Primer pair and kit for detecting pear fire blight bacteria and application of primer pair and kit

Abstract

The invention provides a primer pair and a kit for detecting pear fire blight bacteria and application of the primer pair and the kit, and belongs to the technical field of biological agriculture detection. The invention provides a specific DNA fragment for detecting pear fire blight bacteria. The nucleotide sequence of the specific DNA fragment is as shown in SEQ ID NO: 1. The invention also provides a primer pair for amplifying the specific DNA fragment. The primer pair comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 3. The primer pair disclosed by the invention can be used for carrying out conventional PCR detection and / or real-time fluorescent quantitative PCR detection on pear fire blight bacteria, has the characteristic of high specificity, and can realize specific detection without being combined with a fluorescent probe.

Description

Technical Field

[0001] The invention belongs to the technical field of biological agricultural detection, and in particular relates to a primer pair and a kit for detecting Erwinia amylovora and applications thereof. Background Art

[0002] Apricot fire blight is caused by Erwinia amylovora, which has a wide host range and can infect more than 140 plants in 32 genera of the Rosaceae family. It mainly infects pears, apples, hawthorns, crabapples, quince and other Rosaceae fruit plants, and is very harmful to pears and apples. On pear trees, new shoots, flowers and fruits infected with apricot fire blight have obvious water-soaked lesions in the early stage of the disease. When the climate is humid, pus oozes out. As the disease progresses, the diseased tissue turns black and withers, the new shoots become like a dragon head, and the leaves, flowers and diseased fruits are stiff and do not fall off, like a burn, eventually leading to the death of the whole plant. Many countries have suffered irreparable losses due to the outbreak of apricot fire blight. In order to prevent the disease from spreading further, it is crucial to use reliable detection methods for pathogen detection and epidemic monitoring.

[0003] The most widely used detection method in existing detection technologies is molecular biology technology based on PCR, including conventional PCR detection and real-time fluorescence quantitative PCR detection. The DNA fragments amplified by existing conventional PCR detection are large and are not suitable for real-time fluorescence quantitative PCR detection. When the real-time fluorescence quantitative PCR primers designed are used for real-time fluorescence quantitative PCR detection using the dye method, the amplified DNA fragments have the problem of low specificity, and specific detection must be achieved by combining fluorescent probes. In addition, when based on real-time fluorescence quantitative PCR detection, fluorescent probes are expensive, which increases the detection cost and limits the further promotion and application of the technology. Summary of the invention

[0004] In view of this, the present invention provides a specific DNA fragment for detecting Erwinia amylovora, which is not only suitable for conventional PCR detection and dye-based real-time fluorescence quantitative PCR detection of Erwinia amylovora, but also has the characteristics of high detection specificity.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a specific DNA fragment for detecting Erwinia amylovora, and the nucleotide sequence of the specific DNA fragment is shown in SEQ ID NO:1.

[0007] The present invention provides a primer pair for detecting Erwinia amylovora, wherein the primer pair is a primer pair for amplifying the specific DNA fragment;

[0008] The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO:2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:3.

[0009] The invention provides a detection kit for Erwinia amylovora, comprising the primer pair.

[0010] Preferably, the detection kit further comprises a DNA polymerase, a buffer and the specific DNA fragment.

[0011] The present invention provides an application of the specific DNA fragment, the primer pair or the detection kit in detecting fire blight of crops.

[0012] The present invention provides a method for detecting a crop pathogen, Erwinia amylovora, comprising the following steps:

[0013] 1) using the genomic DNA of the sample to be tested as a template, and using the primer pair to perform real-time fluorescence quantitative PCR detection and / or conventional PCR detection;

[0014] 2) Determine whether the sample carries the amylovora blight pathogen based on the test results;

[0015] The criteria for judging the results of real-time fluorescence quantitative PCR detection are as follows: if the Ct value is ≤35 and an "S"-shaped curve appears, the sample is judged to carry the amylovora blight pathogen; if the Ct value is >40, the sample is judged not to carry the amylovora blight pathogen; if 35 <Ct value ≤40, re-testing is required;

[0016] The judgment criteria for conventional PCR test results are: when a fragment with a length of 136bp is amplified, the sample is judged to carry the amylovora; when a fragment with a length of 136bp is not amplified, the sample is judged not to carry the amylovora.

