Breeding method of butter crabs and method for screening key genes formed by butter crabs

Abstract

The invention relates to a method for cultivating butter crabs and a method for screening key genes formed by the butter crabs. The method comprises the following steps: a, screening blue crabs cultivated by the butter crabs; b, performing cultivation management; according to the breeding method, blue crabs are independently bred in a crab breeding device, and the crab breeding device comprises a breeding basket body; the sandy layer is laid at the bottom of the breeding basket body; the blowdown device is arranged in the breeding basket body, and water in the sandy layer, excrement and residual feed can be discharged by means of water level pressure generated by the inner side and the outer side of a blowdown chamber. By regulating and controlling the temperature and salinity of seawater, the proportion of the butter crabs in the blue crab breeding process is increased; the pollution discharge device is arranged in the crab breeding device, self-cleaning of the sandy layer is achieved, the stress reaction of crabs is reduced, meanwhile, the self-cleaning sandy layer can allow the crabs to dive in sand, the living state of the crabs in the nature is simulated, meanwhile, the crabs can be prevented from ulcer, and then the breeding success rate of the butter crabs is increased.

Description

Technical Field

[0001] The invention relates to the technical field of aquaculture, in particular to a method for cultivating butter crabs and a method for screening key genes formed by butter crabs. Background Art

[0002] The butter crab is a special type of female mud crab. It is named mainly because its hemolymph is yellow and oily. Because of its good taste, high nutritional value and high scarcity, it is very popular among consumers in China (especially Guangdong Province) and its price is also relatively high. So far, the mechanism of the formation of butter crab is still unclear, and the existence of "butter crab" is unpredictable. There are currently three main hypotheses about the formation mechanism of butter crab: (1) High temperature stimulation-stress theory: The strong sunlight and warm water temperature after low tide in summer stimulate the physiological response of the crab, causing the ovary to degenerate and decompose into golden oil that penetrates into various parts of the body; (2) Developmental lesion-lesion theory: The ovaries of normal female crabs absorb nutrients from the hepatopancreas and eventually develop into crabs. However, some crabs may have lesions, metabolic disorders, and cannot absorb nutrients from the hepatopancreas, eventually forming butter crabs; (3) "germplasm theory": that seedlings from specific coastal areas are more likely to breed butter crabs. It is believed that mud crabs from the surrounding areas of Dianbai District, Maoming City, Guangdong Province are more likely to produce butter crabs. Farmers purchase this type of crab seedlings in the hope that the pond will produce a higher proportion of butter crabs, but no quantitative research has been done. Therefore, it is necessary to study the formation mechanism of butter crabs and provide a theoretical basis for the development of the blue crab industry.

[0003] The production of butter crabs mainly depends on chance. At present, they are mainly produced randomly in ponds. There are about 2-3 butter crabs among 1,000 blue crabs. However, artificial regulation and induction are still blank, which has huge commercial potential. Environmental regulation may be an important way to induce the production of butter crabs. The factory-scale circulating water monomer breeding system for crabs plays an important role in environmental regulation and can be used to induce the production of butter crabs. Compared with pond breeding, the factory-scale circulating water monomer breeding system for crabs has many advantages, such as: (1) strong environmental controllability; (2) high water resource utilization rate; (3) high breeding density; (4) reduced fighting and high survival rate. According to the applicant's breeding experience, when using factory-scale circulating water monomer breeding for crabs, the sandy bottom plays an important role in maintaining the living environment of crabs, promoting their growth and reproduction. However, due to the constraints of various factors such as technology, equipment or design concepts, the existing breeding system cannot effectively be compatible with the sandy bottom. If the system does not have a sandy bottom, blue crabs will have a stress response due to their habit of burrowing in the sand, which will affect their survival rate. If a sandy bottom is placed in the system, waste will easily accumulate if the bottom is not cleaned properly, causing crab diseases or even death. Therefore, it is urgent to design a crab factory-scale circulating water monomer breeding device that can be placed on a sandy bottom and has a self-cleaning function, such as the Chinese invention patent "A crab breeding device" with patent number 201921431446.4 (authorization announcement number CN210929164U). Although the sewage discharge unit in the device can discharge excrement and residual bait to achieve the self-cleaning function, there are still the following defects in the actual breeding process: (1) It is impossible to flexibly switch the water level and the sandy bottom when breeding young crabs and adult crabs; (2) The sewage discharge unit adopts a siphon generating device, and its overall device structure is relatively complex and the manufacturing cost is high; (3) The setting of the double area in the breeding box body reduces the breeding space of crabs in the breeding box body; (4) There is a lack of water outlet and rest space for crabs that like to dry and expose. For this reason, the current crab factory-scale circulating water monomer breeding device still needs to be further optimized to better meet the actual breeding needs. Summary of the invention

[0004] The first technical problem to be solved by the present invention is to provide a method for cultivating butter crabs which can better cultivate butter crabs and prevent the sandy layer from stinking due to the accumulation of residual bait or excrement in view of the above-mentioned existing technical status.

[0005] The second technical problem to be solved by the present invention is to provide a method for cultivating butter crabs that can be switched between high-level and low-level cultivation in view of the above-mentioned existing technical status. The third technical problem to be solved by the present invention is to provide a method for screening key genes for the formation of butter crabs by using the above-mentioned cultivation method in view of the above-mentioned existing technical status.

[0006] The technical solution adopted by the present invention to solve the above-mentioned first technical problem is: the butter crab breeding method comprises the following steps:

[0007] a. Screening blue crabs bred from butter crabs: Select healthy blue crabs with a size of 400-500g and complete appendages;

[0008] b. Cultivation management: The bait shall be fresh or chilled shellfish, and the daily dry matter weight shall not be less than 5% of the body weight of the cultured blue crabs;

[0009] Features:

[0010] The blue crab in step a is a female crab, and the gonadal development reaches stage IV or above / the ovarian index is greater than 10%;

[0011] In the culture management conditions in step b, the salinity of seawater is in the range of 3-17‰, the temperature of seawater is in the range of 18-28°C, and the fluctuation between day and night does not exceed ±2°C;

[0012] The blue crabs in step a and step b are all raised separately in a crab culture device, wherein the crab culture device comprises

[0013] Breeding basket body;

[0014] A sandy layer is laid on the bottom of the breeding basket body;

[0015] The sewage discharge device is arranged in the breeding basket body, and generates water level pressure inside and outside the sewage discharge chamber, so that the water in the sandy layer together with the excrement and residual bait can be discharged.

[0016] In order to prevent the sandy layer from stinking due to the accumulation of residual bait or excrement, that is, to solve the second technical problem, preferably, the sewage discharge device includes a first sewage discharge chamber which is relatively isolated from the breeding basket body and is suitable for high water level breeding, and a vertically arranged partition is provided in the first sewage discharge chamber to separate the first sewage discharge chamber into a first flow channel and a second flow channel that are connected; a low water inlet lower than the top of the partition and a high water inlet higher than the top of the partition are provided on the first wall portion of the first flow channel corresponding to the first sewage discharge chamber, and a first water outlet is provided on the bottom wall of the first sewage discharge chamber corresponding to the second flow channel, thereby achieving: with the help of the height of the partition, water level pressure is generated inside and outside the first sewage discharge chamber, so that the water in the sandy layer, together with the excrement and residual bait, can enter the first sewage discharge chamber through the low water inlet through the first flow channel, and then be discharged through the first water outlet of the second flow channel, thereby achieving the goal of flushing away the excrement while retaining the sandy layer, and finally achieving self-purification of the sandy layer.

[0017] The first sewage discharge chamber can be cylindrical or frame-shaped, as long as it can be relatively isolated from the breeding basket body. The bottom wall of the first sewage discharge chamber can be independently set from the bottom wall of the breeding basket body, or it can be: part of the bottom wall of the breeding basket body directly serves as the bottom wall of the first sewage discharge chamber, and the first sewage discharge chamber also includes a side wall extending upward from the bottom wall, and the first wall portion constitutes part of the side wall. This can also reduce the production cost of the entire breeding basket body. The first sewage discharge chamber is explained by taking a frame shape as an example: the first sewage discharge chamber uses the side wall portion of the breeding basket body directly as the inner wall of the first sewage discharge chamber, and the side wall has three: a first wall portion arranged opposite to the inner wall, and a first side wall and a second side wall connecting the first wall portion and the inner wall, the partition is connected to the first side wall and the second side wall, and the bottom end of the partition is connected to the bottom wall of the first sewage discharge chamber. The advantage of this design is that the partition can be set more stably. On the other hand, the first sewage discharge chamber is set at the most side position relative to the breeding basket body, which maximizes the activity area required for butter crab breeding.

