Multiplex fluorescent PCR (polymerase chain reaction) method for detecting parasite pollution in water body and application of multiplex fluorescent PCR method

Abstract

The invention relates to a multiplex fluorescent polymerase chain reaction (PCR) method for detecting parasite pollution in a water body and application of the multiplex fluorescent polymerase chain reaction (PCR) method. According to the method, the existence of schistosoma japonicum katsurada, giardia giardia and hooked nematode duodenum in a water body is detected by utilizing a fluorescent quantitative PCR technology so as to evaluate whether the water body is polluted by the parasites or not. The method comprises the following steps: extracting environmental DNA of a to-be-detected sample, preparing a PCR amplification system containing a specific primer and a fluorescent probe, and detecting the 18s rRNA gene of a target parasite through a PCR amplification reaction. The method is rapid, sensitive and specific, and has important practical application value for evaluating and preventing water parasite pollution.

Description

Technical Field

[0001] The present invention relates to molecular biology detection technology, and in particular to a method for detecting the presence of Schistosoma japonicum, Giardia spp. and Ancylostoma duodenale in water by using fluorescent quantitative polymerase chain reaction technology to evaluate whether the water is contaminated by these parasites. Background Art

[0002] Water pollution is a global problem, among which parasite pollution is of particular concern. Traditional water detection methods rely on microscopic examination or biological culture, which are time-consuming, low-sensitivity, and difficult to detect low-abundance pathogens. Therefore, the development of a rapid, sensitive, and specific detection method is of great significance for the assessment and prevention of water parasite pollution.

[0003] Schistosoma japonicum is a serious public health problem, especially in areas with polluted water. The larvae (cercariae) of this parasite usually infect humans through contact with contaminated water. When people swim, bathe, or perform other activities in water containing cercariae, the cercariae can penetrate the skin and enter the body, causing schistosomiasis japonicum.

[0004] Giardia lamblia, also known as Giardia duodenalis, is a widespread single-cell protozoan that is common in areas with poor sanitation. It can parasitize in the human small intestine and cause giardiasis. The spread of Giardia is mainly related to water pollution. It can be transmitted through contaminated drinking water, recreational water, or direct contact with infected individuals. Giardia cysts are highly resistant to the environment and can survive for weeks in humid environments and for days in drinking water. They can resist conventional chlorination disinfection treatments and are widely distributed in natural water bodies, including lakes, rivers, streams, and even municipal water supplies and swimming pools.

[0005] Ancylostoma duodenale is one of the main pathogens of hookworm disease, which can cause long-term chronic blood loss and lead to iron deficiency anemia. The larvae (filariform larvae) of this hookworm can survive in polluted water and can penetrate the skin and infect the human body when people touch or swim barefoot. Therefore, water pollution increases the risk of hookworm infection, especially in warm and humid soil and water environments.

[0006] Water pollution is a global problem, among which parasite pollution is of particular concern. Traditional water detection methods rely on microscopic examination or biological culture, which are time-consuming, low-sensitivity, and difficult to detect low-abundance pathogens. Therefore, establishing a rapid and effective method for detecting multiple parasites has important practical application value and significance for assessing and preventing water parasite pollution.

[0007] The beneficial effect of the present invention is that it provides a rapid, sensitive and specific fluorescent quantitative PCR detection method, which can effectively detect whether there is schistosoma, giardia and hookworm pollution in water bodies, and has important practical application value for evaluating and preventing water parasite pollution. Summary of the invention

[0008] The technical problem to be solved by the present invention is to establish a rapid and effective means of detecting multiple parasites for evaluating and preventing parasite pollution in water bodies.

[0009] To achieve the purpose of the present invention, the technical solution adopted by the present invention is as follows:

[0010] The present invention provides a multiplex PCR primer set for detecting 18srRNA of Schistosoma japonicum, Giardia spp. and Ancylostoma duodenale in water, characterized in that: the primer set contains any one or more specific primers for detecting Schistosoma japonicum, Giardia spp. and Ancylostoma duodenale respectively, including primer sets for amplifying 18s rRNA of three parasites of Schistosoma japonicum, Giardia spp. and Ancylostoma duodenale and corresponding fluorescent probes respectively, the primer set includes SJ18s-F, SJ18s-R, GI18s-F, GI18s-R, AD18s-F and AD18s-R, and the nucleotide sequences thereof are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6 respectively, SJ18s-F and SJ18s-R are 18s rRNA of Schistosoma japonicum, respectively. The invention relates to an upstream and downstream primer of the rRNA gene of the three parasites, GI18s-F and GI18s-R are respectively the upstream and downstream primers of the 18s rRNA gene of Giardia, AD18s-F and AD18s-R are respectively the upstream and downstream primers of the 18s rRNA gene of Ancylostoma duodenale; the fluorescent probes corresponding to the 18s rRNA genes of the three parasites are SJ18s-P, GI18s-P and AD18s-P, and their nucleotide sequences are shown in SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9, respectively.

