Cyclobalanopsis gilgii EST-SSR (expressed sequence tag-simple sequence repeat) marker primer as well as preparation method and application thereof

Abstract

The invention provides a cyclobalanopsis rupestris EST-SSR (expressed sequence tag-simple sequence repeat) marker primer, the primer comprises seven primer pairs which are P2, P11, P24, P25, P29, P32 and P34 in sequence, and the sequences are shown as SEQ ID NO: 1-14, the invention further provides a preparation method of the EST-SSR marker primer, and the preparation method comprises the following steps: S1, selecting a cyclobalanopsis rupestris sample, sampling, drying and storing; s2, carrying out DNA extraction and purity detection on the sample, and then storing all extracted sample DNAs for later use; and S3, selecting a DNA sample to establish a PCR amplification system, then carrying out PCR amplification to obtain pre-selected primers, and then screening the pre-selected primers to obtain the cyclobalanopsis gilgiana EST-SSR labeled primer. The invention also comprises the application of the EST-SSR labeled primer in population genetic diversity, population genetic structure analysis, population genetic differentiation analysis, genetic distance and clustering analysis of the EST-SSR labeled primer. The cyclobalanopsis gilgii leaf EST-SSR marker primer fills up the technical vacancy in the field, and provides a research basis for cyclobalanopsis gilgii population protection and germplasm resource preservation and utilization.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a EST-SSR marker primer for Cyclobalanopsis glauca leaves, and a preparation method and application thereof. Background Art

[0002] Quercus gilva, also known as red cypress, red bark, red bark cypress, etc., belongs to the genus Quercus of the Fagaceae family. It is an evergreen tall tree mainly distributed in the subtropical regions of East Asia (Editorial Committee of Flora of China, 1998). The wood of this tree is hard and has beautiful and delicate texture. It is an excellent hardwood timber species (Li Jinhua et al., 2013). In addition, Quercus gilva has strong adaptability to the environment and can be used for artificial afforestation, ecological restoration and landscaping (Ouyang Zeyi et al., 2021; Qin Zhikuang et al., 2023). Since the 20th century, the use of Quercus gilva timber has continued to increase, resulting in serious damage to most of the natural Quercus gilva forests, and even facing the risk of depletion at one time (Deng et al., 2018). According to Song et al. (2023), there are less than 5,000 wild Quercus gilva plants in my country, and less than 10,000 plants distributed worldwide. In the previous survey of natural forests of Cyclobalanopsis rubra in Hunan, Zhejiang, Fujian, Guizhou, Jiangxi and other places in my country, this research team found that more than 80% of the populations have no more than 30 individuals, which are small-scale and fragmented. At present, Cyclobalanopsis rubra has been listed as an endangered tree species by many countries (Kim et al, 2012; Sugiura et al, 2015; Han et al, 2020; Ouyang Zeyi et al, 2021), and it is very necessary to protect and study this wild plant resource.

[0003] Research on Cyclobalanopsis rubripes mainly focuses on resource distribution, population ecology, physiological characteristics, breeding technology, etc. (Li Jinhua et al., 2014; Wu Lijun, 2015; Rong Yanbing and Xie Min, 2017; Li Fengqing et al., 2020; Xia Chan et al., 2021; Yang Mengqing et al., 2023), and research on its population genetic diversity is still very limited. Genetic diversity is one of the important contents of biodiversity. Clarifying the genetic diversity of germplasm resources is a prerequisite for formulating effective protection and utilization strategies (Sork & Smouse, 2006; Jing Zhaoyang et al., 2023). Zhu Pinhong (2014) used ISSR molecular markers to analyze the genetic diversity of 7 Cyclobalanopsis rubripes populations from Hunan and Zhejiang, revealing the genetic relationship between different geographical populations. Sugiura et al. (2015) detected 13 haplotypes from Cyclobalanopsis rubripes populations distributed in Japan and China, and found that the haplotypes of different geographical populations were specific. Song et al. (2023) revealed that the genetic diversity of the red-barbed cycad population is low based on field population surveys and whole genome sequencing results, thus supporting its assessment as an endangered species. Qin Zhikuang et al. (2023) found that the phenotypic diversity of red-barbed cycad is at a high level in a study of 14 natural populations, and the phenotypic variation mainly comes from within the population. However, the above studies involved a small number of populations and individuals, and could not fully reveal the genetic diversity of the species and its population genetic structure.

[0004] Simple sequence repeat (SSR) markers are widely used in genetic diversity analysis and are considered to be an ideal molecular marker due to their codominance, high polymorphism and easy repeatability (Zhao et al., 2014; Cui Qingmei et al., 2024). In woody plants, there have been many reports on the development and application of SSR markers. For example, Xie Qian et al. (2023) screened 12 polymorphic SSR markers from olive (Canarium album) fruit transcriptome data and used them for population genetic structure analysis; Zhao Kai et al. (2023) used 24 pairs of EST-SSR primers to analyze the genetic diversity and genetic structure of five populations of the endangered species Rhododendron shanni; Cheng Jianhui et al. (2024) analyzed the genetic background of natural populations of Toona sinens in southwestern Zhejiang based on SSR markers. In Cyclobalanopsis rubrum, there are no reports on SSR molecular markers. Since there is no reference genome for Cyclobalanopsis rubra and SSR markers are species-specific, SSR markers can be obtained through high-throughput transcriptome sequencing technology. Summary of the invention

[0005] One of the technical problems to be solved by the present invention is to provide a EST-SSR marker primer for the leaves of Cyclobalanopsis glauca to fill the technical gap in this field, and the EST-SSR marker primer for the leaves of Cyclobalanopsis glauca can be used in the genetic diversity and genetic structure analysis of the leaves of Cyclobalanopsis glauca.