[0017] Preferably, the amplification system for the real-time fluorescence quantitative PCR detection is: 10 μL of 2×Taq Pro Universal SYBRqPCR MasterMix, 0.5 μL of 10 μM upstream and downstream primers, and 100-200 ng of genomic DNA template, supplemented with ddH2O to 20 μL;

[0018] The amplification program of the real-time fluorescence quantitative PCR detection is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, and 40 cycles.

[0019] Preferably, the amplification system of the conventional PCR detection is: 10 μL of 2×TaqPCRMasterMix, 0.5 μL of each of 10 μM upstream and downstream primers and 100-200 ng of genomic DNA template, supplemented with ddH2O to 20 μL;

[0020] The amplification program of the conventional PCR detection is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min.

[0021] Preferably, the sample to be tested includes Rosaceae pome-fruit plants.

[0022] Preferably, the Rosaceae pome-fruit plant includes at least one of the following: pear, apple, hawthorn, crabapple and quince.

[0023] Compared with the prior art, the present invention has the following advantages:

[0024] The present invention provides a specific DNA fragment for detecting amylovora, and the nucleotide sequence is shown in SEQ ID NO: 1. In the present invention, the length of the specific DNA fragment is only 136bp. When the specific DNA fragment is used as a target fragment to detect amylovora and various crop pathogenic bacteria and microorganisms, the electrophoresis band of the amplified product is clear and specific, and the amylovora can be accurately distinguished from various crop pathogenic bacteria and microorganisms. At the same time, when the specific DNA fragment is used as a target to identify a variety of host crops (pear, apple, hawthorn, crabapple and quince), non-specific bands will not be amplified, and when P1 and P3 to P10 are used as primers to amplify the corresponding targets, non-specific amplification occurs. In addition, by detecting positive samples and negative samples from different regions, the results show that the specific DNA fragment is used as a target amplification detection result with high accuracy, and the detection accuracy of conventional PCR and dye method real-time fluorescence quantitative PCR is 100%. It can be seen that the specific DNA fragment of the present invention has the characteristics of short fragment length, strong specificity and high accuracy, and is suitable for conventional PCR detection of Erwinia amylovora and dye-based real-time fluorescence quantitative PCR detection.

[0025] The present invention provides a primer pair for detecting amylovora, which is a primer pair for amplifying the specific DNA fragment; it comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO:2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:3. The primer pair can only specifically amplify amylovora, and does not cross-react with other crop pathogens and host crops (pear, apple, hawthorn, crabapple and quince). The primer pair can be used for conventional PCR and dye-based real-time fluorescence quantitative PCR to detect amylovora in plant samples, and can achieve specific detection without combining with fluorescent probes, which is more cost-effective and easy to promote and apply compared with the probe method. At the same time, the primer pair of the present invention has high detection accuracy, and the detection results of conventional PCR and real-time fluorescence quantitative PCR are consistent with the identification results of standard primers. In addition, the primer pair of the present invention has the characteristic of high sensitivity, and the detection sensitivity is 0.1CFU / μL.

[0026] The present invention provides a method for detecting the crop pathogen Erwinia amylovora, wherein the genomic DNA of the sample to be tested is used as a template, and the primer pair is used to perform real-time fluorescence quantitative PCR detection and / or conventional PCR detection; and whether the sample carries Erwinia amylovora is determined according to the detection result. The method can be used for conventional PCR and dye method real-time fluorescence quantitative PCR to detect Erwinia amylovora in plant samples, and specific detection can be achieved without combining with a fluorescent probe, which is more cost-effective than the probe method. At the same time, it has the characteristics of high detection accuracy and high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The results of primer pairs P1 to P8 amplifying genomic DNA of Erwinia amylovora, where M represents DL2000 DNA marker, and lanes 1 to 8 represent the amplification products of primer pairs P1, P2, P3, P7, P4, P5, P6 and P8, respectively;

[0028] Figure 2 The results of amplifying the genomic DNA of healthy Venus Golden Apple plants using primer pairs P1 to P8, where M represents DL2000 DNA marker, and lanes 1 to 8 represent the amplification products of primer pairs P1, P2, P3, P7, P4, P5, P6 and P8, respectively;

[0029] Figure 3 The results of primer pair P9 and P10 amplifying genomic DNA of healthy tissues of 9 apple varieties, where M represents DL2000 DNAMarker, and lanes 1-10 are 1: Ganhong, 2: Shandong Tiaohong, 3: Wanglin, 4: Miyazaki, 5: Huangjin, 6: Luli, 7: Micui, 8: Local Tiaohong, 9: Yanfu No. 8, and 10: Erwinia amylovora (positive control);

