Arthrobotrys guangdongensis and application of arthrobotrys guangdongensis in prevention and treatment of pine wood nematode disease

Abstract

The invention discloses arthrobotrys guangdongensis and application of the arthrobotrys guangdongensis in prevention and treatment of pine wood nematode diseases. The invention relates to Arthrobotrys guangdonensis 20GD2519A, which is preserved in China General Microbiological Culture Collection Center (CGMCC) on November 15, 2021, the address of the Arthrobotrys guangdonensis is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the postal code is 100101, and the preservation number is CGMCC No.23849. The Arthrobotrys guangdonensis 20GD2519A has the advantages that the Arthrobotrys guangdonensis 20GD2519A can be used for preparing a microbial inoculum; the invention directly aims at pathogenic nematodes, inhibits and kills nematodes, and reduces nematode density. The strain has strong sporulation ability, can maintain good hereditary stability, and still has high fatality rate to pine wood nematodes after continuous subculture. The survival rate of pine trees inoculated with the arthrobotrys guangdongensis suspension in advance can reach 72%.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a Guangdong arthrosporum fungus and application thereof in preventing and controlling pine wood nematode disease. Background Art

[0002] Pine wilt disease, also known as pine wilt disease, is a devastating epidemic caused by the pine wood nematode (Bursaphelenchus xylopilus) and is an internationally recognized dangerous biological disease. It is a complex disease system formed by the interweaving of multiple factors such as pine wood nematodes, host plants, vector insects, associated fungi and bacteria, economic and logistics activities, and environmental factors. Since the first discovery of pine wood nematode disease in Nanjing, Jiangsu in 1982, 702 county-level administrative regions in 19 provinces have become epidemic areas. The rapidly spreading pine wood nematode disease has brought huge losses to my country's forestry economy and ecology. The direct or indirect economic and ecological losses have reached hundreds of billions of yuan, seriously threatening the safety of my country's forestry ecological environment.

[0003] At present, the prevention and control methods of pine wood nematode disease are mainly aimed at vector insects and pathogenic nematodes. During the emergence and mating and egg-laying period of longhorn beetles, the base number of longhorn beetles can be reduced by spraying chemical agents such as cypermethrin, thiacloprid, and Green Weilei II on the ground, high-range spraying vehicles, and aircraft, thereby achieving a control effect. A common physical control method is to place traps before the emergence of pine sawyer beetles to reduce the population of forest sawyer beetles and monitor the density of forest sawyer beetles. In addition, natural enemies are also used to control vector insects. For example, the scleroderma can stabilize the parasitic pine sawyer larvae, and the flower beetle can effectively control the overwintering pine sawyer beetles. The most common control method for pathogenic nematodes is dry injection spraying, among which insecticides such as avermectin and emamectin benzoate have significant control effects.

[0004] The biological control microorganisms of pine wood nematodes mainly include nematode-trapping fungi, endoparasitic fungi, and toxin-producing fungi. Among them, nematode-trapping fungi are an important type of biological control factor, which has great advantages in ecological benefits and is environmentally friendly, efficient, and sustainable. Arthrobotrys is an important group of nematode-trapping fungi. It will spontaneously or induced by nematodes to form specialized predators or fungal nets, which have a process of attracting, contacting, identifying, capturing, killing, and nutrient utilization for nematodes. Arthrobotrys has advantages in biological control: it is easy to cultivate, has a wide host range, and can generally play a long-term role in the environment or in animals and plants. Its application is mainly focused on the prevention and control of plant root-knot nematodes and nematodes in animals. It can effectively control the insect population density and establish a relatively stable biological control system. However, when pine wood nematodes are transferred from the body of longhorn beetles to the body of pine trees, the problem of how to use nematode-trapping fungi such as Arthrobotrys to control pathogenic nematodes remains to be solved.

[0005] Existing prevention and control methods cannot fundamentally curb the spread of pine wood nematode disease. Chemical methods have limited time effectiveness, high spraying costs, and are easy to destroy natural enemy resources; trap monitoring and control have high maintenance costs, frequent replacement of bait cores, and are greatly affected by natural factors; biological methods are unstable and uncertain due to the influence of external environmental and biological factors; toxicological studies have shown that avermectin is highly toxic to some aquatic organisms, bees, etc., and will have an impact on other ecological populations; and avermectin agents are expensive and are currently only used for small-scale forest or precious tree prevention.