[0006] The present invention provides a Cyclobalanopsis glauca leaf EST-SSR marker primer, the primer comprising 7 primer pairs, which are P2, P11, P24, P25, P29, P32, and P34 in sequence, and the sequences are shown in SEQ ID NOs: 1-14, wherein:

[0007] The primer sequence of P2 is:

[0008] Forward primer: GGAGGCACACGTACCAAAGT;

[0009] Reverse primer: TTGAGTCGGTGCACAGAAAG;

[0010] The primer sequence of P11 is:

[0011] Forward primer: TCCACACTTTTGCCACACTC;

[0012] Reverse primer: CGGGGTTTACTATGGAGCAA;

[0013] The primer sequence of P24 is:

[0014] Forward primer: CCCTTACTCATTGTCCGGTT;

[0015] Reverse primer: TTCGTGATGCAAGGTACCAA;

[0016] The primer sequence of P25 is:

[0017] Forward primer: TCCAATATCACTTCCATTCCC;

[0018] Reverse primer: TCTGTGTCCAAAATGCTGC;

[0019] The primer sequence of P29 is:

[0020] Forward primer: TAACCTCCAACGGTACGGAA;

[0021] Reverse primer: GGACCGGATTTAAGAGAGGG;

[0022] The primer sequence of P32 is:

[0023] Forward primer: CCAACTCAAGTCCTCCCAAA;

[0024] Reverse primer: TTGTCAGCTCCTCTGGGACT;

[0025] The primer sequence of P34 is:

[0026] Forward primer: TTAGGGCTTTGACGGAGAAA;

[0027] Reverse primer: ATCCAGATTCCACAACACCC.

[0028] Compared with the prior art, the EST-SSR marker primers for leaves of Cyclobalanopsis glauca in the present application have the following advantages: the present invention utilizes the transcriptome data of Cyclobalanopsis glauca to develop EST-SSR molecular markers, and utilizes SSR markers to analyze the genetic diversity level and genetic structure of the natural population of Cyclobalanopsis glauca, to explore the genetic background and endangered mechanism of wild resources of Cyclobalanopsis glauca, and to provide a research basis for the protection of Cyclobalanopsis glauca populations and the preservation and utilization of germplasm resources.

[0029] The second technical problem to be solved by the present invention is to provide a method for preparing EST-SSR marker primers for leaves of Cyclobalanopsis glauca, so as to prepare EST-SSR marker primers that can be used for genetic diversity and genetic structure analysis of leaves of Cyclobalanopsis glauca, thus filling the gap in current technology.

[0030] In order to solve the above technical problems, the present invention provides a method for preparing the EST-SSR marker primers of Cyclobalanopsis glauca leaves, comprising the following steps:

[0031] S1: Select various samples of Cyclobalanopsis glauca leaves for sampling and drying;

[0032] S2: extracting DNA from the sample stored in step S1 and performing purity testing, and then storing all the extracted sample DNA for future use;

[0033] S3: Select the DNA sample extracted in step S2 to establish a PCR amplification system, then perform PCR amplification to obtain pre-selected primers, and then screen the pre-selected primers to obtain Cyclobalanopsis glauca EST-SSR marker primers.

[0034] In a possible embodiment, in step S2, the method for DNA extraction and purity detection is: using a plant / fungal genomic DNA extraction kit to extract DNA from the sample, and then using 1% agarose gel electrophoresis and NanoDrop 2000 ultra-micro spectrophotometer to detect DNA concentration and purity.

[0035] In a possible embodiment, in step S2, the storage condition is: diluting the DNA to 50 ng·μL -1 Then store it in a -20℃ refrigerator for later use.

[0036] In one possible embodiment, in step S3, the PCR amplification system includes: a total volume of 20 μl, including: 14.8 μl of ddH2O, 2 μl of 10×Buffer, 0.4 μl of a mixture of 2.5 mM dNTPs, 0.3 μl of a solution including 20 μM forward primers, 0.3 μl of a solution including 20 μM reverse primers, 2 μl of 50 ng·μL -1 DNA template solution, 0.2 μl of 5U·μL -1 Taq DNA polymerase.

[0037] In a possible embodiment, in step S3, the PCR reaction procedure includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 45 s, and extension at 72°C for 50 s, for a total of 35 cycles; extension at 72°C for 7 min, and finally storage at 10°C.

[0038] Through further optimization of the above possible implementation modes, the PCR amplification system and amplification procedure provided by the present invention provide a guarantee for the subsequent preparation of EST-SSR marker primers.

[0039] The third technical problem to be solved by the present invention is to provide the application of the EST-SSR marker primers of the leaves of Cyclobalanopsis glauca, and the application includes the application of the EST-SSR marker primers of the leaves of Cyclobalanopsis glauca in its population genetic diversity, population genetic structure analysis, population genetic differentiation analysis, genetic distance and cluster analysis.

[0040] In a possible embodiment, the population genetic diversity includes the number of alleles, the effective number of alleles, the observed heterozygosity, the expected heterozygosity, Nei's genetic diversity index, Shannon's information index and polymorphism information content.

[0041] Based on the patent of this invention, the screened SSR molecular markers can reflect the differences in certain DNA fragments in the genome between individuals or populations of Cyclobalanopsis rubra, and can therefore be used to solve issues such as genetic diversity evaluation, wild resource protection, breeding and seedling cultivation, and provenance selection during ecological restoration in my country. This molecular marker can detect DNA polymorphism, thereby analyzing the genetic diversity of Cyclobalanopsis rubra populations and revealing the genetic differences between different individuals, which is of great significance for Cyclobalanopsis protection and evolution research. At the same time, establishing the kinship of different individuals through molecular sequences has reference value for parent selection and hybrid breeding, and can effectively improve breeding efficiency and variety quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 Schematic diagram of amplification of some primers in 6 materials in the example;

[0043] Figure 2 This is the characteristic band pattern of capillary electrophoresis of primer P32;

[0044] Figure 3 The figure shows the number and proportion of motif types of repeat types in the transcriptome of Cyclobalanopsis glauca. A is a schematic diagram of the number of motif types, B is a schematic diagram of the proportion, and motif types R1-R6 represent mononucleotides to hexanucleotides.