[0030] Figure 4 The results of primer pair P2 amplifying genomic DNA of healthy tissues of 9 apple varieties, where M represents DL2000 DNA Marker, and lanes 1-10 are 1: Ganhong, 2: Shandong Tiaohong, 3: Wanglin, 4: Miyazaki, 5: Huangjin, 6: Luli, 7: Micui, 8: Local Tiaohong, 9: Yanfu No. 8, and 10: Erwinia amylovora (positive control). DETAILED DESCRIPTION

[0031] The invention provides a specific DNA fragment for detecting Erwinia amylovora. The nucleotide sequence of the specific DNA fragment is shown in SEQ ID NO: 1 (CGTTCTGATTGAACACCAGTCGACGCCGGATAAACATATGGCCTTCCGG CTTATCCGCTACGCGGTGGCGGCGATGCAGCGCCATCTCGATGCCGGGCAT CAAAAGCTGCCGCTGGTTATCCCGGTGCTGTTCTAT).

[0032] In the present invention, the length of the specific DNA fragment is only 136bp. When the specific DNA fragment is used as the detection target to detect the amylovora blight pathogen and other various crop pathogenic microorganisms, the electrophoresis band of the amplified product is clear and has strong specificity, and the amylovora blight pathogen can be accurately distinguished from various crop pathogenic microorganisms. At the same time, when the specific DNA fragment is used as the target fragment to identify various host crops (pear, apple, hawthorn, crabapple and quince), non-specific bands will not be amplified, and when other DNA fragments are used as the target fragment amplification in the embodiment of the present invention, non-specific amplification occurs. In addition, by detecting positive samples and negative samples in different regions, the results show that the specific DNA fragment amplification detection result has high accuracy, and the conventional PCR and dye method real-time fluorescence quantitative PCR detection accuracy are both 100%. It can be seen that the specific DNA fragment of the present invention has the characteristics of short fragment length, strong specificity and high accuracy, and is suitable for conventional PCR detection and dye method real-time fluorescence quantitative PCR detection of amylovora blight pathogen.

[0033] The invention provides a primer pair for detecting Erwinia amylovora, which is a primer pair for amplifying the specific DNA fragment; the primer pair comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO:2 (CGTTCTGATTGAACACCAGT) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:3 (ATAGAACAGCACCGGGATAA).

[0034] The invention provides a detection kit for Erwinia amylovora, comprising the primer pair.

[0035] In the present invention, the detection kit preferably further comprises a DNA polymerase, a buffer and the specific DNA fragment.

[0036] The invention provides application of the specific DNA fragment, the primer pair or the detection kit in detecting fire blight of crops.

[0037] The present invention provides a method for detecting a crop pathogen, Erwinia amylovora, comprising the following steps:

[0038] 1) using the genomic DNA of the sample to be tested as a template, and using the primer pair to perform real-time fluorescence quantitative PCR detection and / or conventional PCR detection;

[0039] 2) Determine whether the sample carries the amylovora blight pathogen based on the test results;

[0040] The criteria for judging the results of real-time fluorescence quantitative PCR detection are as follows: if the Ct value is ≤35 and an "S"-shaped curve appears, the sample is judged to carry the amylovora blight pathogen; if the Ct value is >40, the sample is judged not to carry the amylovora blight pathogen; if 35 <Ct value ≤40, re-testing is required;

[0041] The judgment criteria for conventional PCR test results are: when a fragment with a length of 136bp is amplified, the sample is judged to carry the amylovora; when a fragment with a length of 136bp is not amplified, the sample is judged not to carry the amylovora.

[0042] In the present invention, the sample to be tested includes Rosaceae pome fruit plants. The Rosaceae pome fruit plants preferably include at least one of the following: pear, apple, hawthorn, crabapple and quince. The source of the sample to be tested preferably includes at least one of leaves, flowers, fruits and branches, and the diseased sample to be tested is preferably extracted from the diseased part. The method for extracting genomic DNA of the sample to be tested is preferably completed by CTAB method or plant genomic DNA extraction kit method.

