DNA vaccine based on yeast cell wall as well as preparation method and application of DNA vaccine

Abstract

The invention relates to a yeast cell wall coated protamine DNA complex (YCW-PS-DNA), which is composed of a yeast cell wall YCW and a PS-DNA complex, and the weight ratio of the YCW to the PS-DNA complex is (1-7): 1. The PS-DNA compound is composed of protamine and a DNA recombinant plasmid, the charge ratio (N / P) of the protamine to the DNA recombinant plasmid is (2-8): 1, and the nucleotide sequence of the DNA recombinant plasmid is as shown in SEQ ID NO. 1. The YCW-coated PS-DNA complex disclosed by the invention has good physical and gastrointestinal tract stability, can induce a relatively high mucosal immune level in vivo, simultaneously generates humoral immune and cellular immune responses and provides comprehensive immune protection, has good safety, and can be used for preparing vaccines for resisting respiratory virus infection.

Description

Technical Field

[0001] The invention belongs to the biological field and relates to a DNA vaccine based on yeast cell wall and a preparation method and application thereof. Background Art

[0002] Coronavirus infection is a highly contagious disease caused by severe acute respiratory syndrome coronavirus (SARS-CoV-2). Currently, vaccination is one of the effective means to prevent the disease, mainly including recombinant viral vector vaccines, virus-like particle vaccines (including live attenuated vaccines, inactivated vaccines, toxoid vaccines), histone vaccines, nucleic acid vaccines (mRNA vaccines, DNA vaccines), etc. Recombinant viral vector vaccines have problems such as production stability and deep immune safety. The main disadvantage of inactivated vaccines is weak cellular immune response. Other vaccines may cause allergic reactions in recipients. For example, live attenuated vaccines have residual virulence, and there is a risk of virulence reversion and in vivo recombination. Nucleic acid vaccines are simple in design and simple in production process. They only require key antigen gene sequences of the virus. Subsequent production is not limited by biological materials, and the preparation of vaccines can be completed in a relatively short time. Among them, DNA vaccine is a "naked vaccine" that does not require any chemical carrier. It can recombinant the gene encoding coronavirus protein antigen into a eukaryotic expression vector into a "DNA" plasmid. It has a more lasting immune response and good stability, but its poor immunogenicity makes its antigen expression level low. In order to better deliver DNA vaccines in vivo, it is necessary to select suitable materials.

[0003] Protamine is a type of small arginine-rich nuclear protein that evolved from histones. Compared with conventional histones, protamine carries a stronger positive charge, so it has a stronger binding ability with DNA. The β-glucan structure on the surface of the yeast cell wall can also be used as an adjuvant to increase the SIgA level and the immunogenicity of oral vaccines. At the same time, the natural characteristics of microorganisms can effectively overcome the intestinal epithelial barrier, thereby delivering drugs to the immune layer. However, there are no reports in the prior art on the combination of protamine, yeast cell walls and "DNA" plasmids after the gene encoding the coronavirus protein antigen is recombined into a eukaryotic expression vector. Summary of the invention

[0004] The object of the present invention is to provide a yeast cell wall-wrapped protamine DNA complex YCW@PS-DNA, which consists of a yeast cell wall YCW and a PS-DNA complex, wherein the weight ratio of the YCW to the PS-DNA complex is 1-7:1; the PS-DNA complex consists of protamine and a DNA recombinant plasmid, wherein the charge ratio (N / P) of the protamine to the DNA recombinant plasmid is 2-8:1, and the nucleotide sequence of the DNA recombinant plasmid is shown in SEQ ID NO.1.

[0005] In a preferred technical solution of the present invention, the weight ratio of the yeast cell wall YCW to the PS-DNA complex is 2-5:1.

[0006] In a preferred technical solution of the present invention, the charge ratio of the protamine to the DNA recombinant plasmid is 2-5:1.

[0007] In a preferred technical solution of the present invention, the particle size of the yeast cell wall YCW is 100-250 nm, preferably 140-200 nm.

[0008] In a preferred technical solution of the present invention, the particle size of the PS-DNA complex is 150-400 nm, preferably 200-250 nm.

[0009] In a preferred technical solution of the present invention, the PD I of the PS-DNA complex is less than 0.3, preferably less than 0.15.

[0010] In a preferred technical solution of the present invention, the potential of the PS-DNA complex is 5-20 mV.

[0011] In a preferred technical solution of the present invention, the particle size of the YCW@PS-DNA complex is 250-450 nm, preferably 300-400 nm.

[0012] In a preferred technical solution of the present invention, the PDI of the YCW@PS-DNA complex is less than 0.3, preferably less than 0.2.

[0013] In a preferred technical solution of the present invention, the potential of the YCW@PS-DNA complex is -5 to -20 mV.

[0014] In a preferred technical solution of the present invention, the encapsulation rate of the YCW@PS-DNA complex is greater than 90%, preferably greater than 95%.

[0015] In the preferred technical solution of the present invention, the β-glucan content on the surface of the YCW@PS-DNA complex is not less than 20% in intestinal fluid and gastric fluid for 1-4 hours.

[0016] In a preferred technical solution of the present invention, the release amount of the YCW@PS-DNA complex in the gastrointestinal tract within 2 hours does not exceed 5%, and the release amount in the gastrointestinal tract within 8 hours does not exceed 10%.

[0017] In the preferred technical solution of the present invention, the preparation method of the YCW@PS-DNA complex is:

[0018] (1) dispersing saccharomyces cerevisiae in a sodium hydroxide solution with a concentration of 1-5 M at a weight-to-volume ratio of 1:10-20 (m / v), stirring at 20-30 rpm for 1-5 h in a constant temperature water bath at 70-80° C., collecting the precipitate by centrifugation, washing with water and resuspending with water, adjusting the pH to 4-5, incubating with stirring at 60-70° C. and 20-30 rpm for 1-5 h, collecting the precipitate by centrifugation, washing with water, isopropanol, and acetone in sequence, collecting the precipitate by centrifugation, and freeze-drying in a vacuum to obtain yeast microcapsule powder;

[0019] (2) adding water to the yeast microcapsule powder obtained in step (1) to prepare a solution with a concentration of 1-10 μg / mL, adding 0.1 mm zirconium oxide beads and vortexing at a vortex speed of 1400-2200 rpm for 1-5 h to prepare yeast cell walls;

[0020] (3) Extruding the yeast cell wall and PS-DNA complex prepared in step (2) at a mass ratio of 1-10:1 through a liposome extruder with a polycarbonate porous membrane to obtain a product.

[0021] In the preferred technical solution of the present invention, in step (1), the centrifugation condition is 2000-3000 rpm for 10-30 min.

[0022] In the preferred technical scheme of the present invention, in step (3), the preparation method of the PS-DNA complex is: vortexing the protamine and the DNA recombinant plasmid at a charge ratio of 2-8:1, the vortexing speed is 1400-2200rpm, the vortexing time is 15-30s, and standing at room temperature for 30-60min.