[0045] Figure 4 This is a population genetic structure diagram of Cyclobalanopsis glauca when K=7 in the embodiment;

[0046] Figure 5 The genetic structure diagram of the Cyclobalanopsis glauca population based on 7 EST-SSR loci in the embodiment (K=7);

[0047] Among them, 1-101 are sample numbers; the numbers in brackets 1-14 are population numbers, representing HNCB, HNDK, HNHT, HNJZ, HNSZ, HNYS, ZJLH, ZJQY, ZJSM, ZJSC, GZTZ, FJJO, JXWY and CQWZ respectively;

[0048] Figure 6 This is the principal coordinate analysis diagram of 14 populations of Cyclobalanopsis rubra.

[0049] Figure 7 The UPGMA cluster diagram of 14 populations of Cyclobalanopsis glauca constructed based on 7 EST-SSR markers;

[0050] Figure 8 It is the F test data diagram in the embodiment. DETAILED DESCRIPTION

[0051] First, those skilled in the art should understand that these implementations are only used to explain the technical principles of the embodiments of the present application, and are not intended to limit the protection scope of the embodiments of the present application. Those skilled in the art can make adjustments to them as needed to adapt to specific application scenarios.

[0052] The present invention provides a Cyclobalanopsis glauca leaf EST-SSR marker primer, the primer comprising 7 primer pairs, which are P2, P11, P24, P25, P29, P32, and P34 in sequence, and the sequences are shown in SEQ ID NOs: 1-14, wherein:

[0053] The primer sequence of P2 is:

[0054] Forward primer: GGAGGCACACGTACCAAAGT;

[0055] Reverse primer: TTGAGTCGGTGCACAGAAAG;

[0056] The primer sequence of P11 is:

[0057] Forward primer: TCCACACTTTTGCCACACTC;

[0058] Reverse primer: CGGGGTTTACTATGGAGCAA;

[0059] The primer sequence of P24 is:

[0060] Forward primer: CCCTTACTCATTGTCCGGTT;

[0061] Reverse primer: TTCGTGATGCAAGGTACCAA;

[0062] The primer sequence of P25 is:

[0063] Forward primer: TCCAATATCACTTCCATTCCC;

[0064] Reverse primer: TCTGTGTCCAAAATGCTGC;

[0065] The primer sequence of P29 is:

[0066] Forward primer: TAACCTCCAACGGTACGGAA;

[0067] Reverse primer: GGACCGGATTTAAGAGAGGG;

[0068] The primer sequence of P32 is:

[0069] Forward primer: CCAACTCAAGTCCTCCCAAA;

[0070] Reverse primer: TTGTCAGCTCCTCTGGGACT;

[0071] The primer sequence of P34 is:

[0072] Forward primer: TTAGGGCTTTGACGGAGAAA;

[0073] Reverse primer: ATCCAGATTCCACAACACCC.

[0074] The present invention also provides a method for preparing the Cyclobalanopsis glauca leaf EST-SSR marker primers, comprising the following steps:

[0075] S1: Select various samples of Cyclobalanopsis glauca leaves for sampling and drying;

[0076] S2: extracting DNA from the sample stored in step S1 and performing purity testing, and then storing all the extracted sample DNA for future use;

[0077] S3: Select the DNA sample extracted in step S2 to establish a PCR amplification system, then perform PCR amplification to obtain pre-selected primers, and then screen the pre-selected primers to obtain Cyclobalanopsis glauca EST-SSR marker primers.

[0078] As a preferred solution, in step S2, the method for DNA extraction and purity detection is: using a plant / fungal genomic DNA extraction kit to extract DNA from the sample, and then using 1% agarose gel electrophoresis and NanoDrop 2000 ultra-micro spectrophotometer to detect DNA concentration and purity.

[0079] As a preferred solution, in step S2, the conditions for storage and standby are: diluting the DNA to 50 ng·μL -1 Then store it in a -20℃ refrigerator for later use.

[0080] As a preferred solution, in step S3, the PCR amplification system includes: a total volume of 20 μl, including: 14.8 μl of ddH2O, 2 μl of 10×Buffer, 0.4 μl of a mixture of 2.5 mM dNTPs, 0.3 μl of a solution including 20 μM forward primers, 0.3 μl of a solution including 20 μM reverse primers, 2 μl of 50 ng·μL -1 DNA template solution, 0.2 μl of 5U·μL -1 Taq DNA polymerase.

[0081] As a preferred solution, in step S3, the PCR reaction procedure includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 45 s, extension at 72°C for 50 s, for a total of 35 cycles; extension at 72°C for 7 min, and finally storage at 10°C.

[0082] The present invention also provides an application of the EST-SSR marker primers for the leaves of Cyclobalanopsis glauca, which includes the application of the EST-SSR marker primers for the leaves of Cyclobalanopsis glauca in the genetic diversity of its population.

[0083] As a preferred solution, the population genetic diversity includes the number of alleles, the effective number of alleles, the observed heterozygosity, the expected heterozygosity, Nei's gene diversity index, Shannon's information index and polymorphism information content.

[0084] The present invention also includes an application of the EST-SSR marker primers for the leaves of Cyclobalanopsis glauca, and the application includes the application of the EST-SSR marker primers for the leaves of Cyclobalanopsis glauca in population genetic structure analysis, population genetic differentiation analysis, genetic distance and cluster analysis.