[0043] In the present invention, the amplification system of the real-time fluorescence quantitative PCR detection is preferably: 2×Taq Pro Universal SYBR qPCR Master Mix 10μL, 10μM upstream and downstream primers 0.5μL each and genomic DNA template 100-200ng, supplemented with ddH2O to 20μL. In the embodiment of the present invention, the 2×TaqPro Universal SYBRqPCRMasterMix was purchased from Nanjing Novozyme Biotechnology Co., Ltd. The amplification program of the real-time fluorescence quantitative PCR detection is: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 56℃ annealing for 30s, 72℃ extension for 30s, 40 cycles.

[0044] In the present invention, the amplification system of the conventional PCR detection is preferably: 2×TaqPCRMasterMix10μL, 0.5μL of 10μM upstream and downstream primers and 100-200ng of genomic DNA template, supplemented with ddH2O to 20μL. In the embodiment of the present invention, 2×TaqPCRMasterMix was purchased from Nanjing Novozyme Biotechnology Co., Ltd. The amplification program of the conventional PCR detection is: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 56℃ annealing for 30s, 72℃ extension for 30s, 35 cycles; 72℃ extension for 5min.

[0045] In one embodiment of the present invention, 10 pairs of primers P1 to P10 (the primers described in the present invention are denoted as P2) are respectively used to perform conventional PCR detection on the amylovora blight pathogen. The electrophoresis detection results show that P1 to P10 amplify expected size bands using the genomic DNA of the amylovora blight pathogen as a template, wherein the amplified bands of P1 to P3, P5 to P6, and P8 to P10 are clear, and the amplified bands of P4 and P7 are not clear; the present invention further uses P1 to P10 to amplify the genomic DNA of 14 other pathogenic microorganisms as templates, including Escherichia coli, Pseudomonasfluorescens, Agrobacterium tumefaciens, Erwinia carotovora, Ralstonia solanacearum, Enterobacter ludwigii, Bacillus subtilis, and the like. Electrophoresis showed that no target bands were amplified for the pathogens Aspergillus subtilis, Aspergillus flavus, Aspergillus niger, Aspergillus tubingensis, Fusarium solani, Penicillium glaucum, Valsa mali and Valsa ambiens. The present invention uses P1 to P10 to detect 20 host crops respectively, including 9 varieties of apples, namely 'Venus Gold', 'Lu Li', 'Gan Hong', 'Wang Lin', 'Mi Cui', 'Miyazaki Short Branch Fuji', 'Yan Fu No. 8', '2001 New Stripe Fuji' and 'Huang Yuanshuai', 8 varieties of pear trees, namely 'Xiangli', 'Yali', 'Dangshan Pear', 'Xuehuali', 'Pingguoli', 'Hong Xiangsu', 'Yu Lu Xiang' and 'Cui Guan', and 1 variety each of hawthorn, crabapple and quince. The electrophoresis result shows that only P2 has no non-specific bands amplified when detecting different host crops, which indicates that the primer pair P2 has good specificity when detecting different host crops and can be used for detecting fire blight pathogens of pear.

[0046] In one embodiment of the present invention, 20 samples of pear and apple trees were tested using the primer pair of the present invention, and the conventional PCR and real-time fluorescence quantitative PCR test results were consistent with the standard primer identification results, indicating that the primer pair of the present invention has high accuracy in detecting amylovora. In addition, the primer pair of the present invention has the characteristics of high sensitivity, with a detection limit of 0.1 CFU / μL.

[0047] To further illustrate the present invention, a primer pair, a kit and applications thereof for detecting Erwinia amylovora provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0048] Example 1

[0049] Primer design

[0050] Based on the genome of E. amylovora published on GenBank (Accession No.: FN434113) and pEA29 plasmid (Accession No.: FN434114), six pairs of primers P1-P6 were designed using premierprimer 5. At the same time, the primer pairs (P7-P10) disclosed in the prior art for detecting E. amylovora were used for screening. The specific nucleotide sequences of primers P1-P10 are shown in Table 1.

[0051] P7 References [1] Yuan Yingzhe, Han Jian, Wang Yan, et al. Establishment of a rapid quantitative detection method for live bacteria of Pear Fire Blight[J]. Journal of Fruit Science, 2020, 37(09): 1425-1433. DOI: 10.13925 / j.cnki.gsxb.20200056.

[0052] P8 References [2] Qian Guoliang, Hu Baishi, Lu Ling, et al. Real-time fluorescence PCR detection of E. amylovora[J]. Acta Phytopathologica Sinica, 2006, (02): 123-128. DOI: 10.13926 / j.cnki.apps.2006.02.005.