[0023] In the preferred technical solution of the present invention, the preparation method of the recombinant DNA plasmid is: select the cell receptor binding region (RBD) of the S protein domain as the target antigen sequence, use SAC I and XBA I as restriction sites to insert into the vector, and obtain.

[0024] In a preferred technical solution of the present invention, the vector is pcDNA3.1.

[0025] In the preferred technical solution of the present invention, the DNA recombinant plasmid is pcDNA3.1 SARS-CoV-2RBD.

[0026] In a preferred technical solution of the present invention, in step (3), the extrusion is performed until the yeast cell wall can be seen wrapped around the surface of the PS-DNA complex through a transmission electron microscope.

[0027] In a preferred technical solution of the present invention, in step (3), the particle size of the polycarbonate porous membrane is not less than 400 nm.

[0028] In a preferred technical solution of the present invention, in step (3), the number of extrusions is 20-50 times, preferably 30-40 times.

[0029] Another object of the present invention is to provide a method for preparing a yeast cell wall-wrapped protamine DNA complex YCW@PS-DNA, wherein the complex is composed of a yeast cell wall YCW and a PS-DNA complex, and the weight ratio of the YCW to the PS-DNA complex is 1-7:1; the PS-DNA complex is composed of protamine and a DNA recombinant plasmid, wherein the charge ratio (N / P) of the protamine to the DNA recombinant plasmid is 2-8:1, and the nucleotide sequence of the DNA recombinant plasmid is as shown in SEQ ID NO.1. The preparation method of the complex is:

[0030] (1) dispersing cerevisiae into a 1-5 M sodium hydroxide solution at a weight-to-volume ratio of 1:10-20 (m / v), stirring at 20-30 rpm for 1-5 h in a constant temperature water bath at 70-80° C., collecting the precipitate by centrifugation, washing with water and resuspending with water, adjusting the pH to 4-5, incubating with stirring at 60-70° C. and 20-30 rpm for 1-5 h, collecting the precipitate by centrifugation, washing with water, isopropanol, and acetone in sequence, collecting the precipitate by centrifugation, and freeze-drying in a vacuum to obtain yeast microcapsule powder;

[0031] (2) adding water to the yeast microcapsule powder obtained in step (1) to prepare a solution with a concentration of 1-10 μg / mL, adding 0.1 mm zirconium oxide beads and vortexing at a vortex speed of 1400-2200 rpm for 1-5 h to prepare yeast cell walls;

[0032] (3) Extruding the yeast cell wall and PS-DNA complex prepared in step (2) at a mass ratio of 1-7:1 through a liposome extruder with a polycarbonate porous membrane to obtain a liposome.

[0033] In the preferred technical solution of the present invention, in step (1), the centrifugation condition is 2000-3000 rpm for 10-30 min.

[0034] In the preferred technical scheme of the present invention, in step (3), the preparation method of the PS-DNA complex is: vortexing the protamine and the DNA recombinant plasmid at a charge ratio of 2-8:1, the vortexing speed is 1400-2200rpm, the vortexing time is 15-30s, and standing at room temperature for 30-60min.

[0035] In the preferred technical solution of the present invention, the preparation method of the recombinant DNA plasmid is: select the cell receptor binding region (RBD) of the S protein domain as the target antigen sequence, use SAC I and XBA I as restriction sites to insert into the vector, and obtain.

[0036] In a preferred technical solution of the present invention, the vector is pcDNA3.1.

[0037] In the preferred technical solution of the present invention, the DNA recombinant plasmid is pcDNA3.1 SARS-CoV-2RBD.

[0038] In a preferred technical solution of the present invention, in step (3), the extrusion is performed until the yeast cell wall can be seen wrapped around the surface of the PS-DNA complex through a transmission electron microscope.

[0039] In a preferred technical solution of the present invention, in step (3), the particle size of the polycarbonate porous membrane is not less than 400 nm.

[0040] In a preferred technical solution of the present invention, in step (3), the number of extrusions is 20-50 times, preferably 30-40 times.

[0041] In a preferred technical solution of the present invention, the weight ratio of the yeast cell wall YCW to the PS-DNA complex is 2-5:1.

[0042] In a preferred technical solution of the present invention, the charge ratio of the protamine to the DNA recombinant plasmid is 2-5:1.

[0043] In a preferred technical solution of the present invention, the particle size of the yeast cell wall YCW is 100-250 nm, preferably 140-200 nm.

[0044] In a preferred technical solution of the present invention, the particle size of the PS-DNA complex is 150-400 nm, preferably 200-250 nm.

[0045] In a preferred technical solution of the present invention, the PD I of the PS-DNA complex is less than 0.3, preferably less than 0.15.

[0046] In a preferred technical solution of the present invention, the potential of the PS-DNA complex is 5-20 mV.

[0047] In a preferred technical solution of the present invention, the particle size of the YCW@PS-DNA complex is 250-450 nm, preferably 300-400 nm.

[0048] In a preferred technical solution of the present invention, the PDI of the YCW@PS-DNA complex is less than 0.3, preferably less than 0.2.

[0049] In a preferred technical solution of the present invention, the potential of the YCW@PS-DNA complex is -5 to -20 mV.

[0050] In a preferred technical solution of the present invention, the encapsulation rate of the YCW@PS-DNA complex is greater than 90%, preferably greater than 95%.

[0051] In the preferred technical solution of the present invention, the β-glucan content on the surface of the YCW@PS-DNA complex is not less than 20% in intestinal fluid and gastric fluid for 1-4 hours.

[0052] In a preferred technical solution of the present invention, the release amount of the YCW@PS-DNA complex in the gastrointestinal tract within 2 hours does not exceed 5%, and the release amount in the gastrointestinal tract within 8 hours does not exceed 10%.

[0053] The object of the present invention is to provide a pharmaceutical composition, comprising any one of the PS-DNA complex and the YCW@PS-DNA complex described in the present invention or a combination thereof and a pharmaceutically acceptable carrier.

[0054] In the preferred technical solution of the present invention, the amount or type of the pharmaceutically acceptable carrier in the pharmaceutical composition is determined according to factors such as the physicochemical properties and content of the active ingredient in the composition, the type of preparation, the dissolution and bioavailability of the preparation, and the like.

[0055] In a preferred technical solution of the present invention, the administration method of the pharmaceutical composition is selected from any one of oral administration, mucosal administration, and injection administration.

[0056] In a preferred technical solution of the present invention, the dosage form of the pharmaceutical composition is an oral preparation.

[0057] In a preferred technical solution of the present invention, the oral preparation is selected from any one of oral liquid preparations, tablets, capsules, granules, ointments, syrups, powders, dews, effervescent agents, suspensions, pills, pellets, mixtures, pastes, emulsions, and liniments.