[0085] The present application is further described in detail below with reference to the accompanying drawings and specific embodiments.

[0086] Example:

[0087] This embodiment provides EST-SSR marker primers for Cyclobalanopsis glauca leaves and a preparation method and application thereof, wherein the preparation method comprises:

[0088] Test Materials:

[0089] S1: According to the resource background survey of the Subtropical Forestry Research Institute of the Chinese Academy of Forestry, 14 populations in 6 provinces (cities) including Hunan, Zhejiang, Guizhou, Fujian, Jiangxi and Chongqing were selected for superior tree selection and grafted and preserved in Jiande, Zhejiang. In the selected forest stands, according to the proposed survey methods and standards, the survey was conducted along a certain route, and the single trees that met the requirements were selected as candidate trees. The candidate superior trees were selected using the dominant tree comparison method, and the superior tree spacing was ≥50m. A total of 101 samples of young leaves of the year from the asexual lines of superior trees from 14 populations were collected (as shown in Table 1) and placed in color-changing silica gel for drying and preservation.

[0090] Table 1 Sampling information and samples of Cyclobalanopsis rubra population

[0091]

[0092] Transcriptome sequencing and EST-SSR marker development:

[0093] The yellow variant variety 'Diejin' was selected for transcriptome sequencing. Mature leaves were collected in mid-August 2021. Wild plants were used as controls. Three biological replicates were set for each group. After liquid nitrogen treatment, they were stored on dry ice and sent to Shanghai Meiji Biotechnology Co., Ltd. Transcriptome sequencing was completed using the Ilumina Noveseq 6000 platform, and Clead reads were obtained after filtering and quality inspection of the raw data. Clean reads were De novo assembled using Trinity v2.8.5 software to obtain Unigene sequences. MISAv1.0 software was used to search for SSR sites in all Unigenes, and the minimum number of repeats from single nucleotides to hexanucleotides was set to 10, 6, 5, 5, 5, and 5, respectively. Unigenes containing SSR sites were randomly selected for primer development, and 100 pairs of EST-SSR preselected primers were designed using Primer 3.0 software.

[0094] S2: Genomic DNA extraction and detection:

[0095] DNA was extracted using a plant / fungal genomic DNA extraction kit (Shanghai Laifeng Biotechnology Co., Ltd., China) according to the instructions. DNA concentration and purity were tested using 1% agarose gel electrophoresis and NanoDrop 2000 ultra-micro spectrophotometer (Thermo Scientific, USA). All sample DNA was diluted to 50 ng / μL. -1 Then store it in a -20℃ refrigerator for later use.

[0096] S3: PCR amplification and EST-SSR primer screening:

[0097] Six DNA samples were randomly selected to establish a PCR amplification system, totaling 20 μl, including: 14.8 μl ddH2O, 2 μl 10× Buffer, 0.4 μl dNTPs mixture (2.5 mM), 0.3 μl forward primer (20 μM), 0.3 μl reverse primer (20 μM), 2 μl DNA template (50 ng·μL -1 ), 0.2 μl TaqDNA polymerase (5 U·μL -1 PCR reaction was performed using K960 gene amplifier (Hangzhou Jingge Scientific Instrument Co., Ltd., China), and the reaction procedure was as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 60°C annealing for 45 s, 72°C extension for 50 s, for a total of 35 cycles; 72°C extension for 7 min, and finally storage at 10°C. PCR products were detected by 1.3% agarose gel electrophoresis, and primers with amplified fragments were further detected by 5% polyacrylamide gel electrophoresis ( Figure 1 ), and 7 EST-SSR primers with clear banding patterns and good polymorphism were screened out from 100 pairs of pre-selected primers (Table 2).

[0098] Table 2 Sequence information of 7 pairs of PCR primers

[0099]

[0100] Capillary electrophoresis:

[0101] Formamide and molecular weight internal standard were mixed at a volume ratio of 100:1, 15uL was added to the sample plate, and 1uL of PCR product diluted 10 times was added. Capillary electrophoresis was performed using a 3730XL sequencer (Applied Biosystems, USA). The raw data was read using the Fragment (Plant) program of Genemarker V2.2.0 software to obtain fragment length information (such as Figure 2 shown).

[0102] Data processing:

[0103] GenAlEx v6.503 software (Peakall & Smouse, 2006) was used to calculate the number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), Shannon's information index (I), Nei's gene diversity index (H) and fixation index (Fst) of each SSR locus, and molecular variance analysis (AMOVA) and principal coordinates analysis (PCoA) were performed. The formula for calculating gene flow (Number of migrants, Nm) was: Nm = 0.25 (1-Fst) / Fst. PIC-CALC v0.6 software was used to calculate the polymorphism information content (PIC) of the loci. Popgene v1.32 software was used to calculate the Nei's genetic distance (GD) between populations. MEGA 11.0 software was used to construct a cluster tree based on the unweighted pair-group method with arithmetic means (UPGMA). STRUCTURE v2.3.4 software was used to analyze the population genetic structure. The number of groups (K) was set to 1-14, and the K value was evaluated 10 times. The MCMC (Markor Chain Monte Carlo) was set to 10,000 at the beginning of the iteration, and the number of MCMC repetitions after iteration was set to 50,000. The optimal K value was selected according to the method of Evanno et al. (2005).

[0104] Results and Analysis:

[0105] Analysis of SSR loci distribution characteristics:

[0106] A total of 87,511 Unigenes were obtained from the transcriptome sequencing of the leaves of Cyclobalanopsis rubra, and 36,127 SSR sites were searched from 23,500 sequences, of which 5,953 Unigenes contained more than two SSR sites. The SSR sites of the transcriptome of Cyclobalanopsis rubra were mainly mononucleotide types, accounting for 54.42%, followed by dinucleotide types (31.17%) and trinucleotide types (12.59%), and the pentanucleotide type had the lowest frequency, only 0.30% (Table 3). There were large differences in the number of repetitions of SSR sequence motifs, with 6-10 times being the most, followed by 11-15 times, and the number of repetitions of tetranucleotide types, pentanucleotide types and hexanucleotide types were mainly ≤5 times.

