterase, which is then used for fruit wine fermentation, but also hydrolyze cellulose to produce cellulase. Therefore, the present invention also provides the use of the ester-producing Pichia kudriavzevii in producing ester aroma compounds, producing cellulase or fruit wine fermentation.

[0017] According to tests, the ester-producing Pichia kudriavzevii provided by the present invention is particularly suitable for citrus wine fermentation. Therefore, in the above-mentioned use, the fruit wine is preferably citrus wine.

[0018] The present invention provides a process for producing ester aroma compounds by fermenting the ester-producing Pichia kudriavzevii, which comprises the following steps:

[0019] Single fermentation: Activate the Y44 strain, inoculate the activated Y44 into the ester production medium at an inoculation rate of 1-4%, and culture at a constant temperature of 28-30°C with shaking for 2-3 days;

[0020] Or, mixed fermentation: activate the Y44 strain, inoculate the activated Y44 at an inoculation rate of 1-4% and the alcohol-producing yeast at an inoculation rate of 1-4% into the ester-producing medium, and culture at a constant temperature of 25-26°C for 5-7 days.

[0021] Among them, in the above-mentioned process of fermenting ester aroma compounds using ester-producing Pichia kudriavzevii, the operation of activating the Y44 strain is: inoculating Y44 into YPD liquid, and culturing at a constant temperature of 28-30°C with shaking for 12-14 hours.

[0022] Among them, in the above-mentioned process of producing ester aroma compounds by fermenting ester-producing Pichia kudriavzevii, the ester-producing culture medium is: 20.0g of peptone, 10.0g of yeast extract, 80.0g of glucose, distilled water is added to make the volume to 1000mL, and sterilized at 115°C for 20min.

[0023] The ester-producing Pichia kudriavzevii provided by the present invention has a strong ester-producing ability, and when it is mixed with the common alcohol-producing yeast in the art for fermentation, the efficiency of producing ester aroma compounds can be further improved. Therefore, in the above-mentioned process of using the ester-producing Pichia kudriavzevii to ferment and produce ester aroma compounds, the alcohol-producing yeast can be the common alcohol-producing yeast in the art, such as Angel Yeast.

[0024] The ester-producing Pichia kudriavzevii provided by the present invention has the ability to produce enzymes that can decompose cellulose and other substances in addition to the ability to produce esters, making it easier for these decomposed small molecules to further synthesize esters, which is more conducive to fruit wine fermentation. Therefore, the present invention also provides a process for fruit wine fermentation using the above-mentioned ester-producing Pichia kudriavzevii, which comprises the following steps:

[0025] Single fermentation: After beating the fruit into a homogenate, add pectinase for enzymolysis, then separate the solid and liquid to obtain fruit juice, add potassium metabisulfite to the fruit juice, and adjust the pH to 3-4, then add white sugar to adjust the soluble solid content of the juice to 20-25%, after sterilization, inoculate the activated Y44 at an inoculum of 1-4%, and ferment at 28-30℃ with shaking for 2-3 days;

[0026] Or, mixed fermentation: after beating the fruit into a homogenate, add pectinase for enzymolysis, then separate the solid and liquid to obtain fruit juice, add potassium metabisulfite to the fruit juice, and adjust the pH to 3-4, then add white sugar to adjust the soluble solid content of the juice to 20-25%, after sterilization, inoculate with activated Y44 at an inoculation rate of 1-4% and with alcohol-producing brewer's yeast at an inoculation rate of 1-4%, and ferment at 25-26°C for 5-7 days.

[0027] The ester-producing Pichia kudriavzevii provided by the present invention is not Saccharomyces cerevisiae and has a weak alcohol production capacity. However, when the ester-producing Pichia kudriavzevii is used alone for fruit wine fermentation, it can be applied to the production of fruit wine with low alcohol content.

[0028] The ester-producing Pichia kudriavzevii provided by the present invention can be used for brewing fruit wines such as pitaya, apple, pineapple, and hawthorn, and has a certain degree of versatility; at the same time, according to tests, it is particularly suitable for fermenting citrus fruit wine. Therefore, in the above-mentioned process of using ester-producing Pichia kudriavzevii for fruit wine fermentation, the fruit is preferably citrus.

[0029] Wherein, in the above-mentioned process of using ester-producing Pichia kudriavzevii for fruit wine fermentation, the added amount of the pectinase is 60-100m / L.