[0058] In the preferred technical scheme of the present invention, the pharmaceutically acceptable carrier of the present invention is a commonly used excipient or auxiliary material in the art for preparing the desired preparation, including fillers (diluents), disintegrants, binders, lubricants (glidants or anti-adhesive agents), dispersants, wetting agents, pH regulators (acid-base regulators), osmotic pressure regulators, pore-forming agents, solubilizers, antioxidants, antibacterial agents (bactericides), analgesics (anesthetics), suspending agents, emulsifiers, emulsifier aids, lyoprotectants, flavoring agents, fragrance agents, etc.

[0059] In the preferred technical scheme of the present invention, the filler is selected from any one or a combination of lactose, powdered sugar, dextrin, starch, sodium carboxymethyl starch, sodium starch glycolate, pregelatinized starch, modified starch, hydroxypropyl starch, potato starch, corn starch, cellulose, inorganic calcium salt, calcium chloride, calcium sulfate, calcium phosphate, calcium hydrogen phosphate, precipitated calcium carbonate, sorbitol, mannitol, microcrystalline cellulose, sodium carboxymethyl cellulose, ethyl cellulose, and hydroxypropyl methyl cellulose.

[0060] In a preferred technical solution of the present invention, the disintegrant is selected from any one or a combination of starch, sodium carboxymethyl starch, sodium starch glycolate, pregelatinized starch, modified starch, hydroxypropyl starch, potato starch, corn starch or its derivatives, cross-linked polyvinyl pyrrolidone, microcrystalline cellulose, low-substituted hydroxypropyl cellulose, and cross-linked sodium carboxymethyl cellulose.

[0061] In the preferred technical scheme of the present invention, the adhesive is selected from any one of syrup, gum arabic, gelatin, sorbitol, tragacanth gum, cellulose, microcrystalline cellulose, sodium carboxymethyl cellulose, ethyl cellulose, methyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, gelatin slurry, starch slurry, polyvinyl pyrrolidone, sodium carboxymethyl starch, sodium starch glycolate, pregelatinized starch, modified starch, hydroxypropyl starch, potato starch, and corn starch, or a combination thereof.

[0062] In a preferred technical solution of the present invention, the lubricant is selected from any one of micro-powdered silica gel, magnesium stearate, talc, colloidal silicon dioxide, aluminum hydroxide, boric acid, hydrogenated vegetable oil, polyethylene glycol, and sodium lauryl sulfate, or a combination thereof.

[0063] In a preferred technical solution of the present invention, the wetting agent is selected from any one of sodium lauryl sulfate, polysorbate (Tween), water, alcohol, ester or a combination thereof.

[0064] In the preferred technical scheme of the present invention, the antioxidant is selected from any one of sodium sulfite, sodium bisulfite, sodium metabisulfite, sodium thiosulfate, vitamin C, vitamin E, dibutyl benzoic acid, butylated hydroxyanisole (BHA), dibutyl hydroxytoluene (BHT), propyl gallate (PG), niacinamide, acetylcysteic acid, and tert-butylhydroquinone (TBHQ) or a combination thereof.

[0065] In a preferred technical solution of the present invention, the bacteriostatic agent (bactericide) is selected from any one of phenol, cresol, chlorobutanol, benzyl alcohol or a combination thereof.

[0066] In a preferred technical solution of the present invention, the analgesic (anesthetic) is selected from any one of chlorobutanol, benzyl alcohol, lidocaine, procaine or a combination thereof.

[0067] In the preferred technical scheme of the present invention, the suspending agent is selected from any one of microcrystalline cellulose, sodium carboxymethyl cellulose, ethyl cellulose, methyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, syrup, glycerin, gelatin, gum arabic, tragacanth, sodium alginate, potassium alginate, pectin or a combination thereof.

[0068] In a preferred technical scheme of the present invention, the acid-base regulator (pH regulator) is selected from any one of hydrochloric acid, sodium hydroxide, potassium hydroxide, citric acid, sodium citrate, potassium citrate, malic acid, sodium malate, potassium malate, sodium dihydrogen phosphate, disodium hydrogen phosphate, calcium hydroxide, calcium lactate, sodium lactate, sodium phosphate, potassium phosphate, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium bicarbonate, and sodium carbonate, or a combination thereof.

[0069] In a preferred technical solution of the present invention, the osmotic pressure regulator is selected from any one of sodium chloride, potassium chloride, glucose, phosphate and citrate.

[0070] In the preferred technical scheme of the present invention, the emulsifier is selected from any one of sodium stearate, potassium stearate, triethanolamine stearate, magnesium stearate, calcium stearate, sodium lauryl sulfate, sodium dodecylbenzene sulfonate, polysorbate (Tween), Span, benzyl alcohol, benzyl alcohol, tragacanth gum, gum arabic, Pluronic F-68, lecithin, and soybean lecithin, or a combination thereof.

[0071] In a preferred technical solution of the present invention, the auxiliary emulsifier is selected from any one of n-butanol, ethylene glycol, ethanol, propylene glycol, glycerol, and polyglycerol esters, or a combination thereof.

[0072] In a preferred technical solution of the present invention, the lyoprotectant is selected from any one of sucrose, lactose, galactose, glucose, trehalose, mannitol, and sorbitol, or a combination thereof.

[0073] In the preferred technical solution of the present invention, the solubilizing agent is selected from any one of Tween-80, Pluronic F-68, benzyl alcohol, benzyl alcohol, bile salt, deoxycholate, glycerol, propylene glycol, and polyethylene glycol, or a combination thereof.

[0074] In a preferred technical solution of the present invention, the flavoring agent is selected from any one of honey, syrup, essence, sweetener, or a combination thereof.

[0075] In a preferred technical solution of the present invention, the complex of the present invention is mixed with a pharmaceutically acceptable sustained-release preparation carrier or a controlled-release preparation carrier, such as adding a blocking agent coating or making it into a skeleton-type preparation, and is made into a sustained-release preparation or a controlled-release preparation according to methods in the art.

[0076] In the preferred technical solution of the present invention, the sustained-release preparation carrier or controlled-release preparation carrier is selected from any one of an oily admixture, a hydrophilic colloid, a water-insoluble blocker, an enteric blocker, and a biodegradable blocker or a combination thereof.

[0077] In the preferred technical solution of the present invention, the oily admixture is selected from any one of glyceryl monostearate, hydrogenated castor oil, mineral oil, polysiloxane, dimethylsiloxane or a combination thereof.

[0078] In the preferred technical scheme of the present invention, the hydrophilic colloid is selected from any one of methylcellulose (MC), sodium carboxymethylcellulose (CMC-Na), hydroxyethylcellulose (HEC), hydroxypropyl cellulose (HPC), hydroxypropyl methylcellulose (HMPC), polyvinyl pyrrolidone (PVP), gum arabic, tragacanth or carbopol, polyvinyl alcohol (PVA), pectin, alginate, chitosan, xanthan gum, guar gum, garnet, gelatin, agar, and galactomannan, or a combination thereof.