[0018] In order to balance the pressure of the first sewage discharge chamber and the outside atmosphere, preferably, the top of the first sewage discharge chamber is open, and the back of the bottom wall of the breeding basket body is provided with a first water outlet pipe connected to the first water outlet of the second flow channel. The first water outlet pipe can be connected to the top open part of each breeding basket body located below, so that the water in the sandy layer of the breeding basket body of the upper layer, together with the excrement and the leftover bait, directly flows into the breeding basket body of the next layer through the first water outlet pipe, so as to realize the step-by-step self-purification of the sandy layer.

[0019] In order to provide a resting space for the butter crabs that like to dry and soak, preferably, a drying platform for crabs to dry and soak and rest is detachably provided in the breeding basket body, and the drying platform is provided adjacent to the first sewage discharge chamber, and its height is between the low water inlet and the high water inlet. The drying platform is located between the low water inlet and the high water inlet, and it can not affect the sewage discharge function of the first sewage discharge chamber. The drying platform includes a platform body and at least two drainage holes for drainage arranged on the platform body, and a notch that can adapt to the first sewage discharge chamber is provided on the platform body. The drying platform is kept dry by the drainage holes; the breeding basket body is also provided with a support member for supporting the platform body, and the support member is provided with a slot for the platform body to be inserted. The movement of the drying platform is prevented by the clamping connection between the drying platform and the support column.

[0020] Furthermore, a third water outlet is provided at the bottom of the breeding basket body for discharging the sandy layer together with the breeding water, and a switch for opening or closing the third water outlet is installed in the third water outlet. When the third water outlet is opened, the cleaning water together with the sandy layer can be discharged when the entire breeding basket body is finally cleaned.

[0021] In order to simulate the biological effect of light, preferably, a light source is also provided on the breeding basket body, and the light source is a full-spectrum LED lamp, and the light intensity of the light source is 50-300Lx, and the illumination time is 12-18 hours. The full-spectrum LED lamp is based on sunlight, and the simulation of sunlight intensity and time is closer to nature than the visible light LED lamp. The design of the light intensity and illumination time is because butter crabs are mostly formed in a relatively high temperature environment. The temperature in the natural environment is higher in spring and summer, and the illumination time is about 12-18 hours.

[0022] In order to provide a method for cultivating butter crabs that can be cultivated on a large scale and at a low cost, preferably, each of the cultivation basket bodies is arranged vertically and / or horizontally to form a crab cultivation system, including a main water outlet pipe located at the bottom layer and connected to the first water outlet pipes of each cultivation basket body at the bottom, a pump body connected to the water outlet end of the main water outlet pipe, and a water supply pipe located at the top layer and connected to the pump body to supply water to each cultivation basket body at the top. From top to bottom, the first water outlet pipe and / or the second water outlet pipe of each cultivation basket body located at the top are directly connected to the top open part of each cultivation basket body located at the bottom. By using the first sewage discharge device in the cultivation basket, water can flow from the first sewage discharge device in the upper cultivation box into the lower cultivation box, and gravity flows through the self-flow between each cultivation basket body, which greatly reduces the electric energy required for circulating water and the pipelines required for water inlet and outlet.

[0023] To solve the third technical problem, the present invention provides a method for screening key genes for the formation of butter crabs, characterized in that it includes the following steps:

[0024] S1: The normal crab and the butter crab cultured by the above-mentioned butter crab culture method were cultured, and the ovarian tissues of the normal crab and the butter crab were sequenced;

[0025] S2: In step S1, transcripts are obtained by aligning the transcriptome sequencing results to the reference genome, assembling transcripts, and annotating gene functions;

[0026] S3: Calculate the FPKM value of the expression of each gene in each sample through the transcript, and calculate the difference in the expression of each gene in the comparison between the normal crab group and the butter crab group to identify the differentially expressed genes;

[0027] S4: Perform gene enrichment analysis on the differentially expressed genes in step S3 to identify pathways where the differentially expressed genes are significantly enriched;

[0028] S5: screening the differentially expressed genes in the pathways identified in step S4;

[0029] S6: Design primers and detect the expression levels of the differentially expressed genes in step S5.

[0030] Furthermore, the pathway in which the differentially expressed genes are enriched is the regulation of lipolysis in adipocytes, and the differentially expressed genes in the pathway include MGL gene, FABP gene and HSL gene, wherein

[0031] The cDNA sequence of the MGL gene is shown in SEQ ID NO.1;

[0032] The cDNA sequence of the FABP gene is shown in SEQ ID NO.2;

[0033] The cDNA sequence of the HSL gene is shown in SEQ ID NO.3.

[0034] Furthermore, the differentially expressed genes also include GS gene, PKG gene, AC gene, β-AR gene, wherein

[0035] The cDNA sequence of the GS gene is shown in SEQ ID NO.4;

[0036] The cDNA sequence of the PKG gene is shown in SEQ ID NO.5;

[0037] The cDNA sequence of the AC gene is shown in SEQ ID NO.6;

[0038] The cDNA sequence of the β-AR gene is shown in SEQ ID NO.7.

[0039] Furthermore, the primers of the MGL gene are: MGL-F: CTGTTCAGAGGCGTGGTTCT, MGL-R: TACCGTGATGTAGGGCAGGA;

[0040] The primers for the FABP gene are:

[0041] FABP-F:ACGCTGGATGACGGCACCTA,

[0042] FABP-R:CGTCCATCAGCAGTGGTCTCCT;

[0043] The primers for the HSL gene are:

[0044] HSL-F:AGGCTGTGTGTCCGTGTTCA,

[0045] HSL-R: AGGACGACCAGTGACGCAAGA.

[0046] Compared with the prior art, the advantages of the present invention are:

[0047] 1. By regulating the seawater temperature and salinity, the proportion of butter crabs in the blue crab farming process is increased;

[0048] 2. A sewage discharge device is installed in the crab breeding device to realize the self-purification of the sand layer. While reducing the stress response of crabs, the self-purifying sand layer can be maintained for crabs to burrow into the sand and prevent ulcers from occurring while simulating the living state of crabs in nature, thereby improving the success rate of butter crab breeding;

[0049] 3. The present invention studied the ovarian tissues of normal crabs and butter crabs, and used RNA-seq technology to detect the expression of mRNA to obtain a reliable transcriptome data set. Using this data set, the differential genes and signal pathways between butter crabs and normal crabs were analyzed to provide a basis for clarifying the regulatory mechanism of the transformation of normal crabs into butter crabs;

[0050] 4. The results of the present invention illustrate that normal crabs can activate the regulatory pathway of lipolysis in adipocytes by artificially inducing temperature and salinity factors, thereby increasing the expression of MGL, FABP and HSL genes, thereby accelerating the lipid decomposition process of ovarian tissue and increasing the formation ratio of butter crabs; primers of MGL, FABP and HSL genes are also designed, providing technical means for detecting the expression of MGL, FABP and HSL genes, and also proving that salinity and temperature can affect the formation of butter crabs by affecting the expression of MGL, FABP and HSL genes, the optimal salinity is 10-17‰, the optimal temperature is 18-23°C, and the breeding parameters of butter crabs are improved;

[0051] During the present invention, the following studies have found that: (1) genes in the regulatory pathway of lipolysis in adipocytes are significantly differentially expressed in the butter crab group, and these changes may affect the formation of butter crabs; (2) MGL, FABP and HSL genes are all differentially expressed genes. In addition, these three genes are all involved in the regulation of lipolysis in adipocytes. These changes may be the key to the transformation of normal crabs into butter crabs. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 is a schematic diagram of embodiment 1 of the present invention;