[0006] The use of beneficial microorganisms for biological control of pine wood nematodes is an important means at present. The nematode-trapping fungus used in the present invention is Arthrobotrys guangdongensis (sp.nov.), and there is no report on its biological control of pine wood nematodes. Summary of the invention

[0007] The purpose of the present invention is to provide a strain of Kwangtung Articulospore and its application in the prevention and control of pine wood nematode diseases, to provide a new type of biocontrol bacteria for the prevention and control of pine wood nematode diseases, and to explore a long-term, environmentally friendly biological control method directly targeting pathogenic nematodes.

[0008] The Arthrobotrys guangdongensis 20GD2519A of the present invention was deposited in the General Microbiology Center of China Culture Collection Administration (CGMCC) on November 15, 2021, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, and the deposit number is: CGMCC No. 23849.

[0009] The second object of the present invention is to provide a biological preparation containing the above-mentioned Guangdong Arthrosporum 20GD2519A as an active ingredient.

[0010] The third object of the present invention is to provide the use of the above-mentioned Guangdong Arthrospore 20GD2519A or biological agent in controlling pine wood nematodes.

[0011] The fourth object of the present invention is to provide a method for controlling pine wood nematodes, which comprises applying the above-mentioned Guangdong Arthrospore 20GD2519A or biological agent into pine trees to control pine wood nematodes.

[0012] Preferably, the wound on the pine stem is inoculated with a bacterial solution of Artemisia guangdongensis 20GD2519A or its spore solution.

[0013] It is further preferred to use a sterile scalpel to make a 1 cm wound on the stem of the pine seedling at a downward angle of about 80°, fill the wound with sterile cotton to receive the Guangdong joint spore 20GD2519A spore suspension, then access the Guangdong joint spore 20GD2519A suspension, and finally wrap the wound with a sealing film.

[0014] Compared with the prior art, the present invention has the following advantages:

[0015] 1. Environmentally friendly. The strain is of natural origin, environmentally friendly and non-toxic, environmentally friendly and compatible, safe for humans and animals, has little impact on other biological groups, and does not pollute the ecological environment.

[0016] 2. Long-term effect. As a microorganism, the strain can absorb nutrients from the pine tree, can colonize in the pine tree for a long time, and is less affected by the natural environment, so it can exert its prevention and control function for a long time.

[0017] 3. Highly effective prevention and treatment. The present invention directly targets pathogenic nematodes, inhibits and kills nematodes, and reduces nematode density. The strain has a strong spore-producing ability and can maintain good genetic stability. After continuous subculture, the mortality rate to pine wood nematodes is still very high. The survival rate of pine trees that were inoculated with Guangdong knot spore suspension in advance can reach 72%.

[0018] 4. Simple operation. The operation process of culturing the strain and preparing the spore suspension preparation is relatively simple, and the technical requirements for using biological agents to control pine wood nematodes are not high.

[0019] 5. Low cost, suitable for large-scale application. The Guangdong Arthrospora strain used in the present invention can be cultured on a large scale, has low requirements for culture conditions, and can be completed under general laboratory conditions; the biological preparation materials are widely available, the selected materials are low in cost, can be used for large-scale promotion, and have good development and application prospects.

[0020] Arthrobotrys guangdongensis 20GD2519A was deposited in the General Microbiology Center of China Culture Collection Administration (CGMCC) on November 15, 2021, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, and the deposit number is: CGMCC No. 23849. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the morphology of Guangdong Arthrospora fungus. a: front and back of the colony on MEA medium; b, c: three-dimensional sticky bacterial network; df:

[0022] Three-dimensional fungus web entangles pine woodworm; gi: conidiophores and conidia Scale: b, i = 20um; ch = 10um;

[0023] Figure 2 It is the phylogeny of Arthrospora cantonensis;

[0024] Figure 3 It is a pine tree mortality graph;

[0025] Figure 4 This is the survival status of pine trees. Figure a: Control group that was only exposed to sterile water; b: NAg group that was first exposed to pine wood nematodes and then to Cantonese spores; c: AgN group that was first exposed to Cantonese spores and then to pine wood nematodes. DETAILED DESCRIPTION

[0026] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0027] Example 1 Isolation and identification of Arthrosporea guangdongensis

[0028] 1.1 Isolation of strains

[0029] In October 2020, bark, tunnels and blue-discolored wood of Masson pine diseased trees that were damaged by pine wood nematodes and showed signs of wilting or dying were collected in the Qingyunshan Provincial Nature Reserve in Wengyuan. A strain of nematode-trapping fungus 20GD2519A was isolated from the collected materials, inoculated on 2% malt extract agar medium (MEA, 20 g malt extract powder, 20 g agar, 1000 ml distilled water), and cultured in an artificial climate chamber at 25°C in the dark for 7 days.