[0053] P9 Reference [3] Gottsberger R A. Development and evaluation of a real-time PCR assay targeting chromosomal DNA of Erwinia amylovora. Letters in Applied Microbiology, 2010, 51 (3): 285-292.

[0054] P10 References [4] Lehman SM, KimW, Castle AJ, et al. Duplex real-timepolymerase chain reaction reveals competition between Erwinia amylovora and E.pyrifoliae onpearblossoms. Phytopathology, 2008, 98(6): 673-679.

[0055] Table 1 Primer sequence information

[0056]

[0057] Example 2

[0058] Primer specificity test

[0059] 1. P1~P10 detects different microorganisms

[0060] The genomic DNA of 15 different pathogenic microorganisms were extracted, including Erwinia pyrifoliae, Escherichia coli, Pseudomonas fluorescens, Agrobacterium tumefaciens, Erwinia carotovora, Ralstonia solanacearum, Enterobacter ludwigii, Bacillus subtilis, Aspergillus flavus, Aspergillus niger, Aspergillus tubingensis, Fusarium solani, Penicillium glaucum, Valsa mali and Valsa ambiens, which were preserved in the laboratory.

[0061] Conventional PCR was performed using primers P1 to P10 and genomic DNA of 15 microorganisms as templates to obtain PCR products;

[0062] The conventional PCR amplification system was: 10 μL of 2× TaqPCR MasterMix, 0.5 μL of each 10 μM upstream and downstream primers, and 100 ng of genomic DNA template, supplemented with ddH2O to 20 μL;

[0063] The conventional PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 54-60°C (specific annealing temperatures for P1-P10 are shown in Tables 1 and 2) for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min.

[0064] The PCR products were detected by 1.5% agarose gel electrophoresis.

[0065] The electrophoresis results showed that P1-P10 amplified the expected size bands using the genomic DNA of Erwinia amylovora as template, among which the amplified bands of P1-P3, P5-P6, and P8-P10 were clear, while the amplified bands of P4 and P7 were not clear (the results of amplifying the DNA of Erwinia amylovora by P1-P8 are shown in Figure 1 ); When P1-P10 amplified the genomic DNA of the remaining 14 microorganisms except Erwinia amylovora as templates, no non-specific bands were amplified.

[0066] 2. P1~P10 detection of different host crops

[0067] The genomic DNA of 20 different host crops were extracted, including nine varieties of apples, namely 'Venus Gold', 'Luli', 'Ganhong', 'Wanglin', 'Micui', 'Miyazaki Short Branch Fuji', 'Yanfu No. 8', '2001 New Striped Fuji' and 'Huang Yuanshuai'; eight varieties of pear trees, namely 'Xiangli', 'Yali', 'Dangshan Pear', 'Xuhuali', 'Pingguoli', 'Hongxiangsu', 'Yuluxiang' and 'Cuiguan'; and one variety each of hawthorn, crabapple and quince.

[0068] The host crop genomic DNA extraction method is as follows: take an appropriate amount of plant tissue, add liquid nitrogen to fully grind, take about 0.1g and transfer to a sterile 2.0mL centrifuge tube, add 800μL CTAB extraction buffer, incubate in a 65°C water bath for 1 hour, mix by inverting several times every 15 minutes, add 800 μL of a mixture of phenol / chloroform / isopropanol (the volume ratio of phenol, chloroform and isopropanol is 25:24:1), mix by inverting, centrifuge at 12000rpm for 10 minutes, transfer the upper aqueous phase to a new 2mL centrifuge tube, add an equal volume of chloroform / isopropanol mixture (the volume ratio of chloroform and isopropanol is 24:1), mix by inverting, centrifuge at 12000rpm for 10 minutes, transfer the supernatant to a new 1.5mL centrifuge tube, add 0.6 times the volume of isopropanol, precipitate at -20°C for more than 30 minutes, centrifuge at 12000rpm for 10 minutes, discard the supernatant, add 75% ethanol to wash twice, dry at room temperature for about 10 minutes, add water to dissolve the DNA, and obtain the host crop genomic DNA.

[0069] Conventional PCR was performed using P1 to P10 as primers and genomic DNA of 20 host crops of E. amylovora as templates to obtain PCR products;

[0070] The conventional PCR amplification system, procedure and amplification product detection method are the same as those for detecting different microorganisms in P1 to P10 above, and will not be described in detail here.