[0053] Figure 2 Schematic diagram of Example 1 of the present invention (excluding the door panel and the partition panel);

[0054] Figure 3 is another schematic diagram of Embodiment 1 of the present invention;

[0055] Figure 4 It is a cross-sectional view of the breeding basket body of Example 1 of the present invention;

[0056] Figure 5 This is a schematic diagram of a crab breeding system according to Example 1 of the present invention;

[0057] Figures 6A-6B This is an analysis diagram of the bacterial community structure on the surface of blue crabs in Example 2 of the present invention, in which there is no bottom sediment, PVC pipes are placed, and a sandy layer is laid. Fig. 6A This is the analysis result diagram of principal coordinate analysis PCoA; Figure 6B This is the analysis result diagram of non-metric multidimensional scaling NMDS;

[0058] Figures 7A to 7C This is a traceability analysis diagram of the bacterial community on the surface of the crab in Example 2 of the present invention, wherein: Fig. 7A This is a traceability analysis diagram of the bacterial community on the surface of crabs without sand on the bottom; Figure 7B This is a traceability analysis diagram of the bacterial community on the surface of the crab placed in the PVC tube; Figure 7C This is a traceability analysis diagram of the bacterial community on the surface of crabs in the bottom sand-laying group;

[0059] Figure 8 is the ratio of butter crab under different temperature conditions in Example 5 of the present invention;

[0060] Fig. 9 is the ratio of butter crab under different salinity conditions in Example 6 of the present invention;

[0061] Figures 10A to 10L This is a comparison diagram of the appearance of a butter crab and a normal crab in Example 8 of the present invention, wherein: Fig. 10A This is the overall picture of a normal crab; Fig. 10B This is a partial enlarged view of the red dotted frame in A, which is a photo of a normal crab appendage; Fig. 10C This is a photo of the ovarian tissue of a normal crab; Fig. 10D This is a photo of the muscle tissue of a normal crab's body; Fig.10E This is a photo of the muscle tissue of the claw of a normal crab. Fig.10F This is a photo of the hemolymph of a normal crab; Figure 10G This is the overall picture of the butter crab; Fig. 10H for Figure 10G The enlarged part of the red dotted box is the photo of the butter crab appendages; Fig.10I This is a photo of the ovarian tissue of a butter crab; Fig.10J This is a photo of the muscle tissue of the butter crab's body; Figure 10K This is a photo of the muscle tissue of the large claw of the butter crab; Fig.10L A photo of the hemolymph of a butter crab;

[0062] Figures 11A to 11B The hepatopancreas index and gonad index statistics of the initial, normal and butter crab groups in Example 8 of the present invention are shown in FIG. Fig.11AIt is the statistical graph of hepatopancreas index of the initial, normal crab and butter crab groups; Fig. 11B Statistical graph of gonadal index of initial, normal crab and butter crab groups; stars indicate statistically significant differences, "*" represents P < 0.05, and "**" represents P < 0.01;

[0063] Figures 12A to 12F This is a histological comparison photo of the cross section of the ovarian tissue of a normal crab and a butter crab in Example 8 of the present invention, wherein: Fig. 12A This is a 4x magnified photo of a cross section of normal crab ovarian tissue; Fig. 12B This is a 10-fold magnified photograph of a cross section of normal crab ovarian tissue; Fig. 12C This is a 20-fold magnified photograph of a cross section of normal crab ovarian tissue; Fig.12D This is a 4x magnified photo of the cross section of the ovarian tissue of the butter crab; Fig.12E This is a 10x magnified photo of the cross section of the ovarian tissue of the butter crab; Fig.12F This is a 20-fold magnified photograph of the cross section of the ovarian tissue of the butter crab (in the annotations, Fc represents follicular cell, Nu represents cell nucleus, No represents nucleolus, Oc represents oocyte, Va represents vacuoles, and Yg represents yolk granules);

[0064] FIG. 13 is a statistical diagram of biochemical indices of the hepatopancreas, ovary and hemolymph of normal crabs and butter crabs in Example 8 of the present invention, wherein: Fig.13A The triglyceride and total cholesterol contents in the hepatopancreas of normal crab and butter crab; Fig. 13B The triglyceride and total cholesterol contents of normal crab and butter crab ovaries; Fig. 13C The contents of triglyceride, total cholesterol, free fatty acid, low-density lipoprotein cholesterol and high-density lipoprotein cholesterol in the hemolymph of normal crabs and butter crabs; stars indicate statistically significant differences, "*" represents P < 0.05, and "**" represents P < 0.01;

[0065] Fig.14 This is a bar graph of the number of differentially expressed genes in the ovarian tissues of normal crabs and butter crabs in Example 9 of the present invention;

[0066] Fig.15 The volcano plot of differentially expressed genes in ovarian tissues of butter crabs and normal crabs in Example 9 of the present invention, wherein significantly down-regulated differential genes are shown in blue, significantly up-regulated differential genes are shown in red, and genes with no significant expression difference are shown in gray; black vertical lines highlight Log2(FC)=1 or -1, FC represents fold change; black horizontal lines represent P values ​​of 0.05;

[0067] Fig.16 It is a bubble diagram of KEGG enrichment analysis of differentially expressed genes in the ovaries of butter crab and normal crab in Example 9 of the present invention;

[0068] Fig.17 It is a bubble chart of GO enrichment analysis of differentially expressed genes in the ovaries of butter crab and normal crab in Example 9 of the present invention;

[0069] Figures 18A to 18C The relative expression statistics of MGL, FABP and HSL genes in the ovarian tissue of Scylla pseudoburrows at different temperatures in Example 10 of the present invention are shown in FIG. Fig.18A The statistical diagram of the relative expression of MGL gene in the ovarian tissue of mud crab at different temperatures; Fig.18B The statistical diagram of the relative expression of HSL gene in the ovarian tissue of mud crab at different temperatures; Fig.18C The statistical diagram of the relative expression of FABP gene in the ovarian tissue of mud crab at different temperatures;

[0070] Figures 19A to 19C The relative expression statistics of MGL, FABP and HSL genes in the ovarian tissue of mud crab under different salinities in Example 10 of the present invention are shown in FIG. Fig.19A The statistical diagram of the relative expression of MGL gene in the ovarian tissue of mud crab under different salinities; Fig.19B The relative expression statistics of HSL gene in ovarian tissue of mud crab under different salinities; Fig.19C This is a statistical chart of the relative expression levels of FABP genes in the ovarian tissue of Scylla pseudoburrowing crab under different salinities. DETAILED DESCRIPTION

[0071] The present invention is further described in detail below with reference to the accompanying drawings.

[0072] Example 1 High and low water level breeding structure of crab breeding device for butter crab breeding

[0073] like Figure 1-5 As shown, the crab breeding device of this embodiment is applicable to high water level breeding and low water level breeding. In the crab growth stage, small crabs can be bred at low water level; commercial crabs or parent crabs temporarily raised for wintering can be bred at high water level. The following is a further detailed description in conjunction with the device diagram.

[0074] In order to enable the breeding basket body 1 to breed small crabs at a low water level, a second drainage chamber 22 is provided in the breeding basket body 1, which is located on different side walls of the breeding basket body 1 and is relatively isolated from the breeding basket body 1. It can also be provided on the same side wall, which can be determined according to actual production needs, wherein the second drainage chamber 22 is provided with a second water inlet 221 located at a height between the low water inlet 215 and the high water inlet 216, and the bottom wall of the second drainage chamber 22 is provided with a second water outlet, and the second water outlet is provided at the bottom wall of the breeding basket body 1. A second water outlet pipe 12 connected to the second water outlet is provided on the back, and the water outlet end of the second water outlet pipe 12 is connected to the middle part of the first water outlet pipe 11, and a switch 13 for connecting or disconnecting the water channel of the first water outlet pipe 11 is provided on the second water outlet pipe 12. When crabs need to be cultured at a low water level (no sandy layer A is required), the switch 13 is opened, and the second water outlet pipe 12 of the first sewage discharge chamber 21 here serves as the water outlet end of the second water outlet pipe 12, and the water in the culture basket body 1 can flow out through the second water outlet pipe 12.