[0079] In the preferred technical solution of the present invention, the water-insoluble retarder is selected from any one of ethyl cellulose (EC), cellulose acetate (CA), polyethylene, polypropylene, polysiloxane, ethylene vinyl acetate copolymer (EVA), polymethyl methacrylate or a combination thereof.

[0080] In the preferred technical solution of the present invention, the enteric retarder is selected from any one of cellulose acetate phthalate (CAP), hydroxypropyl methylcellulose phthalate (HMPCP), polyvinyl alcohol phthalate (PVAP), hydroxypropyl methylcellulose acetate succinate (HPMCAS) acrylic resin or a combination thereof.

[0081] In the preferred technical solution of the present invention, the biodegradable retarder is selected from any one of wax, fatty acid, fatty acid ester, fatty alcohol, carnauba wax, stearic acid, glyceryl monostearate, stearyl alcohol, and hexadecanol, or a combination thereof.

[0082] Another object of the present invention is to provide the use of the PS-DNA complex, YCW@PS-DNA complex or the pharmaceutical composition of the present invention in the preparation of vaccines against respiratory viral infections.

[0083] In a preferred technical solution of the present invention, the respiratory virus is a coronavirus or an influenza virus.

[0084] In the preferred technical solution of the present invention, the coronavirus is coronavirus SARS-CoV-2.

[0085] In the preferred technical scheme of the present invention, the SARS-CoV-2 includes virus subtypes such as the original strain, D614G variant, Gamma variant, Delta variant and Omicron variant.

[0086] In a preferred technical solution of the present invention, the influenza virus is an influenza virus of the H1N1, H5N1, or H7N9 subtype.

[0087] Unless otherwise specified, when the present invention relates to the percentage between liquids, the percentage is volume / volume percentage; when the present invention relates to the percentage between liquids and solids, the percentage is volume / weight percentage; when the present invention relates to the percentage between solids and liquids, the percentage is weight / volume percentage; the rest are weight / weight percentages.

[0088] Unless otherwise stated, the present invention uses the following detection methods:

[0089] 1. The calculation formula of charge ratio (N / P) is:

[0090] N / P=(ρ-protamine×21) / (4250×5)) / (ρ-DNA / 308), where ρ-protamine and ρ-DNA represent the mass concentrations of protamine and recombinant plasmid, respectively. Mass concentration ρ(g / L)=solute mass m(g) / solution volume V(L), 21 refers to the number of arginine residues in protamine; 5 is the volume conversion factor; 4250 and 308 represent the relative molecular masses of one nucleotide in protamine and DNA, respectively.

[0091] 2. Use Malvern particle size analyzer to measure particle size and potential.

[0092] 3. Determination of encapsulation efficiency

[0093] The YCW@PS-DNA complex was centrifuged at 17000g for 0.5h at 4℃, 100μL of the supernatant was taken and added with an equal volume of 4M NaCl solution to dissolve the complex in the supernatant, and the complex containing 100μg of recombinant plasmid was taken and added with 3mL of double distilled water to prepare a 2μg / mL standard working solution, and finally diluted with 1×TE buffer to 2000ng / mL, 1500ng / mL, 1000ng / mL, 500ng / mL, 200ng / mL, 100ng / mL, 0ng / mL, respectively, and the same volume of standard working solution and PicoGreen working solution were mixed, and 200μL of the mixed solution was added to a 96-well plate, and 3 groups were measured in parallel at each DNA solution concentration, and placed at room temperature in the dark for 5min; the fluorescence value was detected using an enzyme reader, and the standard curve of standard solution concentration-fluorescence intensity was prepared. Regression equation y=0.0766x-0.6154R 2=0.9977. Take 95 μL of 1×TE buffer and add it to a 96-well plate, then add 5 μL of YCW@PS-DNA complex, and finally add 100 μL of PicoGreen working solution, mix well, protect from light, and incubate at room temperature for 5 min; use an ELISA reader to detect its fluorescence value at an excitation wavelength of 480 nm and an emission wavelength of 520 nm; substitute the fluorescence value of the sample solution into the standard curve to calculate the free DNA content of the sample, and the encapsulation rate calculation formula is: encapsulation rate (%) = (total DNA content-free DNA content) / total DNA content × 100%.

[0094] 4. Determination of β-glucan content on the surface of YCW@PS-DNA complex

[0095] Take an equal amount of YCW@PS-DNA and incubate it in artificial intestinal fluid and artificial gastric fluid for 1h and 4h respectively, centrifuge at 3000rpm for 15min, resuspend the precipitate in 400μL of 2M potassium hydroxide solution, and incubate the sample on ice for 30min. Then add 1.6mL of 1.2M sodium acetate buffer (pH3.8) and 40μL of glucanase. Incubate on ice for 2min. Then incubate the sample at 40℃ overnight. Add deionized water (10mL) to each test tube and centrifuge at 3000rpm for 10min. Add the supernatant (100μL) to 4mL of glucan assay reagent, incubate at 40℃ for 20 minutes, and read the OD value at 510nm using a multi-detection microplate reader.

[0096] Compared with the prior art, the technical effects of the present invention are:

[0097] 1. The YCW@PS-DNA complex of the present invention uses protamine as a polycation to condense DNA to form a PS-DNA complex to improve its ability to resist severe external forces and enhance the in vivo and in vitro transfection efficiency of genes; at the same time, the yeast cell wall YCW is selected to be wrapped on the surface of the PS-DNA complex to protect the DNA from being degraded by nucleases in the gastrointestinal tract, and the β-glucan structure on the surface of the yeast cell wall can target the M cells with dectin-1 receptors on the surface of the intestinal mucosa and the internal antigen presenting cells. The YCW@PS-DNA complex of the present invention has good physical and gastrointestinal stability, can induce a higher level of mucosal immunity in the body, and simultaneously produce humoral immunity and cellular immune responses, provide comprehensive immune protection, and has good safety, and can be used to prepare vaccines against respiratory virus infections.

[0098] 2. The invention is simple to prepare, low in cost, and can be used for industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0099] Figure 1 Schematic diagram of the construction of the DNA recombinant plasmid of the present invention;

[0100] Figure 2 The PS-DNA complex of the present invention is verified by nucleic acid gel;

[0101] Figure 3 Scanning electron microscopy image of the PS-DNA complex of the present invention;

[0102] Figure 4 Transmission electron microscopy image of the PS-DNA complex of the present invention;

[0103] Figure 5 Changes in β-glucan content of the YCW@PS-DNA complex of the present invention in simulated intestinal fluid and gastric fluid (n=4);

[0104] Figure 6 In vitro release evaluation of the YCW@PS-DNA complex of the present invention (n=3);

[0105] Figure 7 Results of immunofluorescence staining of the YCW@PS-DNA complex of the present invention in mice, A CD8+T cells in colon tissue; B Quantification of CD8+T cells in each field of view (n=3);

[0106] Figure 8 Evaluation of the humoral immunity level of the YCW@PS-DNA complex of the present invention in mice (n=5);

[0107] Fig. 9 Evaluation of mucosal immune level of the YCW@PS-DNA complex of the present invention in mice (n=5);

[0108] Fig.10 H&E staining results of pathological tissue sections of mice after administration of the YCW@PS-DNA complex of the present invention. DETAILED DESCRIPTION

[0109] The reagents and instruments in the examples are all commercially available, including protamine sulfate (Beijing Solebold Technology Co., Ltd.), vortexer (VORTEX-5, Haimen Qilin Bell Instrument Manufacturing Co., Ltd.), liposome extruder (LF-1, Avestin), and polycarbonate porous membrane (Avestin, membrane pore size: 400 nm).