[0030] Wherein, in the above-mentioned process of using ester-producing Pichia kudriavzevii for fruit wine fermentation, the enzymatic hydrolysis is enzymatic hydrolysis in a constant temperature water bath at 30 to 40°C for 2 to 3 hours.

[0031] Wherein, in the above-mentioned process of using ester-producing Pichia kudriavzevii for fruit wine fermentation, the addition amount of potassium metabisulfite is 80-120 mg / L.

[0032] Wherein, in the above-mentioned process of using ester-producing Pichia kudriavzevii for fruit wine fermentation, calcium carbonate is used to adjust the pH.

[0033] Among them, in the above-mentioned process of using ester-producing Pichia kudriavzevii for fruit wine fermentation, the activation operation of the Y44 strain is: inoculating Y44 into YPD liquid, and culturing at a constant temperature of 28-30°C with shaking for 12-14 hours.

[0034] The ester-producing Pichia kudriavzevii provided by the present invention has a strong ester-producing ability. When it is mixed with the alcohol-producing Saccharomyces cerevisiae commonly used in the art with high alcohol production, practicality and safety for fruit wine fermentation, the flavor of the fruit wine can be further improved. Therefore, in the above-mentioned process of using the ester-producing Pichia kudriavzevii to ferment and produce ester aroma compounds, the alcohol-producing Saccharomyces cerevisiae commonly used in the art, for example, Angel yeast, can be used.

[0035] The present invention also provides a process for producing cellulase by fermenting the above-mentioned ester-producing Pichia kudriavzevii, which comprises the following steps:

[0036] The Y44 strain is activated, and the activated Y44 is inoculated into a Congo red medium at an inoculation rate of 1 to 4%, and cultured at a constant temperature of 28 to 30° C. with shaking for 2 to 3 days; the Congo red medium comprises: 10.0 g of sodium carboxymethyl cellulose, 3.0 g of yeast extract powder, 5.0 g of peptone, 1.0 g of sodium chloride, 1.0 g of Congo red, and distilled water is added to make the volume 1000 mL, and sterilized at 121° C. for 20 minutes.

[0037] Beneficial effects of the present invention:

[0038] The invention obtains a high-yield esterase fermentation Pichia yeast screened from the pit mud of Luzhou-flavor liquor. The bacteria can metabolize to produce ester substances. In addition, the bacteria can be mixed with different types of strains for fermentation, so as to achieve the purpose of improving the aroma substances of fruit wine. When the bacteria is applied to the fermentation of citrus and other fruit wines, a variety of volatile flavor substances can be produced, the pH is suitable, the alcohol content is high, the fruit aroma and wine aroma are mellow and rich, the taste is mellow and refreshing, not only the content of ester substances in the fruit wine is increased, the flavor substance components are increased, but also the deep processing industry of citrus and other fruits can be promoted, and the added value of agricultural products can be increased.

[0039] The deposit number of Pichia kudriavzevii Y44 of the present invention is CGMCC No. 31683. The deposit time is August 19, 2024, and the deposit center is: General Microbiological Center of China Microorganism Culture Collection Administration (CGMCC), the address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, postal code 100101. The classification name is Pichiakudriavzevii Y44. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a colony morphology diagram of the ester-producing Pichia kudriavzevii Y44 of the present invention.

[0041] Figure 2 This is the electrophoresis result of the ITS PCR amplification product of ester-producing yeast in Example 2.

[0042] Figure 3 This is the phylogenetic tree of the ITS gene sequence of ester-producing yeast in Example 2.

[0043] Figure 4 This is the heat map of flavor substances in citrus wine fermented by Angel alone and Angel and Y44 mixed fermentation in Example 5. DETAILED DESCRIPTION

[0044] The present invention is further described in detail below by way of examples, but the protection scope of the present invention is not limited to the scope of the examples.

[0045] Example 1: Enrichment and separation of ester-producing microorganisms

[0046] Weigh 5 g of a Luzhou-flavor liquor cellar mud sample from a century-old cellar of a certain liquor company in Luzhou, add it to a triangular flask containing 45 mL of YPD liquid culture medium, and culture it at 30°C with constant temperature shaking for 20 min. Then take 100 μL of the supernatant and inoculate it into 50 mL of YPD liquid culture medium, and culture it at 30°C with constant temperature shaking for about 48 h to prepare a bacterial suspension. Use YPD liquid culture medium to dilute the bacterial suspension to a concentration of 10 -2 , 10 -3 , 10 -4 , 10 -5, take 100 μL of each concentration dilution of YPD liquid culture medium, evenly spread it on YPD solid culture medium, and then place it in a 30℃ constant temperature incubator for 24 hours. Select single colonies with different morphologies from the plate and inoculate them in YPD liquid culture medium. After constant temperature shaking culture at 30℃ for about 48 hours, streak purification to single colonies and store them in glycerol tubes in a -80℃ refrigerator. By identifying the ester production ability of different single bacteria, strains with ester production ability were screened out, and then the total ester content was measured by overnight saponification experiment. It was found that Y44 had a strong ester production ability, and it was identified.