[0075] In addition, the following is an introduction to high-water-level aquaculture. The bottom of the aquaculture basket body 1 of this embodiment is paved with a sandy layer A, and also includes a sewage discharge device 2. The sewage discharge device 2 includes a first sewage discharge chamber 21 that is relatively isolated from the aquaculture basket body 1 and is suitable for high-water-level aquaculture. A vertically arranged partition 211 is provided in the first sewage discharge chamber 21 to separate the first sewage discharge chamber 21 into a first flow channel 212 and a second flow channel 213 that are connected. The first sewage discharge chamber 21 is provided with a first wall portion 214 corresponding to the first flow channel 212. There is a low water inlet 215 which is lower than the top of the partition 211 and a high water inlet 216 which is higher than the top of the partition 211. A first water outlet is provided on the bottom wall of the first sewage chamber 21 corresponding to the second flow channel 213, thereby achieving: with the help of the height of the partition 211, water level pressure is generated inside and outside the first sewage chamber 21, so that the water in the sandy layer A together with the excrement and leftover bait can enter the first sewage chamber 21 through the first flow channel 212 from the low water inlet 215, and then be discharged through the first water outlet of the second flow channel 213. The first flow channel 212 of the first sewage chamber 21 creates a water level pressure difference between the inside and outside of the breeding basket body 1 by virtue of the height of the partition 211. Since the sandy layer A itself is relatively heavy, it will not be washed away by the water flow. In this way, the water in the sandy layer A in the breeding basket body 1 together with the excrement and leftover bait will automatically enter the first sewage chamber 21 through the low water inlet 215 through the first flow channel 212, and then be discharged through the first water outlet of the second flow channel 213, thereby achieving the goal of flushing away the excrement while retaining the sandy layer A, and finally achieving self-purification of the sandy layer A.

[0076] In summary, the working process of low water level and high water level aquaculture of this aquaculture device is as follows:

[0077] (1) Low water level aquaculture:

[0078] The switch member 13 is turned on, so that the second water outlet pipe 12 is connected to the first water outlet pipe 11, and the water in the breeding basket body 1 can flow out from the first sewage chamber 21 and the second sewage chamber 22 of the sewage discharge device 2. Since the height of the second water inlet 221 of the second sewage chamber 22 is located between the low water inlet 215 and the high water inlet 216, and is lower than the top of the partition 211, when the water level reaches the height of the second water inlet 221, the water will enter the second sewage chamber 22 from the second water inlet 221, and then be discharged from the second water outlet of the second sewage chamber 22.

[0079] (2) High water level aquaculture:

[0080] The switch member 13 is closed to disconnect the second water outlet pipe 12 from the first water outlet pipe 11; water is continuously supplied to the breeding basket body 1 through the water inlet pipe, so that the water level remains stable between the low water inlet 215 and the high water inlet 216, and a water level difference is created between the first flow channel 212 and the second flow channel 213 by virtue of the height of the partition 211. Therefore, there is a pressure difference, and under the action of the pressure, the water in the sandy layer A together with the excrement and the residual bait enter the first sewage chamber 21 from the low water inlet 215 through the first flow channel 212, and then is discharged through the first water outlet of the second flow channel 213.

[0081] Example 2 Sandy layer factors of crab breeding device for butter crab breeding

[0082] In the process of cultivating butter crabs in this method, the method is aimed at crabs with roe, i.e. large-sized crabs, so the high water level in the above Example 1 is used for cultivation. In order to explore the role of the sandy layer under high water level cultivation conditions, the following experiments were conducted:

[0083] The artificially reared female mud crabs were used as experimental materials. Before the experiment, the mud crabs were individually reared in the culture basket body 1 of the crab culture device in Example 1 for 14 days to adapt to the environment and fed with frozen bamboo clam meat. During the adaptation period, the water quality indicators of the culture water body were maintained as follows: temperature 15-20°C, dissolved oxygen>8mg / L, salinity 23-25‰, pH 7.8-8.3, ammonia nitrogen<0.50mg / L, nitrite<0.02mg / L, and light exposure time of 12h. An appropriate amount of fresh ice fish was fed at 5:00 pm every day, and feces, residual bait and dead crabs were removed after 3 hours, and 1 / 3 of the water was changed.

[0084] 1. Animal Experimentation:

[0085] A total of 72 healthy crabs (271.80±26.08g) with complete appendages and gonadal development at stage IV or above were selected.

[0086] 2. Test methods:

[0087] Three sets of crab culture basket bodies 1 were prepared, and one blue crab was placed in each culture basket body 1. The bottom of the first group had no bottom sediment, the bottom of the second group had a PVC pipe, and the bottom of the third group had a sandy layer with a thickness of 8 cm and a sand diameter of 1-3 mm. The three systems were all in circulating water mode. Three replicate groups were set for each group, and each replicate group had 8 blue crabs cultured individually. The experimental culture lasted for 28 days.

[0088] 3. Test results

[0089] (1) Survival rate

[0090] The survival rates of blue crabs cultured under different substrates are shown in Table 1.

[0091] Table 1 Survival rate of blue crabs in different substrates

[0092]

[0093] The results showed that after 28 days of experiment, the survival rate of blue crabs cultured under different substrates was significantly different (P=0.03). The survival rate of blue crabs in the bottomless group was the lowest at 41.2±5.7%, while the survival rate of blue crabs in the sandy layer was the highest at 76.8±7.2%. Therefore, the results showed that laying a sandy layer in the culture device can improve the survival rate of blue crabs.

[0094] (2) Ovarian development

[0095] The ovarian development of blue crabs cultured under different substrates is shown in Table 2.

[0096] Table 2 Ovarian index of blue crabs in different substrates

[0097]

[0098] The results showed that there were significant differences in the ovarian development of blue crabs cultured under different substrates (P=0.04). The ovarian index of blue crabs in the bottomless group was the lowest, and the ovarian index of blue crabs in the sandy layer was the highest. Therefore, the results showed that laying a sandy layer in the culture device can accelerate the ovarian development of blue crabs.

[0099] (3) Ulcer incidence

[0100] The incidence of ulcers in blue crabs cultured under different substrates is shown in Table 3.

[0101] Table 3 Effect of different substrates on the incidence of ulcers

[0102]

[0103] The results showed that the incidence of ulcers in blue crabs cultured under different substrates was significantly different (P=0.01). The incidence of blue crab ulcers in the group without substrate was the highest at 49.9±16.7%, and no ulcers were found in blue crabs in the sandy layer. Therefore, the results show that laying a sandy layer in the culture device can significantly inhibit the incidence of blue crab ulcers.

[0104] (4) Analysis of bacterial communities on the surface of blue crabs

[0105] The bacterial community structure on the surface of blue crabs cultured in three different substrates was studied. Fig. 6A The results of principal coordinate analysis (PCoA) showed that the bacterial communities on the crab surface of the sandy layer group and the PVC tube group were significantly different from those of the bottomless group at the PCo1 level (explaining 38% of the variance), and the difference in the sandy layer group was more significant (P<0.05). Figure 6B The non-metric multidimensional scaling (NMDS) analysis results also showed that the bacterial community on the surface of the crabs in the sandy layer group was significantly different from that in the no-bottom group (P<0.05). The above results all indicate that laying a sandy layer can significantly change the bacterial community structure on the surface of blue crabs.

[0106] Further analysis of the sources of bacteria on the surface of blue crabs was conducted, as shown in Table 4 and Figures 7A to 7C As shown, the results showed that the bacterial community on the surface of blue crabs in the group without bottom sediment and the group with PVC pipe placement mainly came from the water body. However, in the group with sandy layer, the source of the bacterial community on the surface of crabs changed significantly, and most of them came from sand, with only less than 1% of the bacteria coming from the water body.

[0107] Table 4: Sources of bacterial communities on the surface of blue crabs cultured under different substrates

[0108]

[0109] The above results show that laying a sand layer in the culture device can not only improve the survival rate of blue crabs, but also accelerate the development of blue crab ovaries. In addition, the sand layer can change the bacterial community structure on the surface of blue crabs, reduce the relative abundance of harmful bacteria, and thus inhibit the occurrence of ulcers.