[0030] 1.2 Identification of strains

[0031] 1.2.1 Morphological identification

[0032] The colony morphology and aerial hyphae of the fungus 20GD2519A grown on MEA medium after purification were observed, and the growth rate of Guangdong Arthrospore 20GD2519A at the optimal temperature was measured. The colonies on MEA medium were fluffy, with dense hyphae, white on both the front and back of the colonies, colorless vegetative hyphae, and moderately separated ( Figure 1 ). Observe the microscopic characteristics of fungi such as conidiophores, conidia, and predatory structures using an electron microscope ( Figure 1 The fungus will produce a large number of specialized hyphae, i.e., a three-dimensional fungal net, and the pine wood nematodes will be attracted, entangled, dissolved, and gradually die by the specialized three-dimensional fungal net ( Figure 1 ).

[0033] 1.2.2 Molecular biological identification

[0034] PrepMan DNA extraction reagent was used to extract genomic DNA from purified Guangdong joint spore 20GD2519A. The experimental strain DNA was used as a template to perform PCR amplification of part of the gene encoding β-tubulin (TUB) using common primers Bt2a (GGTAACCAAATCGGTGCTGCTTTC, forward) and Bt2b (ACCCTCAGTGTAGTGACCCTTGGC, reverse). A 25uL reaction system was used: Taq PCR Master Mix 12.5uL, ddH2O 10.5uL, DNA template 1μL, and primers 0.5μL each. The PCR product was sent to Sangon Biotech Co., Ltd. for sequencing.

[0035] The measured TUB sequence is:

[0036] CACCCTCTTGTATCTTATTATACTTATTCTGGTAGCGTGCATAAAGCTAACATACTCGGCA

[0037] CAGGCAAACCATCTCCAGTACGTTTTAAAGCTTGATCCAAGCTTGGTCTTTGGTATATCTTA

[0038] AGGATTGGCTAACAACCATGTTGCTCTATAGACGAGCACGGCCTCGACGGCGCCGGTGT

[0039] TTACAATGGATCCTCCGACCTCCAACTCGAGAGGATGAACGTACGTCTCATTTACTAAAA

[0040] ATCACTCAAACACGTAGATATAGCTAACATGGTTCCGTCTTAGGTCTACTTCAACGAGGT

[0041] CAGTTCCGTCTAGTTCGCTGCGGATTTCGTAAGCCAGAACAACCCAACCTAACAGACTT

[0042] CAAAACAGGCCTCCCAGAACAAATATGTCCCACGTGCCGTTCTCATCGATCTTGAGCCC

[0043] GGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGTCCAGACAACTTT

[0044] GTCTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTACACTGAGGGTA(SEQ IDNO.1)

[0045] The obtained sequences were compared with BLAST gene sequences on the NCBI website, and similar strain sequences with high homology were found in GenBank. The similarity was calculated 1000 times using the maximum likelihood (ML) method using MEGA7.0 software to construct a phylogenetic tree ( Figure 2 ).

[0046] 1.3 Results Analysis

[0047] Through analysis, it was found that the strain A.guangdongensis (sp.nov.) in the present invention and its closely connected Arthrobotrys polycephala (NR 160072) have a node support rate of 90% supporting the two fungi to branch separately. The two strains of bacteria in the present invention (the two strains are of the same species) are clustered into a separate evolutionary branch with a node support rate of 100. Based on the comprehensive morphological characteristics and phylogenetic analysis, the strain has not been reported and described, and it is identified as a new species belonging to the genus Arthrobotrys. We named it Guangdong Arthrobotrys (Arthrobotrys guangdongensis) 20GD2519A, which was deposited in the General Microbiological Center (CGMCC) of the China Microbiological Culture Collection Administration on November 15, 2021, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, and the deposit number is: CGMCC No.23849.

[0048] Example 2 Outdoor biological control experiment of pine wood nematode with spores of Guangdong

[0049] 2.1 Preparation of the Strain Spore Suspension

[0050] Use a sterile cotton swab to scrape off the Guangdong joint spore 20GD2519A colonies soaked on the substrate surface, add sterile water to rinse the MEA medium covered with colonies, place the centrifuge tube containing the colony suspension on a vortex oscillator and shake it thoroughly for 4 minutes, then filter it through a funnel padded with sterile cotton wool and pour the filtrate into a conical flask and let it stand at 4°C. Finally, transfer an appropriate amount of supernatant according to the concentration to obtain a spore suspension. Adjust the spore concentration to 4*10 by increasing or decreasing the amount of sterile water. 6 U / mL (first stage inoculation) or 7*10 6 U / ml (second stage inoculation).