[0107] Table 3 Distribution characteristics of SSR sequences in Cyclobalanopsis rubra transcriptome

[0108]

[0109] A total of 167 motifs were detected in SSR sequences, including 2 mononucleotides, 4 dinucleotides, 10 trinucleotides, 23 tetranucleotides, 34 pentanucleotides, and 94 hexanucleotides ( Figure 3 Among the different types of motifs, the frequency of the mononucleotide motif A / T is the highest, reaching 53.74%, followed by the dinucleotide motif AG / TC, which is 21.36%, and the frequencies of AC / TG and AT / TA are 5.03% and 4.70% respectively. Figure 3 B).

[0110] EST-SSR marker polymorphism analysis:

[0111] Seven pairs of EST-SSR primers were used to analyze the polymorphism of Cyclobalanopsis rubra, and a total of 66 allele numbers (Na) were detected, with the lowest number of 4 (P29) and the highest number of 17 (P24) (Table 4). The effective number of alleles (Ne) ranged from 1.4123 to 6.6499, with an average of 3.6320. The observed heterozygosity (Ho) ranged from 0.1584 to 0.7327, with an average of 0.4724; the expected heterozygosity (He) ranged from 0.2934 to 0.8538, with an average of 0.6390, indicating that these primers were good at amplifying polymorphisms in 101 Cyclobalanopsis rubra materials. The average Nei's gene diversity index (H) of the seven pairs of primers was 0.6358, and the Shannon's diversity index (I) ranged from 0.6734 to 2.2205, with an average of 1.4763. The polymorphic information content (PIC) ranged from 0.2806 to 0.8354, with an average value of 0.6098.

[0112] Table 4 Genetic diversity parameters of 7 EST-SSR markers in 101 Cyclobalanopsis glauca accessions

[0113]

[0114]

[0115] Population genetic diversity analysis:

[0116] The percentage of polymorphic sites (PPB) among the populations of Cyclobalanopsis rubra was quite different, among which the PPB values ​​of HNDK, HNHT, HNJZ, HNSZ, ZJQY, GZTZ and FJJO populations were the highest, 100%, and the lowest, 57.14% in ZJLH, ZJSM and JXWY populations (Table 5). The Na of HNDK population was the largest, 5.7143, followed by GZTZ (Na=4.5714) and HNHT (Na=4.4286), and the Na of ZJLH and JXWY populations was the smallest, 1.5714. The maximum Ne value of 3.0804 also appeared in HNDK population, and the minimum value was in JXWY population (Ne=1.3956). According to the results of H and I, the genetic diversity level of the HNDK population was the highest, the genetic diversity of the HNHT, GZTZ and FJJO populations was also relatively rich, and the genetic diversity level of the JXWY population was the lowest.

[0117] Table 5 Estimation of genetic diversity parameters of 14 populations of Cyclobalanopsis rubra

[0118]

[0119] Population genetic differentiation analysis:

[0120] The genetic differentiation coefficient (Fst) of the red-skinned Cyclobalanopsis population was 0.174 6, and the Fst values ​​between different populations ranged from 0.0418 to 0.6071 (Table 6), with the minimum value between populations HNYS and HNSZ, and the maximum value between populations ZJLH and JXWY. The gene flow value (Nm) ranged from 0.1618 to 5.7309, with an average of 1.1850, indicating that the gene flow level was generally at a medium level, but there were large differences between different populations (Nagylaki, 1998). The results of AMOVA analysis (Table 7) revealed that the genetic differentiation of the red-skinned Cyclobalanopsis resources mainly came from the variation between individuals and within individuals within the population, which were 9.99% and 72.55% respectively, and the genetic differentiation between populations accounted for 17.46%.

[0121] Table 6: Genetic differentiation coefficient (Fst, above the diagonal) and gene flow (Nm, below the diagonal) among 14 populations of Cyclobalanopsis rubra

[0122]

[0123] Table 7: AMOVA analysis of variance of 14 Cyclobalanopsis rubra populations

[0124]

[0125] Note: The significance test was performed after 999 permutations.

[0126] Population genetic structure analysis:

[0127] The Structure population structure of Cyclobalanopsis rubra was analyzed based on 7 EST-SSR markers. When K = 7, the ΔK value is the largest ( Figure 4 ), indicating that the tested materials of Cyclobalanopsis rubra can be divided into 7 subgroups. The proportions of the Cyclobalanopsis rubra materials of the 14 populations in the 7 subgroups are as follows: the gene composition of the HNCB population material comes from the 2nd subgroup (green), the 5th subgroup (purple) and the 6th subgroup (cyan); the gene composition of the HNDK population material comes from the 1st subgroup (red, accounting for 25%), the 2nd subgroup (accounting for 30%) and the 4th subgroup (yellow, accounting for 40%); the gene composition of the HNJZ population material mainly comes from the 1st and 6th subgroups; the gene composition of the HNSZ, HNYS and ZJLH population materials mainly comes from the 3rd subgroup (blue); The genetic composition of the HNHT population material is evenly distributed in the six subpopulations (excluding the third subpopulation); the genetic composition of the ZJQY population material comes from the first subpopulation (red, accounting for 50%) and the seventh subpopulation (orange, accounting for 50%); the genetic composition of the ZJSM and JXWY population materials mainly comes from the fourth subpopulation; the genetic composition of the ZJSC and CQWZ population materials all comes from the fifth subpopulation; 88.89% of the genetic composition of the GZTZ population material comes from the second subpopulation; 50% of the genetic composition of the FJJO population material comes from the seventh subpopulation ( Figure 5 ). This shows that there is a certain degree of gene exchange between populations of Cyclobalanopsis rubra and there is a serious genetic admixture within the population.