[0011] Furthermore, the 5' ends of the fluorescent probes SJ18s-P, GI18s-P and AD18s-P are all labeled with a fluorescent reporter group, and the 3' ends are all labeled with a fluorescent quencher group.

[0012] Furthermore, the fluorescent reporter group labeled with TXR at the 5' end of the fluorescent probe SJ18s-P, and the fluorescent quencher group labeled with BHQ2 at the 3' end, the fluorescent reporter group labeled with FAM at the 5' end of the fluorescent probe GI18s-P, and the fluorescent quencher group labeled with BHQ0 at the 3' end, and the fluorescent probe labeled with VIC at the 5' end of the fluorescent probe AD18s-P, and the fluorescent quencher group labeled with BHQ1 at the 3' end.

[0013] The method comprises the following steps:

[0014] 1. Extract environmental DNA from samples or water bodies to be tested;

[0015] 2. Configure a PCR amplification system containing a primer-probe combination to perform an amplification reaction on the sample to be tested;

[0016] The reaction conditions are pre-denaturation at 95°C for 2-5 min, denaturation at 95°C for 20-30 sec, annealing at 65°C-56°C for 30-35 sec, and extension at 72°C for 15-25 sec, wherein the annealing temperature of the first cycle is 65°C, and then the annealing temperature decreases by 1°C after each cycle, and the cycle is repeated 10 times; denaturation at 95°C for 20-30 sec, annealing at 56°C for 30-35 sec, and extension at 72°C for 15-25 sec, and the cycle is repeated 40 times.

[0017] The detection method of this patent is used to detect water parasite pollution. The 18s rRNA of three parasites, Schistosoma japonicum, Giardia, and Ancylostoma duodenale, can be detected simultaneously. It can effectively evaluate and prevent water parasite pollution. It is simple and efficient, with high accuracy, sensitivity and specificity, and low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a diagram showing the normal working result of the primer and probe combination of the present invention indicating the detection system (Schistosoma japonicum plasmid, Giardia plasmid, Ancylostoma duodenalis plasmid);

[0019] Figure 2 This is a graph showing the results of the primer and probe combination of the present invention detecting test samples (Schistosoma japonicum, Giardia, and Ancylostoma duodenale). DETAILED DESCRIPTION

[0020] The principles and features of the present invention are described below in conjunction with specific embodiments. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0021] Example 1 Multiplex PCR primer set and probe set for detecting parasite 18s rRNA in water

[0022] The technical solution of the present invention will be described clearly and in detail below in conjunction with specific embodiments. All other embodiments obtained by ordinary technicians in the field without creative work are within the protection scope of the present invention.

[0023] The invention provides a multiplex PCR primer set for detecting Schistosoma japonicum, Giardia spp. and Ancylostoma duodenale in water, comprising primers SJ18s-F, SJ18s-R, GI18s-F, GI18s-R, AD18s-F and AD18s-R; the nucleotide sequences thereof are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6, respectively; SJ18s-F and SJ18s-R are respectively the upstream and downstream primers of the 18s rRNA gene of Schistosoma japonicum, GI18s-F and GI18s-R are respectively the upstream and downstream primers of the 18s rRNA gene of Giardia spp., AD18s-F and AD18s-R are respectively the upstream and downstream primers of the 18s rRNA gene of Ancylostoma duodenale; the 18s The fluorescent probes corresponding to the rRNA genes are SJ18s-P, GI18s-P and AD18s-P, respectively, and their nucleotide sequences are shown in SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, respectively. The specific sequences of the primer set and the probe set are shown in Table 1 below:

[0024] Table 1 Multiplex fluorescent PCR primer sets and probe sets for detecting parasite environmental DNA in water