[0047] Y44 was cultured on YPD solid medium at 30℃ for 1-2 days. The colonies were round, milky white, 0.5-5 mm in size, and dry and smooth. The colony morphology is shown in the figure below. Figure 1 shown.

[0048] YPD liquid culture medium: every 100 mL of YPD liquid culture medium contains 1 g yeast extract powder, 2 g glucose and 2 g peptone.

[0049] YPD solid culture medium: Every 100 mL of YPD solid culture medium contains 1 g yeast extract powder, 2 g glucose, 2 g peptone and 2 g agar.

[0050] Example 2: Identification of Pichia kudriavzevii Y44 strain

[0051] The screened strains were activated and cultured, and then PCR was performed on the bacterial solution.

[0052] PCR amplification: The primers for fungi are ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') whose ITS sequence is shown in SEQ ID NO: 2 and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') whose ITS sequence is shown in SEQ ID NO: 3.

[0053] Reaction system: 2× Rapid Tap Master Mix 12.5 μL, ITS1 and ITS4 1 μL each (27F and 1492R 1 μL each), add ddH2O to 25 μL.

[0054] Reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1 min 50 s; 30 cycles; extension and repair at 72°C for 5 min.

[0055] The PCR amplification products were detected by 1% agarose gel electrophoresis and sent to Chengdu Qingke Zixi Biotechnology Co., Ltd. for sequencing. The gene sequences obtained by sequencing were input into the National Center for Biotechnology Information (NCBI) database for BLAST homology online comparison, and the phylogenetic tree was constructed using MAGE-X software.

[0056] After PCR amplification of the strain DNA, the electrophoresis diagram is obtained, such as Figure 1 shown by Figure 1 The Y44 band is clear and bright, with a size of about 500 bp. The phylogenetic tree of homologous strains of gene sequences was drawn using the neighbor-joining method in MEGA-X software, as shown in Figure 2 As shown, Y44 was found to have the highest homology with Pichia kudriavzevii.

[0057] Example 3: Identification of the enzyme production capacity of Pichia kudriavzevii Y44

[0058] The Y44 strain purified in Example 1 was made into seed liquid, 5 μL of the bacterial suspension was plated on YPD solid medium, and after culturing at 30° C. for 2-3 days, whether a transparent circle was produced around the strain was observed. The esterase produced by ester-producing microorganisms can decompose or synthesize triglycerides. If a transparent circle appears on the screening medium, it indicates that the strain can produce esterase and utilize tributyrin.

[0059] Take 5 μL and inoculate it on Congo red medium. After culturing at 30℃ for 2-3 days, observe whether there is a transparent circle around the strain. Congo red can form a red complex with cellulose. After cellulose is decomposed, a transparent circle will appear around the strain.

[0060] Take 5 μL of bacterial liquid and inoculate it on casein culture medium, and culture it at 30℃ for 2-3 days. If the strain can produce protease and secrete it outside the cell, it can degrade casein and form a proteolytic circle around the strain.

[0061] Take 5 μL of bacterial liquid and inoculate it on the starch culture medium. After culturing at 30℃ for 2-3 days, weigh 0.4 g of iodine particles and grind them into powder. Spread the powder evenly on the lid of the starch culture dish, then turn the culture dish upside down on it and let it stand for 10 minutes. Transparent circles will appear around the colonies with the ability to produce amylase.

[0062] Take 5 μL of bacterial solution and inoculate it on the culture medium with xylan as the only carbon source. After culturing at 30°C for 2-3 days, observe whether there is a transparent circle around the strain.

[0063] Take 5 μL of bacterial solution and inoculate it on the culture medium with pectin as the only carbon source. After culturing at 30°C for 2-3 days, observe whether there is a transparent circle around the strain.

[0064] Congo red medium: sodium carboxymethyl cellulose 10.0 g, yeast extract powder 3.0 g, peptone 5.0 g, sodium chloride 1.0 g, Congo red 1.0 g, add distilled water to make up to 1000 mL, sterilize at 121°C for 20 min.