[0128] Using principal coordinate analysis, we can display the relationship based on the distance of the location on a two-dimensional plane. Figure 6 It can be seen that the 14 population materials of Cyclobalanopsis rubra are mixed with each other and cannot be clearly separated, which verifies the analysis results of the population genetic structure.

[0129] Genetic distance and cluster analysis:

[0130] The GD value of the Cyclobalanopsis rubra population ranged from 0.0345 to 0.8881, with an average of 0.4054. The materials with GD values ​​between 0.20 and 0.90 accounted for 92.31%, and those with GD values ​​≥ 0.40 accounted for 65.93%, indicating that the genetic differences between the tested populations were generally large. Among them, the populations with the largest GD values ​​were JXWY and CQWZ (GD = 0.8881), and the populations with the smallest GD values ​​were HNSZ and HNYS (GD = 0.0345). According to the Mantel test, there was no significant correlation between the genetic distance and geographical distance of the Cyclobalanopsis rubra population (r = 0.1847, P = 0.0530), indicating that the distance isolation model cannot well explain the formation of the genetic pattern of the Cyclobalanopsis rubra population. It can be found that the geographical distances between ZJLH, ZJQY and ZJSC are relatively close (253km and 237km respectively), but the genetic distances between populations are relatively large (0.7976 and 0.7102 respectively); the geographical distances between populations HNYS and ZJSM are relatively far (1136km), but the genetic distances between populations are relatively small (0.2210), indicating that geographical distance is not the dominant factor in the formation of the modern genetic pattern of Cyclobalanopsis rubra.

[0131] Cluster analysis was performed on 14 Cyclobalanopsis glauca populations based on the UPGMA method, and a phylogenetic tree was constructed ( Figure 6 ). When the genetic distance value is 0.228, three clades are formed, among which Clade I contains 9 populations, Clade II contains 4 populations, and Clade III contains only 1 population (ZJLH). At the genetic distance value of 0.132, Clade I is further divided into 5 subclades, among which: I-1 contains two Hunan populations HNCB and HNHT and 1 Fujian population (FJJO); I-2 is composed of populations HNJZ and ZJQY; I-3 and I-4 are formed by populations ZJSC and HNCB respectively; I-5 contains two populations GZTZ and CQWZ. Clade II contains two subclades, among which II-1 is formed by population JXWY, and II-2 is composed of three populations ZJSM, HNSZ and HNYS.

[0132] Table 8 Genetic distance (GD, below the diagonal) and geographic distance (above the diagonal, unit: km) between populations of Cyclobalanopsis rubra

[0133]

[0134] Results and Analysis:

[0135] Transcriptome SSR distribution and polymorphism analysis of Cyclobalanopsis rubra:

[0136] A total of 36,127 SSR loci were obtained based on transcriptome data, with an occurrence frequency of 26.85%, which was lower than that of avocado (35.05%, Guo Jun et al., 2020) and camellia oleifera (63.22%, Dai Han et al., 2024), but higher than that of Bupleurum chinense (20.08%, Wang Binbin et al., 2024), olive (22.98%, Xie Qian et al., 2023), blueberry (25.57%, Yang Qin et al., 2024), and Taxus chinensis var. mairei (5.38%, Jiang Luyuan et al., 2024), indicating that the frequency of SSRs varies in different plants, which may be related to factors such as development methods, search criteria, and differences in plant gene sequences (Du Qingzhang, 2014).

[0137] From the perspective of the repeat types of SSR markers, the most frequent type in Cyclobalanopsis rubra was the mononucleotide repeat type (accounting for 54.42%), followed by the dinucleotide and trinucleotide repeat types, accounting for 31.17% and 12.59%, respectively. Figure 3 ). Since mononucleotide repeats are often not considered to be useful polymorphic markers (Yan Qiuliang, 2007), this study mainly screened EST-SSR markers from dinucleotide and trinucleotide repeat types. From the perspective of dinucleotide repeat motifs, AG / TC is the most abundant, accounting for 21.36%, followed by AC / TG (accounting for 5.03%) and AT / TA (accounting for 4.70%). Among trinucleotide repeat motifs, AAG / TTC is the most abundant (accounting for 1.51%).

[0138] Polymorphism is an important criterion for judging the effectiveness of molecular markers (Xie Qian et al., 2023). The PIC values ​​of the EST-SSR primers screened in this study ranged from 0.2806 to 0.8354. According to the standard of Botstein et al. (1980), when the PIC value is ≥0.5, the primer is a highly polymorphic primer, and when 0.25 < PIC value <0.5, it is a moderately polymorphic primer. Among the 7 pairs of EST-SSR primers, 5 pairs are highly polymorphic primers and 2 pairs are moderately polymorphic primers, reflecting that the polymorphism level of the primers is generally high (the average PIC value is 0.6098). In addition, combined with the parameters of the tested primers such as Na (4-17), He (0.2934-0.8538), and Ho (0.1584-0.7327), the 7 pairs of polymorphic EST-SSR primers screened this time can reflect the heterozygosity of the red-skinned Cyclobalanopsis population and are suitable for population genetic diversity analysis.