[0110] Example 3 Self-cleaning function of the sand layer of the crab breeding device for butter crab breeding

[0111] In order to explore the self-purification function of the sand layer in the aquaculture device, artificially raised female mud crabs were used as experimental materials. Before the experiment, the mud crabs were individually raised in the aquaculture basket body 1 of the crab aquaculture device in Example 1 for 14 days to adapt to the environment and fed with frozen bamboo razor clam meat. During the adaptation period, the water quality indicators of the aquaculture water body were maintained as follows: temperature 15-20°C, dissolved oxygen>8mg / L, salinity 23-25‰, pH 7.8-8.3, ammonia nitrogen<0.50mg / L, nitrite<0.02mg / L, and light exposure time of 12h. Feed an appropriate amount of fresh ice fish at 5:00 pm every day, remove feces, residual bait and dead crabs after 3h, and change 1 / 3 of the water.

[0112] 1. Animal Experimentation:

[0113] A total of 120 healthy crabs (305.80±35.18 g) with complete appendages and gonadal development at stage IV or above were selected.

[0114] 2. Test methods:

[0115] Two sets of crab culture basket bodies 1 were prepared, and one blue crab was placed in each culture basket body 1. The bottom of the two system devices was paved with a sand layer with a thickness of 8 cm and a sand diameter of 1-3 mm. However, one of the systems turned on the circulating water, that is, the self-purification function of the sand layer was realized; while the other system did not turn on the circulating water, that is, the sand layer could not achieve self-purification. Three replicate groups were set up in each group, and each replicate group had 20 blue crabs cultured individually, and the experimental culture lasted for 30 days.

[0116] 3. Test results

[0117] The incidence of ulcers in blue crabs depending on whether the sand layer has self-purification function is shown in Table 5.

[0118] Table 5 Ulcer incidence of blue crabs under different sand layer self-purification functions

[0119]

[0120] The results showed that the ulcer rate of blue crabs in the aquaculture device with a sandy layer and circulating water turned on to achieve self-cleaning of the sandy layer was 0%, which can effectively avoid the occurrence of ulcers. However, blue crabs cultured without circulating water and the self-cleaning function of the sandy layer developed serious ulcers, which may be due to the fact that the excrement and humus of blue crabs can breed harmful bacteria, causing shell ulcers in blue crabs. Therefore, the self-cleaning function of the sandy layer can effectively prevent the occurrence of blue crab ulcers.

[0121] Example 4 Crab breeding device dry platform structure for butter crab breeding

[0122] The artificially reared female mud crabs were used as experimental materials. Before the experiment, the mud crabs were individually reared in the culture basket body 1 of the crab culture device in Example 1 for 14 days to adapt to the environment and fed with frozen bamboo clam meat. During the adaptation period, the water quality indicators of the culture water body were maintained as follows: temperature 15-20°C, dissolved oxygen>8mg / L, salinity 23-25‰, pH 7.8-8.3, ammonia nitrogen<0.50mg / L, nitrite<0.02mg / L, and light exposure time of 12h. An appropriate amount of fresh ice fish was fed at 5:00 pm every day, and feces, residual bait and dead crabs were removed after 3 hours, and 1 / 3 of the water was changed.

[0123] 1. Animal Experimentation:

[0124] A total of 120 healthy crabs (305.80±35.18 g) with complete appendages and gonadal development at stage IV or above were selected.

[0125] 2. Test methods:

[0126] Two sets of crab culture basket bodies 1 were prepared, and one blue crab was placed in each culture basket body 1. The bottoms of the two system culture devices were paved with a sand layer and had a self-cleaning function. One system culture device had a dry platform structure; while the other system culture device did not have a dry platform structure. Three replicate groups were set up in each group, and each replicate group had 20 blue crabs cultured individually, and the experimental culture lasted for 30 days.

[0127] 3. Test results

[0128] The survival rates of blue crabs cultured with and without dry platforms are shown in Table 6.

[0129] Table 6 Effect of dry exposure platform on survival rate

[0130]

[0131] The results showed that after 30 days of testing, the survival rate of blue crabs cultured under the dry platform was significantly different from that under the dry platform (P = 0.012). The survival rate of blue crabs on the basis of adding the dry platform reached 89.0 ± 12.5%. Therefore, the results show that adding the dry platform to the culture device can significantly increase the survival rate of blue crabs.

[0132] In summary, in embodiments 1-4, when the blue crab is cultured under high water level conditions, an 8-10 cm sand layer is laid at the bottom of the culture device, and the self-cleaning function of the sand layer is turned on. In addition, a drying platform is added, which can effectively improve the survival rate of the blue crab and further inhibit the occurrence of blue crab shell ulcers.

[0133] Example 5 Temperature Factors in the Method for Cultivating Butter Crabs

[0134] Artificially reared female mud crabs were used as experimental materials. Before the experiment, the mud crabs were individually reared in a culture basket body 1 of the crab culture device in Example 1 to adapt to the environment for three weeks and were fed with frozen bamboo clam meat.

[0135] 1. Animal Experimentation:

[0136] 96 healthy crabs with complete appendages and gonad development at stage IV or above were selected (average weight 466.9±61.2g). After fertilization, the gonads of female crabs will gradually develop. In biology, we use the gonad index to measure the degree of development of their gonads. The definition of the gonad index is the percentage of gonad weight to the total weight of the individual. Female crabs with a gonad index of more than 10% are in the late stage of gonad development and can be called "roe crabs".

[0137] 2. Test methods:

[0138] Four sets of crab culture basket bodies 1 were prepared, and one blue crab was placed in each culture basket body 1. The initial temperature of the experiment was 16-19°C, and the initial water temperature was cooled or heated to 13-18°C, 18-23°C, 23-28°C and 28-33°C at a rate of 2°C per day.

[0139] During the experiment, the crabs were cultured for 16 weeks and fed with frozen bamboo clam meat at 5% of their body weight every day. Ammonia nitrogen and nitrite were less than 0.5 mg / L, dissolved oxygen was greater than 5 mg / L, pH range was 8-8.5, light intensity was 50-300 Lx, and light duration was 12-18 hours.

[0140] 3. Test results

[0141] The proportion of butter crabs in blue crabs cultured at different temperatures is shown in Table 7 and Figure 8 shown.

[0142] Table 7: The proportion of yellow crabs in blue crabs cultured at different temperatures

[0143]

[0144] Statistics on the specifications of farmed blue crabs showed that the weight range of butter crabs was 474.2±76.3g, while the weight range of normal crabs was 450.8±48.8g. This shows that crabs with slightly larger specifications may be more likely to be cultivated into butter crabs.

[0145] The analysis results of the proportion of butter crabs among blue crabs cultivated at different temperatures show that when the water temperature is between 18-28℃, the proportion of butter crabs is the highest, reaching 30-50%.

[0146] Example 6 Salinity Factors in the Method for Cultivating Butter Crabs

[0147] Artificially reared female mud crabs were used as experimental materials. Before the experiment, the mud crabs were individually reared in the culture basket body 1 of the crab culture device as in Example 1 to adapt to the environment for three weeks and fed with frozen bamboo clam meat. The relevant salinity test was performed on the basis of maintaining the water temperature at 18-28° C. in Example 5.

[0148] 1. Animal Experimentation:

[0149] 45 healthy crabs (average weight 412.3±60.5 g) with complete appendages and gonadal development at stage IV or above were selected.

[0150] 2. Test methods:

[0151] Three crab culture basket bodies 1 were prepared, one blue crab was placed in each basket body 1, the water temperature was maintained at 18-28°C, the initial salinity of the test was 24‰, the first crab culture device was set to a test salinity of 17-24‰, the second crab culture device was set to dilute the salinity to 10-17‰ at a rate of 2‰ per day, the third crab culture device was set to dilute the salinity to 10‰ at a rate of 2‰ per day, and then to 3-10‰ at a rate of 1‰.

[0152] During the experiment, the crabs were cultured for 18 weeks and fed with frozen bamboo clam meat at 5% of their body weight every day. Ammonia nitrogen and nitrite were less than 0.5 mg / L, dissolved oxygen was greater than 5 mg / L, pH range was 8-8.5, light intensity was 50-300 Lx, and light duration was 12-18 hours.