[0071] The electrophoresis results showed that P1 and P3-P10 amplified non-specific bands when testing apples, and only P2 did not amplify non-specific bands when testing 20 different host crops (partial results of P1-P10 testing different host plants are shown in Figure 2 to Figure 4 ).

[0072] In summary, it is shown that the primer pair P2 designed in the present invention has good specificity in detecting different host crops and can be used for the detection of Erwinia amylovora.

[0073] Example 3

[0074] Sensitivity test of primer pair P2

[0075] Amylovora xjsz0102 was prepared with sterile water to a concentration of 1×10 8 CFU / mL concentration, 10-fold gradient dilution, 95°C water bath for 5 minutes, take 2 μL as template for real-time fluorescence quantitative PCR detection.

[0076] The test results showed that the dilution of 1×10 5 It can still be detected at dilution of 1×10 6 Therefore, the detection limit of primer pair P2 was 0.1 CFU / μL.

[0077] Example 4

[0078] Application of primer pair P2 in the detection of apricot fire blight

[0079] Twenty samples of pear and apple trees from the areas affected by apricot fire blight in Xinjiang and Gansu were identified as 13 positive samples and 7 negative samples by the conventional PCR method in the agricultural industry standard NY / T41802022 of the People's Republic of China.

[0080] Primer pair P2 was used to test 20 samples. The results of conventional PCR and real-time fluorescence quantitative PCR were consistent with the results of standard primer identification, indicating that P2 has high accuracy in detecting apricot fire blight. Specific sample information and test results are shown in Table 2.

[0081] Table 2 Statistics of pear fire blight detection results

[0082]

[0083]

[0084] Note: + indicates positive test result of Erwinia amylovora, - indicates negative test result of Erwinia amylovora.

[0085] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A specific DNA fragment for detecting Erwinia amylovora, characterized in that: The nucleotide sequence of the specific DNA fragment is shown in SEQ ID NO:

1.

2. A primer pair for detecting Erwinia amylovora, characterized in that: The primer pair is a primer pair for amplifying the specific DNA fragment according to claim 1; The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:

3.

3. A detection kit for Erwinia amylovora, characterized in that: Comprising the primer pair described in claim 2.

4. The detection kit according to claim 3, characterized in that: The detection kit further comprises a DNA polymerase, a buffer and the specific DNA fragment according to claim 1.

5. Use of the specific DNA fragment according to claim 1, the primer pair according to claim 2 or the detection kit according to claim 3 or 4 in detecting fire blight of crops.

6. A method for detecting the crop pathogen Erwinia amylovora, characterized in that: The following steps are involved: 1) Using the genomic DNA of the sample to be tested as a template, using the primer pair described in claim 2 to perform real-time fluorescence quantitative PCR detection and / or conventional PCR detection; 2) Determine whether the sample carries the amylovora blight pathogen based on the test results; The criteria for determining the results of real-time fluorescence quantitative PCR detection are as follows: if the Ct value is ≤35 and an "S"-shaped curve appears, the sample is determined to carry the amylovora blight pathogen; If the Ct value is >40, the sample is judged not to carry the amylovora blight pathogen; If 35<Ct value≤40, retest is required; The judgment criteria for conventional PCR test results are: when a fragment with a length of 136bp is amplified, the sample is judged to carry the amylovora; when a fragment with a length of 136bp is not amplified, the sample is judged not to carry the amylovora.

7. The method according to claim 6, characterized in that: The amplification system of the real-time fluorescence quantitative PCR detection is: 2×TaqPro Universal SYBR qPCRMasterMix 10μL, 0.5μL of 10μM upstream and downstream primers and 100-200ng of genomic DNA template, supplemented with ddH2O to 20μL; The amplification program of the real-time fluorescence quantitative PCR detection is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, and 40 cycles.

8. The method according to claim 6, characterized in that: The amplification system of the conventional PCR detection is: 2×TaqPCRMasterMix 10μL, 0.5μL of 10μM upstream and downstream primers, and 100-200ng of genomic DNA template, supplemented with ddH2O to 20μL; The amplification program of the conventional PCR detection is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min.

9. The method according to any one of claims 6 to 8, characterized in that: The samples to be tested include Rosaceae pome fruit plants.

10. The method according to claim 9, characterized in that: The Rosaceae pome fruit plant comprises at least one of the following: pear, apple, hawthorn, crabapple and quince.

Images