[0139] Analysis of genetic diversity of Cyclobalanopsis rubra population:

[0140] Genetic diversity is an important criterion for measuring the evolutionary potential and environmental adaptability of species, and has important reference value for the excavation and utilization of germplasm resources (Zhu Shujing et al., 2023). The use of 7 pairs of EST-SSR primers independently developed revealed that the average percentage of polymorphic sites (PPB = 83.67%), the Nei's gene diversity index (H = 0.4416) and the Shannon's information index (I = 0.7813) of the red-skinned Cyclobalanopsis population were higher than the results obtained by Zhu Pinhong (2014) based on ISSR markers (PPB = 79.29%, H = 0.3012, I = 0.4514), which may be related to the wider sampling range and larger population size of this study. Compared with closely related species, the average He value of the red-skinned Cyclobalanopsis population (0.4435) is lower than the average He value of Fujian Cyclobalanopsis (C.chungii) (0.5409) (Jiang Xiaolong, 2020), indicating that the genetic diversity of the red-skinned Cyclobalanopsis population is relatively lower. The H value can be further judged that the H values ​​of the 14 populations of Cyclobalanopsis rubra ranged from 0.2222 to 0.6054, with an average value of 0.441 6 (<0.5), confirming that the genetic diversity of wild resources of Cyclobalanopsis rubra was at a medium level. The average values ​​of Ho and He of the 14 populations were close, 0.5556 and 0.5714, respectively, indicating that the heterozygotes of the Cyclobalanopsis rubra population were moderate, and there was no obvious lack of heterozygotes or more heterozygotes (Cheng Jianhui et al., 2004). However, in the HNCB, HNDK, HNHT, HNJZ, HNYS, ZJSM, GZTZ and FJJO populations, there was a phenomenon that Ho was lower than He, suggesting that there was self-pollination within these populations (Tang Jianmin et al., 2004).

[0141] The genetic diversity of plants is related to their breeding methods and life forms. Generally, the genetic diversity level of rare species is lower than that of widespread species (Zhu Shujing et al., 2023). Although Cyclobalanopsis rubra is distributed in many places in my country, the population size is generally small. Many studies have shown that there is a close relationship between population size and biodiversity (Frankham, 1996). The low genetic diversity of populations such as JXWY, ZJSM, and ZJLH may be due to the small and fragmented population size caused by habitat destruction, and the loss of alleles caused by genetic drift caused by inbreeding (Lin Li et al., 2012).

[0142] Analysis of genetic structure of Cyclobalanopsis rubra population:

[0143] According to the results of AMOVA analysis, 17.46% of the genetic variation of Cyclobalanopsis rubra comes from populations, and a larger proportion (72.55%) occurs between individuals, which is consistent with the research results of Zhu Pinhong (2014).

[0144] Paphiopedilum Helenii has moderate genetic diversity and low genetic variation among populations, which may be related to its bright flower colors, deceptive pollination strategy and dust-like seeds, which increase the frequency of gene exchange within the population.

[0145] The results of AMOVA analysis (Table 7) revealed that the genetic differentiation of the Cyclobalanopsis rubra resources mainly came from the variation between individuals (72.55%), followed by the variation between populations (17.46%), and there was also some individual variation within the population (9.99%).

[0146] The microsatellite method uses the Fis value to measure the heterozygosity within a population. The analysis of the four populations in this study showed that all four populations showed a certain degree of heterozygosity loss. The reason for this result may be that the content of the samples tested in the experiment was too small. Because the content of the samples tested in the experiment was too small, the presence of invalid alleles, etc. may lead to low calculated heterozygosity values.

[0147] Wright (1972) believed that when Fst < 0.05, there was little differentiation between populations; when 0.05 ≤ Fst ≤ 0.15, the genetic differentiation was moderate; when 0.15 < Fst ≤ 0.25, the genetic differentiation between populations was obvious; and when Fst > 0.25, the genetic differentiation was great. In general, the genetic differentiation of Cyclobalanopsis rubra populations was obvious.

[0148] FIS is the inbreeding coefficient within a population, indicating the lack of heterozygosity within a subpopulation due to non-random mating between individuals in the subpopulation. The total inbreeding coefficient FIT reflects the degree of heterozygosity loss in the total population. Its value is between -1 and 1. An inbreeding coefficient of >0 indicates a lack of heterozygotes, and an inbreeding coefficient of <0 indicates an excess of heterozygotes. FST indicates the degree of differentiation between populations. Wright believes that when FST ≤ 0.05, there is little or almost no differentiation between populations; when FST is between 0.05 and 0.15, there is a moderate degree of differentiation, and when it is between 0.15 and 0.25, there is obvious differentiation. When Fst > 0.25, there is extreme differentiation between populations. Figure 8 The F test data diagram in the embodiment shows that the Fis and Fit of the Angelica population are both positive values ​​(Fis=0.1210, Fit=0.2745), indicating that there is inbreeding between the varieties (lines) of Angelica, and each variety (line) is mainly homozygous. FST is 0.086, indicating that there is a moderate degree of differentiation in the Angelica varieties (lines). Gene flow Nm is an important factor affecting population differentiation. When Nm<1, it indicates that the level of gene exchange between the various populations is low, and the population may have differentiated due to genetic drift. The gene flow Nm between different varieties (lines) of Angelica is 2.667, indicating that there is a relatively frequent gene exchange between the Angelica varieties (lines).

[0149] The genetic differentiation among populations of Cyclobalanopsis rubra was large, with a gene differentiation degree (Gst) of 0.0613, indicating that most of the genetic variation of Cyclobalanopsis rubra exists within the population, and the genetic variation within the population accounts for 93.87% of the total variation, while the variation between populations is 6.13%. The gene flow (Nm) was 3.8283, and Nm>1. The results showed that the gene flow level among populations of Cyclobalanopsis rubra could prevent the effect of genetic drift, reduce the variation produced locally, and maintain the similarity among populations. The clustering results of the genetic distances of the seven populations showed that populations with close geographical distances clustered together, and the size of the genetic distance between populations had a certain correlation with the distance between the geographical distances. The genetic distance (D) values ​​among populations ranged from 0.0260 to 0.1596, among which the genetic distances of the Yongding population in Hunan and the Sangzhi population in Hunan were the smallest, and the genetic distances of Jingzhou in Hunan and Qingyuan in Zhejiang were the largest. These results showed that the distance between the geographical distances of Cyclobalanopsis rubra populations was the main factor affecting the genetic variation of populations. The analysis results of ISSR genetic diversity and genetic structure of seven existing populations of Cyclobalanopsis rubra showed that the main reason for the scarcity of Cyclobalanopsis resources is not genetic variation, but human interference and habitat destruction. Based on this, corresponding strategies were proposed for the protection of existing populations of Cyclobalanopsis rubra: raising forest farmers' awareness of forest protection, establishing protected areas, conducting in-depth research on the species, and establishing a germplasm resource bank.