[0110] A protamine solution with a concentration of 1 μg / μL is prepared by dissolving protamine sulfate in deionized water.

[0111] Example 1 Construction and extraction of recombinant plasmid

[0112] 1. Construction of recombinant plasmid:

[0113] The cell receptor binding domain (RBD) of the S protein domain was selected as the target antigen sequence and inserted into the pcDNA3.1(+) vector using SACI and XBAI as restriction sites ( Figure 1 ). The whole gene synthesis was completed by a synthesis company to obtain the recombinant plasmid pcDNA3.1 SARS-CoV-2RBD, and the nucleotide sequence is shown in SEQ ID NO.1. SEQ ID NO.1 sequence is:

[0114] AGGGTGCAGCCTACCGAGTCTATCGTGAGGTTCCCCAACATCACCAACCTGTGCCCCTTTGGCGAGGTGTTCAATGCCACCCGGTTCGCTTCCGTGTATGCTTGGAACAGGAAGAGGATCTCTAACTGCGTGGCCGACTACAGCGTGCTGTACAACAGCGCATCCTT CTCCACCTTCAAATGCTATGGCGTGTCCCCCACCAAGCTGAACGATCTGTGTTTCACCAACGTGTACGCTGACTCCTTTGTGATTCGGGGCGATGAGGTGAGGCAGATCGCCCTGGACAGACAGGAAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCA CCGGCTGCGTGATTGCTTGGAATAGCAACAATCTGGACAGTAAGGTGGGGGGCAACTACAACTACCTGTATAGGCTGTTCAGGAAGAGCAACCTGAAGCCCTTTGAAAGAGACATCTCCACAGAGATTTACCAGGCCGGCAGCACCCCCTGTAATGGAGTGGAAGGA TTTAACTGCTACTTCCCCCTGCAGAGCTACGGCTTCCAGCCAACAAACGGCGTGGGCTACCAGCCTTACAGGGTGGTGGTGCTGTCCTTCGAGCTGCTGCATGCCCCTGCTACCGTGTGTGGACCTAAGAAGAGCACCAACCTGGTGAAAAACAAATGCGTGAACTTC

[0115] 2. Extraction of recombinant plasmid

[0116] 1 μL of recombinant plasmid pcDNA3.1 SARS-CoV-2RBD was added to the competent E. coli cells, placed on ice for 30 minutes, then heat-shocked in a 42°C water bath for 65 seconds, and then placed on ice for 5 minutes. Finally, the competent cells were all sucked out with a gun on the clean bench and evenly applied to an ampicillin-resistant LB solid culture dish. The culture dish was placed in a 37°C incubator for overnight culture for 12 hours, and then a single clone was picked and placed in a conical flask containing 250 mL of liquid LB culture medium. At the same time, 250 μL of ampicillin was added, and the culture was shaken and cultured at 37°C and 180 rpm for 14 hours. After the bacterial solution reached a suitable turbid concentration, the plasmid was extracted using an endotoxin-free extraction kit, and the concentration of the obtained plasmid was measured using a Nano drop lite spectrophotometer. The DNA concentration in the recombinant plasmid was 396 ng / μL, which was used in the following embodiments and test examples.

[0117] Example 2 Preparation of PS-DNA complex of the present invention

[0118] The protamine solution (concentration of 1 μg / μL) and the recombinant plasmid of Example 1 (DNA concentration of 396 ng / μL) were mixed at a charge ratio of 5 / 1, and mixed thoroughly for 15 seconds using a vortexer (vortex rotation speed of 1400 rpm), and allowed to stand at room temperature for 30 minutes. The particle size and potential were measured using a Malvern particle sizer. The particle size of the PS-DNA complex was 235.09±4.75 nm, the PDI was 0.12±0.05, the particle size uniformity was good, and the potential was 16.33±0.44 mV.

[0119] Example 3 Preparation of PS-DNA complex of the present invention

[0120] The protamine solution (concentration of 1 μg / μL) and the recombinant plasmid of Example 1 (DNA concentration of 396 ng / μL) were mixed at a charge ratio of 3 / 1, and fully mixed for 15 seconds using a vortexer (vortex rotation speed of 1800 rpm), and allowed to stand at room temperature for 30 minutes to obtain the PS-DNA complex. The particle size was 253.16±4.88 nm, the PDI was 0.14±0.05, the particle size uniformity was good, and the potential was 13.48±0.44 mV.

[0121] Example 4 Preparation of PS-DNA complex of the present invention

[0122] The protamine solution (concentration of 1 μg / μL) and the recombinant plasmid of Example 1 (DNA concentration of 396 ng / μL) were mixed at a charge ratio of 2 / 1, and fully mixed for 15 seconds using a vortexer (vortex rotation speed of 2000 rpm), and allowed to stand at room temperature for 30 minutes to obtain the PS-DNA complex. The particle size was 388.16±4.88 nm, the PDI was 0.23±0.05, the particle size uniformity was good, and the potential was 6.12±0.78 mV.

[0123] Example 5 Preparation of the YCW@PS-DNA complex of the present invention

[0124] (1) Weigh 20 g of brewer's yeast and disperse it in 300 mL of 1 M sodium hydroxide solution. Stir at 20 rpm for 1.5 h in a constant temperature water bath at 80° C., centrifuge at 3000 rpm for 10 min, discard the supernatant, wash twice with deionized water, resuspend in 300 mL of water, adjust the pH to 4 with concentrated hydrochloric acid solution, stir at 60° C. and 20 rpm for 1.5 h, centrifuge at 3000 rpm for 10 min, collect the precipitate, wash twice with water, centrifuge and wash four times with 60 mL of HPLC grade isopropanol, wash twice with 60 mL of acetone, centrifuge again at 3000 rpm for 10 min, and freeze-dry the collected precipitate in a vacuum to obtain yeast microcapsule powder;

[0125] (2) Adding double distilled water to the yeast microcapsule powder prepared in step (1) to prepare 10 mL of a solution with a concentration of 10 μg / mL, adding a certain volume of 0.1 mm zirconium oxide beads and vortexing in a 30 mL glass vial, the vortexing speed is 1400 rpm, the vortexing time is 4 h, and yeast cell wall is prepared; the particle size and potential are measured by a Malvern particle size analyzer, the particle size of the yeast cell wall is 145.11±5.12 nm, the uniformity is good, and the potential is -6.28±0.77 mV;

[0126] (3) The yeast cell wall prepared in step (2) was mixed with the PS-DNA complex of Example 2 at a mass ratio of 5:1, and co-extruded 40 times through a liposome extruder with a 400 nm polycarbonate porous membrane to obtain YCW@PS-DNA complex. The particle size of the YCW@PS-DNA complex was 391.08±20.64 nm, the PDI was 0.15±0.03, the potential was 5.77±1.96 mV, and the encapsulation efficiency was 97.45 + 0.04%.