[0065] Casein medium: casein 4.0 g, disodium hydrogen phosphate heptahydrate 1.0 g, potassium dihydrogen phosphate 0.36 g, agar 20.0 g, add distilled water to make up to 1000 mL, sterilize at 121°C for 20 min.

[0066] Starch culture medium: 30.0 g soluble starch, 10.0 g peptone, 5.0 g sodium chloride, 3.0 g beef extract, 20.0 g agar powder, add distilled water to make up to 1000 mL, sterilize at 121°C for 20 min.

[0067] Xylan culture medium: 0.5 g ammonium sulfate, 2.0 g potassium dihydrogen phosphate, 0.5 g magnesium sulfate heptahydrate, 0.2 g calcium chloride dihydrate, 0.1 g potassium sulfate, 0.2 g sodium chloride, 15.0 g xylan, 20.0 g agar powder, add distilled water to make up to 1000 mL, and sterilize at 121°C for 20 min.

[0068] Pectin culture medium: pectin 2g / L, ammonium sulfate 3g / L, potassium dihydrogen phosphate 1.4g / L, disodium hydrogen phosphate 1.7g / L, ferrous sulfate heptahydrate 0.01g / L, magnesium sulfate heptahydrate 0.5g / L, agar 20g, add distilled water to make up to 1000mL, sterilize at 121℃ for 20min.

[0069] The YPD medium, Congo red medium, casein medium, starch medium, xylan medium and pectin medium containing tributyrin were used to qualitatively verify the performance of Y44 strain in producing esterase, cellulase, protease, amylase, xylanase and pectinase. It was found that Y44 strain could hydrolyze tributyrin and produce esterase; it could hydrolyze cellulose and produce cellulase, as shown in Table 2.

[0070] Table 1 Enzyme production capacity of strain Y44

[0071]

[0072] Note: "+" indicates positive, "-" indicates negative; the value in "()" indicates the ratio of the diameter of the transparent zone to the diameter of the colony (D / d). The larger the D / d value, the stronger the ability to produce the corresponding enzyme.

[0073] Example 4: Determination of total ester content produced by Pichia kudriavzevii Y44

[0074] The Y44 strain was activated and inoculated into an ester-producing medium (20.0 g of peptone, 10.0 g of yeast extract, 80.0 g of glucose, fixed to 1000 mL with distilled water, sterilized at 115°C for 20 min) at a 1% inoculation rate. The strain was cultured at 30°C for 3 days. Samples were taken at 3 days of fermentation to determine the total ester content. Y44 was activated in the same way. After activation, the strain was inoculated into an ester-producing medium at a 1% inoculation rate. Angel yeast was also inoculated at a 1% inoculation rate for mixed fermentation. The strain was cultured at 30°C for 7 days. Samples were taken at 7 days of fermentation to determine the total ester content. The total ester was determined by overnight saponification. Angel Yeast uses SY wine and fruit wine yeast from Angel Yeast Co., Ltd.

[0075] The total ester content of Y44 strain after 3 days of fermentation was measured using ester-producing culture medium. The total ester content of Y44 strain after 3 days of fermentation was 1.31 g / L, indicating that the Y44 strain had a strong ester-producing ability.

[0076] The total ester content of the mixed fermentation of Y44 and Angel yeast for 7 days was measured using ester-producing culture medium. The total ester content of the mixed fermentation of Y44 strain and Angel yeast strain for 7 days was 0.93 g / L, indicating that the mixed fermentation of Y44 strain and Angel yeast strain also has a strong ester-producing ability.

[0077] Example 5: Application of Pichia kudriavzevii strain in citrus wine fermentation

[0078] Mixed fermentation of citrus wine with Pichia kudriavzevii Y44 and Angel yeast: fresh, full and ripe oranges were selected, peeled manually, and the white orange peel was removed as much as possible. After crushing and beating, the sugar content was adjusted to 20°Bx. Potassium metabisulfite (100 mg / L) was added to the pulped citrus juice + pectinase (100 mg / L), and the pH was adjusted to 3.5 with calcium carbonate. Three groups were set up in parallel, and the inoculation method was as follows: single bacteria fermentation (comparative example): Angel yeast was inoculated at an inoculation rate of 1%; mixed bacteria fermentation (example): Pichia kudriavzevii Y44 and Angel yeast were inoculated at an inoculation rate of 1% respectively.

[0079] 1. Determination of alcohol content of mixed-bacteria fermented citrus wine: The alcohol content is determined by spectrophotometer.