[0150] In the description of the embodiments of the present application, it should be noted that in the description of the present application, terms such as "inside" and "outside" indicating directions or positional relationships are based on the directions or positional relationships shown in the drawings. This is only for the convenience of description, and does not indicate or imply that the device or component must have a specific orientation, be constructed and operated in a specific orientation. Therefore, it cannot be understood as a limitation on the present application.

[0151] In the description of the present application, the description with reference to the terms "one embodiment", "some embodiments", "in the present embodiment", "specific example", or "some examples" etc. means that the specific features, mechanisms, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, mechanisms, materials or characteristics described may be combined in a suitable manner in any one or more embodiments or examples. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0152] The above is only a specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed in the present application should be included in the protection scope of the present application. Therefore, the protection scope of the present application shall be based on the protection scope of the claims.

Claims

1. A EST-SSR marker primer for Cyclobalanopsis glauca leaves, characterized in that: The primers include 7 primer pairs, namely P2, P11, P24, P25, P29, P32, and P34, and the sequences are shown in SEQ ID NOs: 1-14, wherein: The primer sequence of P2 is: Forward primer: GGAGGCACACGTACCAAAGT; Reverse primer: TTGAGTCGGTGCACAGAAAG; The primer sequence of P11 is: Forward primer: TCCACACTTTTGCCACACTC; Reverse primer: CGGGGTTTACTATGGAGCAA; The primer sequence of P24 is: Forward primer: CCCTTACTCATTGTCCGGTT; Reverse primer: TTCGTGATGCAAGGTACCAA; The primer sequence of P25 is: Forward primer: TCCAATATCACTTCCATTCCC; Reverse primer: TCTGTGTCCAAAATGCTGC; The primer sequence of P29 is: Forward primer: TAACCTCCAACGGTACGGAA; Reverse primer: GGACCGGATTTAAGAGAGGG; The primer sequence of P32 is: Forward primer: CCAACTCAAGTCCTCCCAAA; Reverse primer: TTGTCAGCTCCTCTGGGACT; The primer sequence of P34 is: Forward primer: TTAGGGCTTTGACGGAGAAA; Reverse primer: ATCCAGATTCCACAACACCC.

2. A method for preparing the EST-SSR marker primers of Cyclobalanopsis glauca leaves according to claim 1, characterized in that: The following steps are involved: S1: Select various samples of Cyclobalanopsis glauca leaves for sampling and drying; S2: extracting DNA from the sample stored in step S1 and performing purity testing, and then storing all the extracted sample DNA for future use; S3: Select the DNA sample extracted in step S2 to establish a PCR amplification system, then perform PCR amplification to obtain pre-selected primers, and then screen the pre-selected primers to obtain Cyclobalanopsis glauca EST-SSR marker primers.

3. The method for preparing EST-SSR marker primers of Cyclobalanopsis glauca leaves according to claim 2, characterized in that: In step S2, the method for DNA extraction and purity detection is: using a plant / fungal genomic DNA extraction kit to extract DNA from the sample, and then using 1% agarose gel electrophoresis and NanoDrop 2000 ultra-micro spectrophotometer to detect DNA concentration and purity.

4. The method for preparing EST-SSR marker primers of Cyclobalanopsis glauca leaves according to claim 2, characterized in that: In step S2, the storage condition is as follows: dilute the DNA to 50 ng·μL -1 Then store in a -20℃ refrigerator for later use.

5. The method for preparing EST-SSR marker primers of Cyclobalanopsis glauca leaves according to claim 2, characterized in that: In step S3, the PCR amplification system includes: a total volume of 20 μl, including: 14.8 μl of ddH2O, 2 μl of 10×Buffer, 0.4 μl of a mixture of 2.5 mM dNTPs, 0.3 μl of a solution of 20 μM forward primer, 0.3 μl of a solution of 20 μM reverse primer, 2 μl of 50 ng·μL -1 DNA template solution, 0.2 μl of 5U·μL -1 Taq DNA polymerase.

6. The method for preparing EST-SSR marker primers of Cyclobalanopsis glauca leaves according to claim 5, characterized in that: In step S3, the PCR reaction procedure includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 45 s, and extension at 72°C for 50 s, for a total of 35 cycles; extension at 72°C for 7 min, and finally storage at 10°C.

7. An application of the EST-SSR marker primers for Cyclobalanopsis glauca leaves according to claim 1, characterized in that: The application includes the application of EST-SSR marker primers of Cyclobalanopsis glauca leaves in the genetic diversity of its population.

8. The use according to claim 7, characterized in that: The population genetic diversity includes the number of alleles, the effective number of alleles, the observed heterozygosity, the expected heterozygosity, the Nei's genetic diversity index, the Shannon's information index and the polymorphism information content.

9. An application of the EST-SSR marker primers for Cyclobalanopsis glauca leaves according to claim 1, characterized in that: The application includes the application of EST-SSR marker primers of Cyclobalanopsis glauca leaves in population genetic structure analysis, population genetic differentiation analysis, genetic distance and cluster analysis.

Images