[0127] Example 6 Preparation of the YCW@PS-DNA complex of the present invention

[0128] (1) Weigh 20 g of brewer's yeast and disperse it in 300 mL of 1 M sodium hydroxide solution. Stir at 20 rpm for 1.5 h in a constant temperature water bath at 80° C., centrifuge at 3000 rpm for 10 min, discard the supernatant, wash twice with deionized water, resuspend in 300 mL of water, adjust the pH to 4 with concentrated hydrochloric acid solution, stir at 60° C. and 20 rpm for 1.5 h, centrifuge at 3000 rpm for 10 min, collect the precipitate, wash twice with water, centrifuge and wash four times with 60 mL of HPLC grade isopropanol, wash twice with 60 mL of acetone, centrifuge again at 3000 rpm for 10 min, and freeze-dry the collected precipitate in a vacuum to obtain yeast microcapsule powder;

[0129] (2) Adding double distilled water to the yeast microcapsule powder to prepare a solution with a concentration of 10 μg / mL, 10 mL of which was added with a certain volume of 0.1 mm zirconium oxide beads and vortexed in a 30 mL glass vial at a vortex speed of 1800 rpm for 4 h to prepare the yeast cell wall;

[0130] (3) Yeast cell wall and the PS-DNA complex of Example 2 were mixed at a mass ratio of 3:1, and co-extruded 40 times through a liposome extruder with a 400 nm polycarbonate porous membrane to obtain a liposome.

[0131] The encapsulation efficiency detected by the method of the present invention is 91.05 + 0.01%.

[0132] Example 7 Preparation of the YCW@PS-DNA complex of the present invention

[0133] (1) Weigh 20 g of brewer's yeast and disperse it in 300 mL of 1 M sodium hydroxide solution. Stir at 20 rpm for 1.5 h in a constant temperature water bath at 80° C., centrifuge at 3000 rpm for 10 min, discard the supernatant, wash twice with deionized water, resuspend in 300 mL of water, adjust the pH to 4 with concentrated hydrochloric acid solution, stir at 60° C. and 20 rpm for 1.5 h, centrifuge at 3000 rpm for 10 min, collect the precipitate, wash twice with water, centrifuge and wash four times with 60 mL of HPLC grade isopropanol, wash twice with 60 mL of acetone, centrifuge again at 3000 rpm for 10 min, and freeze-dry the collected precipitate in a vacuum to obtain yeast microcapsule powder;

[0134] (2) adding double distilled water to the yeast microcapsule powder prepared in step (1) to prepare 10 mL of a solution with a concentration of 10 μg / mL, adding a certain volume of 0.1 mm zirconium oxide beads in a 30 mL glass vial and vortexing at a vortex speed of 2000 rpm for 4 h to prepare yeast cell walls;

[0135] (3) The yeast cell wall obtained in step (2) was mixed with the PS-DNA complex of Example 2 at a mass ratio of 7:1, and co-extruded 40 times through a liposome extruder with a 400 nm polycarbonate porous membrane to obtain the encapsulation efficiency of 96.13. + 0.04%.

[0136] Example 8 Preparation of the YCW@PS-DNA complex of the present invention

[0137] (1) Weigh 20 g of brewer's yeast and disperse it in 300 mL of 1 M sodium hydroxide solution. Stir at 20 rpm for 1.5 h in a constant temperature water bath at 80° C., centrifuge at 3000 rpm for 10 min, discard the supernatant, wash twice with deionized water, resuspend in 300 mL of water, adjust the pH to 4 with concentrated hydrochloric acid solution, stir at 60° C. and 20 rpm for 1.5 h, centrifuge at 3000 rpm for 10 min, collect the precipitate, wash twice with water, centrifuge and wash four times with 60 mL of HPLC grade isopropanol, wash twice with 60 mL of acetone, centrifuge again at 3000 rpm for 10 min, and freeze-dry the collected precipitate in a vacuum to obtain yeast microcapsule powder;

[0138] (2) adding double distilled water to the yeast microcapsule powder prepared in step (1) to prepare 10 mL of a solution with a concentration of 10 μg / mL, adding a certain volume of 0.1 mm zirconium oxide beads in a 30 mL glass vial and vortexing at a vortex speed of 2200 rpm for 4 h to prepare yeast cell walls;

[0139] (3) The yeast cell wall prepared in step (2) was mixed with the PS-DNA complex of Example 2 at a mass ratio of 1:1, and co-extruded 40 times through a liposome extruder with a 400 nm polycarbonate porous membrane to obtain a liposome.

[0140] Comparative Example 1 Preparation of PS-DNA Complex

[0141] The protamine solution (concentration of 1 μg / μL) and the recombinant plasmid of Example 1 (DNA concentration of 396 ng / μL) were mixed at a charge ratio of 1.5 / 1, and mixed thoroughly for 15 seconds using a vortexer (vortex speed of 1400 rpm), and allowed to stand at room temperature for 30 minutes.

[0142] Comparative Example 2 Preparation of PS-DNA Complex

[0143] The protamine solution (concentration of 1 μg / μL) and the recombinant plasmid of Example 1 (DNA concentration of 396 ng / μL) were mixed at a charge ratio of 1 / 1, and mixed thoroughly for 15 s using a vortexer (vortex speed of 1400 rpm), and allowed to stand at room temperature for 30 min.

[0144] Comparative Example 3 Preparation of PS-DNA complex

[0145] The protamine solution (concentration of 1 μg / μL) and the recombinant plasmid of Example 1 (DNA concentration of 396 ng / μL) were mixed at a charge ratio of 0.5 / 1, mixed thoroughly for 15 seconds using a vortexer (vortex speed of 1400 rpm), and allowed to stand at room temperature for 30 minutes.