[0153] 3. Test results

[0154] The proportion of butter crabs in blue crabs cultured under different salinities is shown in Table 8 and Fig. 9 shown.

[0155] Table 8: The proportion of yellow crabs in blue crabs cultured at different salinities

[0156]

[0157] Under the premise of a temperature of 18-28°C, the analysis results of the proportion of butter crabs among blue crabs cultivated under different salinities show that when the salinity is 3-17‰, the proportion of butter crabs is the highest, reaching 44-56%.

[0158] Example 7 Cultivation of butter crabs using a culture device and established method

[0159] Artificially reared female mud crabs were used as experimental materials. Before the experiment, the mud crabs were placed in a cement pool (3m*5m*1.5m) for three weeks to adapt to the environment and were fed with frozen bamboo clam meat.

[0160] 1. Animal Experimentation:

[0161] A total of 120 healthy crabs (average weight 405.4±51.2 g) with complete appendages and gonadal development at stage IV or above were selected.

[0162] 2. Test methods:

[0163] The experiment was divided into two groups, and the experimental breeding lasted for 12 weeks. Control group: The blue crabs were placed in 3 square pools for breeding and cultivation. The size of the square pool was 2.5m*2.5m*1m. 20 crabs were placed in each square pool. The water temperature was not additionally controlled, and the natural water temperature was maintained. The salinity was 20-25‰, the dissolved oxygen was >8mg / L, the pH was 7.8-8.3, the ammonia nitrogen was <0.50mg / L, the nitrite was <0.02mg / L, and the light time was 12h. Experimental group: A set of breeding basket bodies 1 of crab breeding devices were prepared, and a blue crab was placed in each breeding basket body 1. The breeding device adopted high water level breeding, and a sandy layer of 8-10cm was laid on the bottom, and the sandpaper layer had a self-cleaning function. In addition, there was a dry platform for rest. The temperature is controlled at 18-28℃, the salinity is 3-17‰, the dissolved oxygen is >8mg / L, the pH is 7.8-8.3, the ammonia nitrogen is <0.50mg / L, the nitrite is <0.02mg / L, and the light time is 14h.

[0164] 3. Test results

[0165] The survival rate during the experiment and the final breeding ratio of butter crabs are shown in Table 9

[0166] Table 9 Survival rate and proportion of butter crabs in different groups

[0167]

[0168] Note: Stars indicate statistically significant differences, P < 0.05 (*) or P < 0.01 (**).

[0169] The results showed that the survival rate of blue crabs was increased to 82.6±9.7% and the proportion of butter crabs was 54.9±10.3% by cultivating blue crabs in the breeding device and controlling a certain temperature and salinity range. Compared with the proportion of butter crabs under natural conditions (1 / 1000), the method of the present invention can significantly improve the breeding ratio of butter crabs.

[0170] Therefore, the results show that the application of the method of the present invention in the above-mentioned breeding device can effectively improve the survival rate of mud crabs and the breeding ratio of butter crabs.

[0171] Example 8 Analysis of the differences in appearance and physiological indicators between normal crabs and butter crabs

[0172] 1. Animal and sample collection

[0173] Six butter crabs cultured according to the method of Example 7 were selected as the butter crab group, and six roe crabs (i.e., ovarian development stage IV and above) were selected as the normal crab group;

[0174] 2. Comparison of the appearance of butter crabs and normal crabs

[0175] Observe various parts of the crabs in the normal crab group and the butter crab group and record the picture results. See Figure 10 for the picture results.

[0176] Specifically, in addition to the differences in appendage color, see Fig. 10A and 10B , there is no obvious difference between the abdomen of butter crabs and normal crabs. The most obvious external features that distinguish normal crabs from "butter crabs" are observed in the appendages and joint membranes, see Fig. 10H , "Butter Crab" shows a distinct red color. Fig.10I Compared with normal crabs, the internal tissue characteristics of "butter crabs" include ovarian atrophy and a color change from orange to dark red; see Fig.10J and 10K , muscle tissue changes from grayish white to brown; see Fig.10L , the hemolymph is dark red and full of oily substances, which is one of the most important features to distinguish normal crabs from "butter crabs", see Fig.10F , because the hemolymph of normal crabs is usually blue.

[0177] 3. Comparison of hepatopancreatic index (HSI) and gonadal index (GSI)

[0178] The hepatopancreas weight, gonad weight and total weight of the crabs before breeding (initial group), normal crabs and butter crabs were weighed respectively, and the hepatopancreas index and gonad index were calculated according to the calculation formula, where the calculation formula is:

[0179] Hepatopancreatic index (HSI, %) = hepatopancreatic weight / crab body weight*100%;

[0180] Gonad index (GSI, %) = gonad weight / crab body weight * 100%; the calculation results are shown in Table 10

[0181] Table 10 HSI and GSI of crabs in different groups

[0182]

[0183] Fig.11A and Fig. 11B For a graphic representation of Table 10, see Fig.11A and Fig. 11BAnalysis showed that the gonad index of the butter crab group showed a statistically significant decrease in the GSI compared with the initial group and the normal crab group (P<0.01). Therefore, ovarian tissue plays an important role in the transformation of normal crabs into butter crabs.

[0184] 4. HE staining observation of ovarian tissue of normal crab and butter crab

[0185] Hematoxylin-eosin staining, referred to as HE staining, is one of the commonly used staining methods in paraffin sectioning technology. The HE staining steps mainly include paraffin embedding, sectioning and staining. In brief, a small portion of ovarian tissue was fixed in 4% tissue cell fixative for 24 hours. After fixation, the sample was dehydrated by continuous immersion in graded ethanol solutions and then embedded in paraffin. Subsequently, the paraffin block containing the sample was cut into 3-4 μm thick sections. After that, the sections were dewaxed using xylene and rehydrated in a series of graded ethanol solutions. Then it was stained with hematoxylin and eosin and covered with neutral resin. Finally, microscopic observation (NOVEL, DN-800M) and image capture analysis were performed.

[0186] The results of the staining step are shown in Figures 12A to 12F , it was concluded that the ovarian tissue of normal crabs showed a complete and clear oocyte structure (Oc), with evenly distributed yolk granules (Yg) in the Oc. In addition, clear structures of the nucleus (Nu) and nucleolus (No) were observed; in contrast, the ovarian tissue of butter crabs showed a degenerative state, with wrinkled Oc, blurred cell boundaries, and structural changes. In addition, the number of Yg in the Oc was significantly reduced, while the number of follicular cells (Fc) around the Oc was significantly increased.

[0187] 5. Comparison of lipid content in hepatopancreas, ovary and hemolymph tissues between normal crab and butter crab

[0188] Experimental procedures: Hepatopancreas and ovarian tissues of normal crabs (n=6) and butter crabs (n=6) were homogenized in physiological saline and placed on ice. The homogenate was centrifuged at 2500 rpm for 15 minutes at 4°C. The supernatant was used to analyze the triglyceride (TG) (A110-1-1) and total cholesterol (T-CHO) (A111-1-1) content according to the instructions in the kit provided by Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Hemolymph samples were collected from crabs and stored in 1.5 mL EP tubes at 4°C overnight. Subsequently, they were centrifuged at 2500 rpm for 15 minutes at 4°C. The supernatant was used to detect the contents of TG (A110-1-1), T-CHO (A111-1-1), free fatty acids (NEFA) (A042-2-1), low-density lipoprotein cholesterol (LDL-C) (A113-1-1) and high-density lipoprotein cholesterol (HDL-C) (A112-1-1). The measurement results are shown in Tables 11 to 13.

[0189] Table 11 Triglyceride and total cholesterol indexes in the hepatopancreas of normal crabs and butter crabs

[0190]

[0191] Table 12 Triglyceride and total cholesterol indexes in ovarian tissues of normal crabs and butter crabs

[0192]

[0193] Table 13 Lipid indexes of hemolymph of normal crab and butter crab

[0194]

[0195] See also Figures 13A to 13C The statistical graphs in Tables 11 to 13 show that there is no significant difference in the triglyceride and total cholesterol content in the hepatopancreas between butter crabs and normal crabs (P>0.05). However, compared with normal crabs, the triglyceride and total cholesterol levels in the ovaries of butter crabs showed a statistically significant decrease (P<0.05). In addition, except for the free fatty acid content, which was not significantly different from that of the normal crab group, the concentrations of other indicators (triglycerides, total cholesterol, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol) in the hemolymph of the butter crab group were significantly higher than those of the normal crab group (P<0.01).