[0025] serial number Primer or probe sequence Fluorescent reporter and quencher type SJ18s-F tctttcaaatgtctgccctatc (SEQ ID NO: 1) -- DNA SJ18s-R tgagtcccgtatccgtattt (SEQ ID NO: 2) -- DNA GI18s-F ggacgggtgaaacaggat (SEQ ID NO: 3) -- DNA GI18s-R gtcagattgagccgcaga (SEQ ID NO:4) -- DNA AD18s-F cttagaaacggctaccacatc (SEQ ID NO:5) -- DNA AD18s-R gcagcaatgacgatttacacta (SEQ ID NO: 6) -- DNA SJ18s-P gtgatttgcctaccatgatgataa (SEQ ID NO:7) TXRBHQ2 TaqMan GI18s-P tgaaacttgaaggcattgacg (SEQ ID NO:8) FAMBHQ0 TaqMan AD18s-P caggcgcgtaacttatccact (SEQ ID NO:9) VIC BHQ1 TaqMan

[0026] Example 2 Multiplex fluorescence PCR method for detecting parasites in water

[0027] The multiplex fluorescent PCR method for detecting parasites in water includes the multiplex fluorescent PCR primer set and probe set for detecting parasites in water provided in Example 1.

[0028] (1) Extraction of environmental DNA: The DNA of the three parasites was extracted from the test water using a commercially available water environmental DNA extraction kit (NucleoSpin® eDNAWater). The concentration and purity of the DNA were determined using Nanodrop; if the DNA concentration was too low, the DNA of the sample to be tested was obtained through multiple extractions and concentrations.

[0029] (2) Multiplex fluorescence PCR amplification detection

[0030] The 18S rRNA genes of Schistosoma japonicum, Giardia and Hookworm duodenalis were amplified using primer combinations and corresponding probe combinations of four water parasites. In addition to the samples to be tested, 18S rRNA plasmid templates of three different parasites and a control group using ddH2O as a template were amplified. The four plasmids were used as positive controls to indicate whether the system was working; ddH2O was used as a negative control to indicate whether the experiment was contaminated by the template.

[0031] Before multiplex fluorescence PCR amplification detection, add 5 μl of sample DNA or plasmid, ddH2O, and then add 20 μl of premixed solution. Set the PCR amplification program as 95℃ pre-denaturation for 2-5min, 95℃ denaturation for 20-30sec, 65℃-56℃ annealing for 30-35sec, and 72℃ extension for 15-25sec. The annealing temperature of the first cycle is 65℃, and then the annealing temperature decreases by 1℃ after each cycle, and the cycle is repeated 10 times; 95℃ denaturation for 20-30sec, 56℃ annealing for 30-35sec and collecting and detecting fluorescence signals, 72℃ extension for 15-25sec, 40 cycles, and PCR products are stored at 4℃; each channel is set to collect four fluorescence signals of FAM, VIC, ROX and CY3 at the same time. The multiplex fluorescence PCR reaction system is shown in Table 2 below.

[0032] Table 2: Multiplex fluorescence PCR reaction system

[0033] Element Volume (μl) Final concentration 10X PCR Buffer 2.5 1X <![CDATA[25mM Mg 2+ ]]> 2.5 2.5mM 5mM dNTPs 1 0.2mM 20 μM SJ18s-F 0.5 0.4μM 20 μM SJ18s-R 0.5 0.4μM 20μM GI18s-F 0.5 0.4μM 20μM GI18s-R 0.5 0.4μM 20 μM AD18s-F 0.5 0.4μM 20μM AD18s-R 0.5 0.4μM 5μM SJ18s-P 0.5 0.1μM 5μM GI18s-P 0.5 0.1μM 5μM AD18s-P 0.5 0.1μM 5U / μl Taq DNA polymerase 0.2 1U / reaction <![CDATA[Sample cDNA / Plasmid Template / ddH2O]]> 5 - <![CDATA[ddH2O]]> 9.3 Make up the total volume to 25 μl

[0034] (3) Interpretation of results

[0035] A. Judgment of control results: The three positive control plasmids all have corresponding fluorescent signals rising, and the Ct value is not greater than 25; the negative control has no fluorescent signal rising, which indicates that the detection system is usable.

[0036] B. If the control results are normal, the quality control has passed and the results of the samples to be tested can be judged:

[0037] 1) If the Ct of the rising signal of Schistosoma japonicum 18s rRNA gene is less than 40, the sample to be tested is judged to be positive for Schistosoma japonicum contamination, that is, Schistosoma japonicum contamination exists in the water body; if there is no rising signal of Schistosoma japonicum 18s rRNA gene or the Ct of the rising signal is greater than 40, the sample to be tested is judged to be negative for Schistosoma japonicum contamination.