[0146] Experimental Example 1 Nucleic Acid Gel Electrophoresis Analysis of PS-DNA Complex of the Present Invention

[0147] Weigh 300 mg of agarose, add 50 mL of 1×TAE buffer, heat and boil, and after the gel is heated and completely dissolved, let it air dry to 45-55°C, add 2 μL of nucleic acid dye, shake quickly, pour it into the gel tank, insert the comb, and when the gel turns white, pull out the comb teeth. Pour 1×TAE buffer into the electrophoresis tank and place the prepared gel into the buffer. Load the PS-DNA complex of Example 2-4 and Comparative Example 1-3, turn on the power of the electrophoresis tank, set the voltage to 120V, set the electrophoresis time to 40 minutes, and place the gel on a gel imager to take a picture. The results show that the RBD plasmid band is clear, with a molecular weight at 7000 ( Figure 2 A). The PS-DNA of Comparative Examples 1-3 showed obvious bands, indicating that the DNA was not condensed by protamine, and there was a large amount of free DNA in the solution. The PS-DNA of Examples 2-4 showed no bands, and there was no free DNA in the solution, indicating that protamine had successfully encapsulated the DNA ( Figure 2 B).

[0148] Experimental Example 2 Characterization of the physicochemical properties of the YCW@PS-DNA complex of the present invention

[0149] 1. Scanning electron microscopy analysis: The YCW@PS-DNA complex prepared in Example 5 was freeze-dried into powder and the yeast microcapsule powder prepared in step (1) of Example 5 was evenly applied to an area of ​​about 1 cm 2 Mica sheets. After treatment, they were observed using a scanning electron microscope with an accelerating voltage of 15kV. The results showed that after yeast cells were treated with acid, alkali and organic solvents to form yeast cell microcapsules, the middle depression showed that the nuclear material had been basically removed, leaving a complete and shrunken yeast cell wall ( Figure 3 A). The morphology of the YCW@PS-DNA complex is round and saturated, indicating that YCW has wrapped the PS-DNA complex ( Figure 3 B).

[0150] 2. Transmission electron microscopy analysis: 50 μL of the PS-DNA complex of Example 2 and the YCW@PS-DNA complex of Example 5 were respectively added dropwise onto a special copper mesh membrane, left to dry at room temperature, and then observed under a transmission electron microscope (TEM) at an accelerating voltage of 80 kV. The results showed that the PS-DNA complex was a regular round shape ( Figure 4 A), the yeast cell wall of the YCW@PS-DNA complex is firmly adsorbed and embedded on the surface of the PS-DNA complex ( Figure 4 B).

[0151] 3. Stability evaluation: 1 mL of the YCW@PS-DNA complexes of Examples 5-8 were taken respectively, and the particle size and potential were measured using a Malvern particle sizer. The particle size and potential of the YCW@PS-DNA complexes were not significantly changed after being placed at 4°C for seven days.

[0152] 4. Determination of surface β-glucan content: The β-glucan content on the surface of the YCW@PS-DNA complex of Example 5 was determined by the method of the present invention. The results showed that the β-glucan content of the YCW@PS-DNA complex in simulated intestinal fluid and gastric fluid for 1 h and 4 h did not change significantly ( Figure 5 ), indicating that its ability to be recognized by M cells remained unchanged even after 4 h in the gastrointestinal tract.

[0153] Experimental Example 3 Evaluation of in vitro release of the YCW@PS-DNA complex of the present invention

[0154] At 37°C, the PS-DNA complex of Example 2 and the YCW@PS-DNA complex of Example 5 were suspended in PBS solution (pH 7.4) and hydrochloric acid solution (pH 1.2), simulate the release process in the gastrointestinal tract after oral administration, and obtain the release samples at different time points. Shake for 0.5h, 1h, 2h, 4h, 6h, and 8h in a 37°C constant temperature incubator at a speed of 100 rpm. Aspirate 100 μL from the supernatant as a sample for in vitro release of 0.5h under the simulated gastric internal pH environment for testing. Centrifuge at 12000g for 20min at 4°C, remove the hydrochloric acid, add 1.5mL of pH7.4 PBS buffer solution, suspend and incubate in a 37°C incubator with constant shaking to simulate the intestinal pH environment in vitro. Take the samples for 0.5h, 1h, 2h, 4h, 6h, and 8h, respectively, and store them in a 4°C refrigerator. Finally, take the supernatant to determine the released DNA content by an ELISA instrument. The free DNA content in the release samples at different time points in the simulated gastrointestinal environment is determined by the OD value at an excitation wavelength of 480nm and an emission wavelength of 520nm. The results showed that the YCW@PS-DNA complex had good stability in the gastrointestinal environment and was significantly different from the PS-DNA complex (P<0.05) ( Figure 6 ).

[0155] Experimental Example 4 Evaluation of in vivo cellular immunity level of the YCW@PS-DNA complex of the present invention

[0156] 1. Experimental plan:

[0157] 6-8 week old SPF grade BALB / C female mice were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. The mice were randomly divided into 4 groups, 5 mice in each group:

[0158] YCW@PS-DNA intramuscular injection group: Each mouse was intramuscularly injected with 50 μg of DNA per mouse with the YCW@PS-DNA complex of Example 5 in the quadriceps and bilateral leg muscles;

[0159] YCW@PS-DNA oral administration group: each mouse was orally gavaged with 50 μg of DNA of the YCW@PS-DNA complex of Example 5;

[0160] PS-DNA intramuscular injection group: Each mouse was intramuscularly injected with 50 μg of DNA per mouse with the PS-DNA complex of Example 2 in the quadriceps and bilateral leg muscles;

[0161] Blank control group: injected with 200 μl of PBS.

[0162] The immunization cycle was three times at week 0, 2, and 4. On day 28, the colons of mice in different dosing groups were fixed with 4% paraformaldehyde and embedded in paraffin, and the staining experiment was submitted to Sevier Company.

[0163] Statistical methods: GraphPad Prism software was used for data analysis and graphing. Each experiment was repeated at least 3 times to obtain 3 independent experimental results. The experimental data were described in bar graphs, and the t-test was used for comparison between the two groups, with a test level of p = 0.05. The fluorescence intensity data were statistically analyzed using Image J software.

[0164] 2. Experimental results

[0165] (1) Expression of cellular immunity in vivo

[0166] Serum collection (humoral immunity samples): Serum samples: Blood was collected from the orbital venous plexus of mice at 1, 3, and 5 weeks, and serum was collected by centrifugation (5000 rpm, 10 min). Figure 7 A shows that the oral and injected YCW@PS-DNA groups had the largest number of CD8+T cells, which was significantly different from other groups (P<0.05), and produced more CD8+ memory T cells ( Figure 7 B), which indicates that the secretion of cytokines indirectly attacks pathogens and produces a certain cellular immunity.