[0196] Example 9 Comparative analysis of transcriptomes of ovarian tissues of normal crabs and butter crabs

[0197] 1. RNA extraction, library preparation and sequencing

[0198] 1.1 Methods

[0199] (1) After the RNA sample is qualified, the mRNA is enriched with magnetic beads with Oligo (dT). Then, fragmentation buffer is added to break the mRNA into short fragments. Using mRNA as a template, a six-base random primer (random hexamers) is used to synthesize a single-strand cDNA. Then, buffer, dNTPs, DNA polymerase I and RNase H are added to synthesize a second-strand cDNA, and then the double-stranded cDNA is purified using AMPure XP beads. The purified double-stranded cDNA is first end-repaired, A-tailed and connected to the sequencing adapter, and then the fragment size is selected using AMPure XP beads. Finally, PCR amplification is performed, and the PCR product is purified using AMPure XP beads to obtain the final library. After the library is constructed, Qubit2.0 is used for preliminary quantification and the library is diluted. Then, the size of the insert fragment of the library is detected using Agilent2100. After the insert fragment meets expectations, the effective concentration of the library is accurately quantified using the qPCR method to ensure the quality of the library.

[0200] (2) The initial fluorescence image data acquired by the Illumina platform were converted into short reads (raw data) through base calling. These short reads were then archived in FASTQ format, including sequence data and related sequencing quality indicators. The raw data were quality controlled using FastQC and filtered using Trim_Galore (v0.6.2) software to obtain Clean data. The filtered Clean data were aligned with the published genome data of the mud crab using Hisat2 software. FeatureCount was used to quantify the gene fragments aligned with the genomic exon sequences to generate the original expression matrix.

[0201] 1.2 Results:

[0202] The cDNA library of ovaries of 12 mud crabs (6 normal crabs and 6 butter crabs in Example 8) was constructed and analyzed using a high-throughput sequencing platform (Illumina NovaSeq 6000), and the total sequencing data was 81.35 Gb. The GC content was 41.10-47.31%. The distribution ranges of Q20 and Q30 in the 12 cDNA libraries were 97.62-98.07% and 93.47-94.45%, respectively. These results indicate that transcriptome sequencing data can be used for further analysis. All sequencing information is shown in Table 14.

[0203] Table 14 Transcriptome sequencing information

[0204]

[0205] 2. Analysis of differentially expressed genes (DEGs) and functional enrichment analysis:

[0206] 2.1 Methods:

[0207] (1) The "stinger" package of R language was used to screen effectively expressed genes, and the screening criterion was that >75% of the fragments were expressed in all samples. The expression matrix was standardized using the "CPM" function of the "edgeR" package, and the obtained CPM value was logarithmized to log2(CPM+1) to obtain a standardized expression matrix. The DESeq2 package was used to perform differential expression analysis on the two treatments (butter crab vs. normal crab). The "DESeq2" package was used to select the differentially expressed DEGs between butter crab and normal crab according to the criteria of P < 0.05 and |log2(fold change)|>1.

[0208] (2) Diamond software was used to annotate protein sequences corresponding to the published genome files of S. pseudoburrowingii against the Nr (NCBI non-redundant protein sequence) and Swiss-Prot databases, with an E-value threshold set at 10 -5 GO and KEGG enrichment analysis of DEGs was performed using the R language “ClusterProfiler” package. In the KEGG enrichment analysis, pathways with P < 0.05 and P.adjust < 0.02 were considered significantly enriched. For GO analysis, entries with P < 0.05 were considered significantly enriched.

[0209] 2.2 Results:

[0210] (1) Analysis of differentially expressed genes (DEGs):

[0211] The raw read counts were normalized and the sequencing depth was adjusted. In the comparison between normal crab and butter crab, a total of 3321 DEGs were identified using the criteria of P < 0.05 and |log2 (fold change)|> 1, including 1749 up-regulated DEGs and 1572 down-regulated DEGs, such as Fig.14 and Fig.15 shown.

[0212] (2) Functional enrichment analysis of DEGs:

[0213] To describe the observed expression patterns in more detail, KEGG enrichment analysis was performed on the significantly up-regulated and down-regulated DEGs. The top 20 enriched KEGG pathways for all DEGs are shown in Fig.16The KEGG pathway that showed the most significant enrichment in butter crab was identified as “Regulation of lipolysis in adipocytes (ko04923)”, followed by “pertussis (ko05133)”, “TNF signaling pathway (ko04668)”, “Notch signaling pathway (ko04330)” and “ribosome (ko03010)”, etc.

[0214] In addition, GO enrichment analysis was performed on DFGs in terms of biological process (BP), cellular component (CC), and molecular function (MF). The enriched GO terms of all DEGs are as follows Fig.17 As shown. In the BP category, the terms such as “regulation of small GTPase-mediated signal transduction”, “small GTPase-mediated signal transduction”, and “regulation of defense response” were significantly enriched in butter crabs. In the CC category, the top three enriched terms in butter crabs were “perinuclear region of cytoplasm”, “apical part of cell”, and “lateral side of membrane”. In the MF category, the terms significantly enriched in the butter group mainly included “nuclease activity”, “actin binding”, and “cadherin binding”.

[0215] 3. Screening of key genes in the regulatory pathway of lipolysis in adipocytes

[0216] Through the KEGG pathway website ( https: / / www.kegg.jp / ) The genes involved in the regulatory pathway of lipolysis in adipocytes (ko04923) that was significantly enriched in butter crabs were searched, and the differentially expressed genes were analyzed through transcriptome data results. The results showed that a total of 7 genes with differential expression were identified in the regulatory pathway of lipolysis in adipocytes, and the specific information is shown in Table 15. Among the upregulated DEGs, MGL, FABP, and HSL genes are key genes that regulate lipid decomposition in the ovaries of butter crabs.

[0217] Table 15 Differentially expressed genes in the regulatory pathways of adipocyte lipolysis

[0218]

[0219]

[0220] Example 10 Relative expression levels of MGL, HSL and FABP genes in ovarian tissue of mud crab under different temperature and salinity conditions

[0221] 1. Methods:

[0222] (1) In order to reveal the expression patterns of the key genes (MGL, HSL and FABP) screened by the transcriptome in the above temperature and salinity examples, ovarian tissues of 6 mud crabs in Example 5 and Example 6 were selected for qPCR analysis;

[0223] (2) RNA extraction and reverse transcription: Total RNA from ovarian tissue was extracted using TRIzol reagent (Invitrogen, USA). The extracted RNA sediment was dissolved in 20-25 μL DEPC-treated water. Total RNA was treated with RNase-Free DNase (Takara, China) to remove genomic DNA contaminants. Then, the concentration and integrity of the extracted total RNA were detected by Nanodrop-2000 (Thermo, USA) and 2% gel electrophoresis, respectively. 2 μg RNA was reverse transcribed into complementary DNA (cDNA) using HiFiScript cDNA synthesis kit (CW Biotech, Shanghai, China) for quantitative PCR analysis.

[0224] (3) Primer design: Based on the sequences of MGL, HSL and FABP in the transcriptome data, the corresponding specific primers were designed (see Table 16). In addition, β-actin was used as an internal reference gene.

[0225] Table 16 Primer information used for qPCR

[0226]

[0227] (4) qPCR analysis: LightCycler96 (Roche) was used for quantitative PCR analysis to evaluate gene expression. Each qPCR system included 10 μL 2× Magic SYBR Green mixture, 1 μL cDNA, 0.4 μL of each 10 mM primer, and 8.2 μL ddH2O, for a total of 20 μL. PCR conditions were: initial denaturation (95°C, 30 s), denaturation (95°C, 5 s), and annealing (60°C, 30 s), for a total of 40 cycles. 2 -△△CT The CT values ​​of the target gene and the internal reference gene (β-actin) were normalized by this method, and the results were the relative expression levels of these genes.