[0080] 2. Determination of total acid and pH of mixed-bacteria fermented citrus wine: refer to GB12456-2021 pH meter potentiometric titration method for total acid, and refer to GB / T10468-1989 for pH.

[0081] 3. Determination of total sugar in mixed-bacteria fermented citrus wine: The total sugar was determined by the DNS method.

[0082] 4. Determination of soluble solid content and clarity of mixed-fermentation citrus wine: The soluble solid content was determined using a handheld sugar meter; the clarity was determined using a spectrophotometer.

[0083] 5. Determination of total phenols and total flavonoids in mixed bacteria fermented mulberry wine: total phenols were determined by Folin-phenol reagent method; total flavonoids (calculated as rutin) were determined by colorimetry.

[0084] Angel yeast and Y44 strain were used to mix and ferment mulberry wine. The alcohol content of the samples after 7 days of fermentation was determined by colorimetry (Table 2). It was found that the combination of Angel yeast and Y44 strain had an alcohol content of 4.24% vol, which was similar to the alcohol content of fruit wine products on the market; the total sugar content was 12.01 g / L, the total acid content was 3.13 g / L, the pH was 3.51, the soluble solid content was 5.5, and the clarity was 94.99% (Table 2).

[0085] Citrus fruits are rich in antioxidant active ingredients such as flavonoids and polyphenols. The total phenol content of the mixed fermentation of Angel Yeast and Y44 was 0.65 mg / mL, and the total flavonoid content was 0.76 mg / mL (Table 2).

[0086] Table 2 Physical and chemical test results of citrus wine

[0087]

[0088]

[0089] 6. GC-MS determination of flavor substances in mixed-bacteria fermented citrus wine

[0090] (1) Extraction conditions: Take 5 mL and transfer to the headspace bottle, add 2.50 g of sodium chloride, and repeat 3 times for each sample. Insert the sample into the extraction head at 50°C, extract for 30 min, 500 r / min, and desorb for 3 min.

[0091] (2) Chromatographic conditions: injection port temperature of 220°C, chromatographic column CP-Wax 57CB (50 m x 250 μm x 0.2 μm), helium as carrier gas, non-split injection; temperature program: starting temperature of 35°C, maintained for 5 min, increased to 80°C at 3°C / min, and then increased to 210°C at 5°C / min and maintained for 9 min.

[0092] (3) Mass spectrometry conditions: EI ionization source, electron energy 70 eV, transfer line temperature 250 °C, ion source temperature 230 °C, quadrupole temperature 150 °C, mass scan range m / z 30-350, solvent delay 0 min.

[0093] A total of 48 aroma substances were identified in citrus wine fermented with Angel yeast alone, and 61 aroma substances were identified in mixed fermentation with Angel yeast and Pichia kudriavzevii Y44. The number of aroma substances produced by mixed fermentation was significantly higher than that produced by single fermentation (e.g. Figure 4 ).

[0094] Esters are mainly derived from fruit and ethanol fermentation, have fruity aroma, and are a type of fermentation aroma compound that has a great influence on the aroma of wine. Angel yeast fermented citrus wine and identified 8 esters, while the addition of Pichia kudriavzevii Y44 increased the number of esters in citrus wine to 23 (as shown in Table 3), and the relative content was increased. The main aroma components of citrus wine obtained by mixed fermentation of Pichia kudriavzevii Y44 are phenylethanol, 3-methyl-1-butanol, ethyl acetate, 2,4-di-tert-butylphenol, etc. Among them, the relative content of ethyl octanoate, ethyl 2-phenylacetate, ethyl acetate, isopentyl acetate and ethyl decanoate is higher than that of Angel fermentation, and plays an important role.

[0095] Table 3 Detection results of flavor substances in mulberry wine fermented by strain Y44

[0096]

[0097]

[0098]

[0099]

[0100] Note: In Table 3, “—” means not detected.

Claims

1. Ester-producing Pichia kudriavzevii, characterized in that: The ester-producing Pichia kudriavzevii strain is named Pichia kudriavzevii Y44, which is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, and its deposit number is CGMCC No.31683.

2. The method for isolating and culturing the ester-producing Pichia kudriavzevii according to claim 1, characterized in that: The following steps are involved: Add liquor pit mud to YPD liquid culture medium, culture at 28-30℃ constant temperature with shaking for 20-30min, take the supernatant and inoculate it into YPD liquid culture medium, culture at 28-30℃ constant temperature with shaking for 2-3d to prepare bacterial suspension; dilute the bacterial suspension to 10 -2 , 10 -3 , 10 -4 and 10 -5 , take each concentration of dilution and evenly spread it on YPD solid culture medium, then culture it at a constant temperature of 28-30℃ for 24-48h, streak it to purify it into single colonies, identify the ester production ability of each single bacteria, and screen out the ester-producing Pichia pastoris Y44.