[0167] (2) Expression of humoral immunity in vivo

[0168] Remove the entire mouse small intestine, clamp one end of the small intestine with scissors and clamps, carefully inject 3 ml of trypsin inhibitor solution into the intestine with a 1 mL syringe, clamp the other end of the intestine, incubate at room temperature for 10 minutes, transfer the intestinal contents to a centrifuge tube, vigorously vortex and ultrasonicate, centrifuge at 1800 rpm and 4 ° C for 10 minutes, take the supernatant to a new centrifuge tube, incubate at room temperature for 15 minutes, and add 50 mL of goat serum to each 1 mL of lavage fluid. The sample mixture was mixed with the sample diluent in a 1:1 ratio and used for ELISA experiments to detect IgG antibody levels. Results are shown in Figure 8 After the third immunization, the antibody titer of PS-DNA vaccine can reach 10 3 The oral and injection YCW@PSDN groups could reach 10 5 , which was significantly different from the PS-DNA group (P<0.01), indicating that high titers of specific IgG antibodies can be induced in vivo and there is a strong humoral immune response.

[0169] (2) Evaluation of mucosal immune levels in vivo

[0170] Used in ELISA test to detect IgA antibody level, the result is as follows Fig. 9The specific antibody titer of YCW@PS-DNA in the oral group could reach 10 in the second and third immunizations. 3 , which was significantly different from the other groups (P<0.01), and could induce a certain mucosal immune response in vivo.

[0171] (3) Pathological tissue staining sections

[0172] After fasting for 12 hours after the administration, the mice were anesthetized and killed by dislocating the neck. After being fixed with 4% paraformaldehyde for 48 hours, H&E staining sections were prepared to observe cell morphology changes and inflammation. The stomach and duodenum, cecum, jejunum, ileum and colon tissues were taken, fixed with 4% paraformaldehyde for 48 hours, embedded in paraffin and sliced, H&E staining, and the gastrointestinal tissue cell morphology and inflammatory cell infiltration of each group were observed under a microscope. It can be seen from the H&E staining results of gastrointestinal pathological sections (X40 times: Fig.10 A Organ tissue section, Fig.10 B) In gastrointestinal tract sections, no infiltration of inflammatory cells was observed in stomach sections and tissues such as the duodenum, cecum, jejunum, ileum and colon.

[0173] The above description of the specific embodiments of the present invention does not limit the present invention. Those skilled in the art may make various changes or modifications based on the present invention. As long as they do not depart from the spirit of the present invention, they should all fall within the scope of protection of the claims of the present invention.

Claims

1. A YCW@PS-DNA complex of protamine DNA wrapped in a yeast cell wall, comprising a yeast cell wall YCW and a PS-DNA complex, wherein the weight ratio of the YCW to the PS-DNA complex is 1-7:1; the PS-DNA complex comprises protamine and a DNA recombinant plasmid, wherein the charge ratio (N / P) of the protamine to the DNA recombinant plasmid is 2-8:1, and the nucleotide sequence of the DNA recombinant plasmid is shown in SEQ ID NO.

1.

2. The composite according to claim 1, wherein the particle size of the composite is 250-450 nm, preferably 300-400 nm.

3. The composite according to any one of claims 1 to 2, wherein the PDI of the composite is less than 0.3, preferably less than 0.

2.

4. The complex according to any one of claims 1 to 3, wherein the encapsulation efficiency of the complex is greater than 90%, preferably greater than 95%.

5. The composite according to any one of claims 1 to 4, wherein the preparation method of the composite comprises the following steps: (1) dispersing saccharomyces cerevisiae in a sodium hydroxide solution with a concentration of 1-5 M at a weight-to-volume ratio of 1:10-20 (m / v), stirring at 20-30 rpm for 1-5 h in a constant temperature water bath at 70-80° C., collecting the precipitate by centrifugation, washing with water and resuspending with water, adjusting the pH to 4-5, incubating with stirring at 60-70° C. and 20-30 rpm for 1-5 h, collecting the precipitate by centrifugation, washing with water, isopropanol, and acetone in sequence, collecting the precipitate by centrifugation, and freeze-drying in a vacuum to obtain yeast microcapsule powder; (2) adding water to the yeast microcapsule powder to prepare a solution with a concentration of 1-10 μg / mL, adding 0.1 mm zirconium oxide beads and vortexing at a vortex speed of 1400-2200 rpm for 1-5 h to prepare yeast cell walls; (3) Extruding the yeast cell wall and PS-DNA complex at a mass ratio of 1-7:1 through a liposome extruder and a polycarbonate porous membrane to obtain the complex. Preferably, the extrusion is performed until the yeast cell wall can be seen wrapped around the PSDNA surface under a transmission electron microscope.

6. The complex according to any one of claims 1 to 5, wherein the preparation method of the PS-DNA complex is: vortex mixing protamine and DNA recombinant plasmid at a charge ratio of 2-8:1, the vortex rotation speed is 1400-2200 rpm, and standing at room temperature for 30-60 minutes.

7. The complex according to any one of claims 1 to 6, wherein the preparation method of the DNA recombinant plasmid is: selecting the cell receptor binding region (RBD) of the S protein domain as the target antigen sequence, using SAC I and XBA I as restriction sites to insert into the vector, and obtaining the complex.

8. A method for preparing a yeast cell wall-wrapped protamine DNA complex (YCW@PS-DNA) according to any one of claims 1 to 7, wherein the complex consists of a yeast cell wall YCW and a PS-DNA complex, and the weight ratio of the YCW to the PS-DNA complex is 1-7:1; the PS-DNA complex consists of protamine and a DNA recombinant plasmid, wherein the charge ratio (N / P) of the protamine to the DNA recombinant plasmid is 2-8:1, and the nucleotide sequence of the DNA recombinant plasmid is as shown in SEQ ID NO.1, and the preparation method comprises the following steps: (1) dispersing saccharomyces cerevisiae in a sodium hydroxide solution with a concentration of 1-5 M at a weight-to-volume ratio of 1:10-20 (m / v), stirring at 20-30 rpm for 1-5 h in a constant temperature water bath at 70-80° C., collecting the precipitate by centrifugation, washing with water and resuspending with water, adjusting the pH to 4-5, incubating with stirring at 60-70° C. and 20-30 rpm for 1-5 h, collecting the precipitate by centrifugation, washing with water, isopropanol, and acetone in sequence, collecting the precipitate by centrifugation, and freeze-drying in a vacuum to obtain yeast microcapsule powder; (2) adding water to the yeast microcapsule powder to prepare a solution with a concentration of 1-10 μg / mL, adding 0.1 mm zirconium oxide beads and vortexing at a vortex speed of 1400-2200 rpm for 1-5 h to prepare yeast cell walls; (3) Extruding the yeast cell wall and PS-DNA complex at a mass ratio of 1-7:1 through a liposome extruder with a polycarbonate porous membrane to obtain the result.

9. A pharmaceutical composition comprising any one of the PS-DNA complex and YCW@PS-DNA complex as described in any one of claims 1 to 7 or a combination thereof and a pharmaceutically acceptable carrier.

10. Use of the PS-DNA complex, YCW@PS-DNA complex according to any one of claims 1 to 7 or the pharmaceutical composition according to claim 9 in the preparation of a vaccine against respiratory virus infection.

Images