[0228] 2. Results

[0229] See also Figures 18A to 18C Temperature significantly affected the relative expression levels of MGL, FABP and HSL genes in the ovarian tissue of blue crabs. As the temperature increased, the expression level of MGL decreased, while the expression levels of FABP and HSL genes increased significantly at 18-23℃, which also corresponded to the highest formation ratio of butter crabs at 18-23℃. Similarly, see Figures 19A to 19C, salinity also significantly affected the relative expression levels of MGL, FABP and HSL genes in the ovarian tissue of blue crab. Interestingly, the expression levels of MGL and FABP were significantly upregulated at 10-17‰ salinity, which also explains the possible reason why the proportion of butter crab formation was the highest at 10-17‰ salinity. In summary, MGL, FABP and HSL genes play a key role in the formation of butter crab under different temperatures and salinities.

Claims

1. A method for cultivating butter crabs, comprising the following steps: a. Screening blue crabs bred from butter crabs: Select healthy blue crabs with a size of 400-500g and complete appendages; b. Cultivation management: The bait shall be fresh or chilled shellfish, and the daily dry matter weight shall not be less than 5% of the body weight of the cultured blue crabs; Features: The blue crab in step a is a female crab, and the gonadal development reaches stage IV or above, and the ovarian index is greater than 10%; In the culture management conditions in step b, the salinity of seawater is in the range of 3-17‰, the temperature of seawater is in the range of 18-28°C, and the fluctuation between day and night does not exceed ±2°C; The blue crabs in step a and step b are individually raised in a crab breeding device, which comprises: Breeding basket body (1); A sandy layer (A) is laid on the bottom of the breeding basket body (1); The sewage discharge device (2) is arranged in the breeding basket body (1), and water in the sandy layer (A) together with excrement and residual bait can be discharged by means of water level pressure generated inside and outside the sewage discharge device (2).

2. The method for cultivating butter crab according to claim 1, characterized in that: The sewage discharge device (2) comprises a first sewage discharge chamber (21) which is relatively isolated from the breeding basket body (1) and is suitable for high water level breeding, and a vertical partition (211) is provided in the first sewage discharge chamber (21) to separate the first sewage discharge chamber (21) into a first flow channel (212) and a second flow channel (213) which are connected to each other; A low water inlet (215) lower than the top of the partition (211) and a high water inlet (216) higher than the top of the partition (211) are provided on the first wall portion (214) of the first sewage chamber (21) corresponding to the first flow channel (212), and a first water outlet is provided on the bottom wall of the first sewage chamber (21) corresponding to the second flow channel (213), thereby achieving: water level pressure is generated inside and outside the first sewage chamber (21) by virtue of the height of the partition (211), so that water in the sandy layer (A) together with excrement and leftover bait can enter the first sewage chamber (21) from the low water inlet (215) through the first flow channel (212), and then be discharged through the first water outlet of the second flow channel (213).

3. The method for cultivating butter crab according to claim 2, characterized in that: A portion of the bottom wall of the breeding basket body (1) directly serves as the bottom wall of the first sewage discharge chamber (21); the first sewage discharge chamber (21) further comprises a side peripheral wall extending upward from the bottom wall, and the first wall portion (214) constitutes a portion of the side peripheral wall; the first sewage discharge chamber (21) directly uses the side wall portion of the breeding basket body (1) as the inner side wall of the first sewage discharge chamber (21), and the side peripheral wall has three portions: a first wall portion (214) arranged opposite to the inner side wall, and a first side wall (217) and a second side wall (218) connecting the first wall portion (214) and the inner side wall; the partition plate (211) is connected to the first side wall (217) and the second side wall (218), and the bottom end of the partition plate (211) is connected to the bottom wall of the first sewage discharge chamber (21).

4. The method for cultivating butter crab according to claim 3, characterized in that: The top of the first sewage discharge chamber (21) is open, and the back of the bottom wall of the breeding basket body (1) is provided with a first water outlet pipe (11) connected to the first water outlet of the second flow channel (213).

5. The method for cultivating butter crab according to claim 4, characterized in that: A dehumidifying platform (3) for crabs to dehumidify and rest is detachably provided in the breeding basket body (1); the dehumidifying platform (3) is arranged adjacent to the first sewage discharge chamber (21) and its height is between the low water inlet (215) and the high water inlet (216); the dehumidifying platform (3) comprises a platform body and at least two drainage holes arranged on the platform body for drainage; a notch is provided on the platform body to fit the first sewage discharge chamber (21); and a supporting member (14) for supporting the platform body is also provided on the breeding basket body (1); the supporting member (14) is provided with a slot (141) for the platform body to be inserted.

6. The method for cultivating butter crab according to claim 5, characterized in that: The bottom of the breeding basket body (1) is provided with a third water outlet for discharging the sand layer (A) together with the breeding water, and a switch (4) for opening or closing the third water outlet is installed in the third water outlet.

7. The method for cultivating butter crab according to any one of claims 2 to 6, characterized in that: The breeding basket body (1) is also provided with a light source, the light intensity of the light source is 50-300Lx, and the lighting time is 12-18 hours.

8. The method for cultivating butter crab according to claim 7, characterized in that: The breeding basket bodies (1) are arranged vertically and / or horizontally to form a crab breeding system, comprising a main water outlet pipe (51) located at the bottom layer and connected to the first water outlet pipes (11) of the breeding basket bodies (1) at the bottom, a pump body (5) connected to the water outlet end of the main water outlet pipe (51), and a water supply pipe located at the top layer and connected to the pump body (5) for supplying water to the breeding basket bodies (1) at the top. From top to bottom, the first water outlet pipe (11) and / or the second water outlet pipe (12) of the breeding basket bodies (1) at the top are directly connected to the top open portion of the breeding basket bodies (1) at the bottom.

9. A method for screening key genes for the formation of butter crabs, characterized in that: The following steps are included: S1: performing transcriptome sequencing on the ovarian tissues of normal crabs and butter crabs cultured according to the butter crab cultivation method according to any one of claims 1 to 8; S2: In step S1, transcripts are obtained by aligning the transcriptome sequencing results to the reference genome, assembling transcripts, and annotating gene functions; S3: Calculate the FPKM value of the expression of each gene in each sample through the transcript, and calculate the difference in the expression of each gene in the comparison between the normal crab group and the butter crab group to identify the differentially expressed genes; S4: Perform gene enrichment analysis on the differentially expressed genes in step S3 to identify pathways where the differentially expressed genes are significantly enriched; S5: screening the differentially expressed genes in the pathways identified in step S4; S6: Design primers and detect the expression levels of the differentially expressed genes in step S5.

10. The method for screening key genes for the formation of butter crab according to claim 9, characterized in that: The pathway in which the differentially expressed genes are enriched is the regulation of lipolysis in adipocytes. The differentially expressed genes in this pathway include MGL gene, FABP gene and HSL gene. The cDNA sequence of the MGL gene is shown in SEQ ID NO.1; The cDNA sequence of the FABP gene is shown in SEQ ID NO.2; The cDNA sequence of the HSL gene is shown in SEQ ID NO.

3.

11. The method for screening key genes for the formation of butter crab according to claim 9 or 10, characterized in that: The differentially expressed genes also include GS gene, PKG gene, AC gene, β-AR gene, wherein The cDNA sequence of the GS gene is shown in SEQ ID NO.4; The cDNA sequence of the PKG gene is shown in SEQ ID NO.5; The cDNA sequence of the AC gene is shown in SEQ ID NO.6; The cDNA sequence of the β-AR gene is shown in SEQ ID NO.

7.

12. The method for screening key genes for the formation of butter crab according to claim 10, characterized in that: The primers of the MGL gene are: MGL-F: CTGTTCAGAGGCGTGGTTCT, MGL-R: TACCGTGATGTAGGGCAGGA; The primers for the FABP gene are: FABP-F:ACGCTGGATGACGGCACCTA, FABP-R:CGTCCATCAGCAGTGGTCTCCT; The primers for the HSL gene are: HSL-F:AGGCTGTGTGTCCGTGTTCA, HSL-R: AGGACGACCAGTGACGCAAGA.

Images