[0038] 2) If the Ct of the Giardia 18s rRNA gene signal rise is <40, the sample to be tested is judged to be positive for Giardia contamination, that is, there is Giardia contamination in the water body; if there is no signal rise of the Giardia 18s rRNA gene or the Ct of the signal rise is >40, the sample to be tested is judged to be negative for Giardia contamination.

[0039] 3) If the Ct of the rising signal of the 18s rRNA gene of Ancylostoma duodenalis is less than 40, the sample to be tested is judged to be positive for Ancylostoma duodenalis contamination, that is, Ancylostoma duodenalis contamination exists in the water body; if there is no rising signal of the 18srRNA gene of Ancylostoma duodenalis or the Ct of the rising signal is greater than 40, the sample to be tested is judged to be negative for Ancylostoma duodenalis contamination.

[0040] Example 3 Detection of test samples using the detection method of the invention

[0041] The primer combination and probe combination shown in Example 1 were used to verify the water samples containing DNA of Schistosoma japonicum, Giardia and Ancylostoma duodenale according to the method of Example 2. The test results are as follows: Figure 1-2 As shown, Figure 1 The results showed that the Ct values ​​of plasmid amplification of the three parasites were all less than 25, and the negative control did not produce any fluorescent signal, proving that the detection system was normal and usable; Figure 2 The results showed that the primer and probe combination of the present invention can well detect and distinguish the 18S rRNA of the above three parasites.

[0042] The detection method of this patent can be used to detect Schistosoma japonicum, Giardia, and Ancylostoma duodenale in water, which can effectively detect and distinguish the presence of parasites in water. The method is simple and efficient, with high specificity and low cost.

[0043] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A multiplex fluorescence PCR method for detecting parasite contamination in water, characterized in that: The method comprises the following steps: a) extracting environmental DNA from the sample to be tested; b) configuring a PCR amplification system containing a primer-probe combination to perform an amplification reaction on the sample to be tested; c) Detection of the 18s rRNA gene of the target parasite by PCR amplification reaction.

2. The method according to claim 1, characterized in that The primer set contains specific primers for detecting Schistosoma japonicum, Giardia spp. and Ancylostoma duodenale, including primer sets for amplifying 18s rRNA of three parasites, namely Schistosoma japonicum, Giardia spp. and Ancylostoma duodenale, and corresponding fluorescent probes.

3. The method according to claim 2, characterized in that The primer set includes SJ18s-F, SJ18s-R, GI18s-F, GI18s-R, AD18s-F and AD18s-R, and their nucleotide sequences are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

4. The method according to claim 2 or 3, characterized in that: The fluorescent probes corresponding to the 18s rRNA genes of the three parasites are SJ18s-P, GI18s-P and AD18s-P, and their nucleotide sequences are shown in SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, respectively.

5. The method according to claim 4, characterized in that The 5' ends of the fluorescent probes SJ18s-P, GI18s-P and AD18s-P are all labeled with a fluorescent reporter group, and the 3' ends are all labeled with a fluorescent quencher group.

6. The method according to claim 5, characterized in that The fluorescent reporter group labeled with TXR at the 5' end of the fluorescent probe SJ18s-P, and the fluorescent quencher group labeled with BHQ2 at the 3' end; the fluorescent reporter group labeled with FAM at the 5' end of the fluorescent probe GI18s-P, and the fluorescent quencher group labeled with BHQ0 at the 3' end; the fluorescent probe labeled with VIC at the 5' end of the fluorescent probe AD18s-P, and the fluorescent quencher group labeled with BHQ1 at the 3' end.

7. The method according to any one of claims 1 to 6, characterized in that The conditions for the PCR amplification reaction are pre-denaturation at 95°C for 2-5 min, denaturation at 95°C for 20-30 sec, annealing at 65°C-56°C for 30-35 sec, and extension at 72°C for 15-25 sec, wherein the annealing temperature of the first cycle is 65°C, and then the annealing temperature decreases by 1°C after each cycle, and the cycle is repeated 10 times; denaturation at 95°C for 20-30 sec, annealing at 56°C for 30-35 sec, and extension at 72°C for 15-25 sec, and the cycle is repeated 40 times.

8. A multiplex PCR primer set for detecting Schistosoma japonicum, Giardia spp., and Ancylostoma duodenale in water, characterized in that: The primer set contains any one or more specific primers for detecting Schistosoma japonicum, Giardia spp. and Ancylostoma duodenale, including primer sets for amplifying 18s rRNA of three parasites, Schistosoma japonicum, Giardia spp. and Ancylostoma duodenale, and corresponding fluorescent probes.

Images