3. The method for isolating and culturing ester-producing Pichia kudriavzevii according to claim 2, characterized in that: At least one of the following is met: The liquor cellar mud is Luzhou-flavor liquor cellar mud; Add liquor pit mud into YPD liquid medium at a mass volume ratio of 1g:8-10ml; The supernatant was inoculated into YPD liquid culture medium at a volume ratio of 1 μL:0.5-1 mL.

4. Use of the ester-producing Pichia kudriavzevii according to claim 1 in the production of ester aroma compounds, the production of cellulase or the fermentation of fruit wine.

5. The use according to claim 4, characterized in that: The fruit wine is citrus wine.

6. The process for producing ester aroma compounds by fermenting the ester-producing Pichia kudriavzevii according to claim 1, characterized in that: The following steps are involved: Single fermentation: Activate the Y44 strain, inoculate the activated Y44 into the ester production medium at an inoculation rate of 1-4%, and culture at a constant temperature of 28-30°C with shaking for 2-3 days; Or, mixed fermentation: activate the Y44 strain, inoculate the activated Y44 at an inoculation rate of 1-4% and the alcohol-producing yeast at an inoculation rate of 1-4% into the ester-producing medium, and culture at a constant temperature of 25-26°C for 5-7 days.

7. The process for producing ester aroma compounds by fermenting ester-producing Pichia kudriavzevii according to claim 6, characterized in that: At least one of the following is met: The operation of activating the Y44 strain is as follows: inoculating Y44 into YPD liquid, and culturing at a constant temperature of 28 to 30° C. with shaking for 12 to 14 hours; The ester production medium is: 20.0 g of peptone, 10.0 g of yeast extract, 80.0 g of glucose, distilled water is added to make up to 1000 mL, and sterilized at 115° C. for 20 min; The alcohol-producing yeast is Angel yeast.

8. A process for fruit wine fermentation using the ester-producing Pichia kudriavzevii according to claim 1, characterized in that: The following steps are involved: Single fermentation: After beating the fruit into a homogenate, add pectinase for enzymolysis, then separate the solid and liquid to obtain fruit juice, add potassium metabisulfite to the fruit juice, and adjust the pH to 3-4, then add white sugar to adjust the soluble solid content of the juice to 20-25%, after sterilization, inoculate the activated Y44 at an inoculum of 1-4%, and ferment at 28-30℃ with shaking for 2-3 days; Or, mixed fermentation: after beating the fruit into a homogenate, add pectinase for enzymolysis, then separate the solid and liquid to obtain fruit juice, add potassium metabisulfite to the fruit juice, and adjust the pH to 3-4, then add white sugar to adjust the soluble solid content of the juice to 20-25%, after sterilization, inoculate with activated Y44 at an inoculation rate of 1-4% and with alcohol-producing brewer's yeast at an inoculation rate of 1-4%, and ferment at 25-26°C for 5-7 days.

9. The process for fruit wine fermentation using ester-producing Pichia kudriavzevii according to claim 8, characterized in that: At least one of the following is met: The fruit is citrus; The added amount of the pectinase is 60-100 m / L; The enzymolysis is carried out in a constant temperature water bath at 30-40°C for 2-3 hours; The amount of potassium metabisulfite added is 80-120 mg / L; Calcium carbonate was used to adjust pH; The activation operation of the Y44 strain is as follows: inoculate Y44 into YPD liquid and culture at a constant temperature of 28-30°C with shaking for 12-14 hours; The alcohol-producing brewer's yeast is Angel yeast.

10. The process for producing cellulase by fermenting the ester-producing Pichia kudriavzevii according to claim 1, characterized in that: The following steps are involved: The Y44 strain is activated, and the activated Y44 is inoculated into a Congo red medium at an inoculation rate of 1 to 4%, and cultured at a constant temperature of 28 to 30° C. with shaking for 2 to 3 days; the Congo red medium comprises: 10.0 g of sodium carboxymethyl cellulose, 3.0 g of yeast extract powder, 5.0 g of peptone, 1.0 g of sodium chloride, 1.0 g of Congo red, and distilled water is added to make the volume 1000 mL, and sterilized at 121° C. for 20 minutes.

Images