[0051] 2.2 Preparation of nematode suspension

[0052] Neopestalotiopsis was inoculated into MEA plates and cultured at 25°C for 7 days. Then pine nematodes were inoculated onto plates covered with Neopestalotiopsis and cultured in the dark at 25°C for 7 days. The nematodes on the MEA plates were collected by the Baermann funnel method, and a nematode suspension was obtained after 24 hours. The nematode suspension was centrifuged at 3000rpm / min for 3 minutes, and then the upper liquid was transferred to remove impurities in the suspension. The centrifuge tube was then placed in a refrigerator at 4°C for 3 hours, and the nematode suspension was obtained after transferring an appropriate amount of supernatant. The nematode concentration was adjusted to 5000U / ml (first stage inoculation) or 10000U / ml (second stage inoculation) by increasing or decreasing the amount of sterile water.

[0053] 2.3 Suspension inoculation

[0054] 2.3.1 Phase 1

[0055] The spore suspension of Guangdong Articulospore 20GD2519A was inoculated into 70 pine seedlings. The operation method was as follows: a sterile scalpel was used to make a wound on the stem at an angle of 80 degrees downward with a horizontal depth of about 1 mm, a vertical length of about 1 cm, and a width of about 0.5 cm. The wound was about 9 cm from the soil surface. Then, an appropriate amount of sterile cotton was used to fill the wound to receive the suspension, and then 120 μL of a 4*10 6 U / mL of spore suspension, and finally quickly wrap the wound with parafilm.

[0056] Inoculate the pine wood nematode suspension into 70 pine seedlings, and follow the same procedure as above. Adjust the wound to about 12 cm from the soil surface. Use an appropriate amount of sterile cotton to fill the wound to receive the suspension, then use a pipette to inoculate 120 μL of nematode suspension at a concentration of 5000 U / ml, and finally quickly wrap the wound with a sealing film.

[0057] 2.3.2 Second stage

[0058] After 14 days, 120 μL of 10,000 U / ml nematode suspension was inoculated on each of the 50 pine seedlings that had been inoculated with fungi, with the wound about 12 cm from the soil surface. 6 U / ml spore suspension, the wound was about 9 cm away from the soil surface.

[0059] At the same time, a mechanical injury blank control group was set up, and 120 μL of sterile water was introduced into 20 pine seedlings, with the wound about 9 cm away from the soil surface.

[0060] 2.4 Isolation of fungi and nematodes

[0061] By microscopically examining the wound areas of both completely wilted and dead pine seedlings and those that appeared mostly normal, attempts were made to isolate the Guangdong Arthrospora fungus and pine nematodes again.

[0062] 2.5 Results Analysis

[0063] The outdoor biological control experiment was divided into 5 groups: the AgN group that was first inoculated with P. guangdongensis and then with pine wood nematodes; the NAg group that was first inoculated with pine wood nematodes and then with P. guangdongensis; the Ag group that was only inoculated with P. guangdongensis; the N group that was only inoculated with pine wood nematodes; and the Control group that was only inoculated with sterile water.

[0064] Under the cover of the sealing film, Guangdong Articulospore can successfully colonize the bark of Masson pine seedlings. Firstly inoculating Guangdong Articulospore 20GD2519A can, on the one hand, enhance the vigor of pine seedlings and delay the process of pine wood nematode infection for about one month; on the other hand, it can effectively reduce the mortality of pine seedlings. For example, the mortality of the N group inoculated with pine wood nematodes only reached 85%, the mortality of the NAg group reached 66%, and the final mortality of the pine seedlings in the AgN group inoculated with Articulospore first was 26% ( Figure 3 ). From the survival of pine seedlings, it can be seen that the prevention effect of the AgN group is better than that of the NAg group ( Figure 4 If pine nematodes were introduced first and then P. cantonensis, although the vigor of pine seedlings could be enhanced and the process of pine nematode infection could be delayed, there was no difference in the number of surviving pine seedlings compared with the N group that was only introduced with pine nematodes (α≤0.05).

Claims

1. Arthrobotrys guangdongensis 20GD2519A, deposit number: CGMCC No.23849.

2. A biological agent, characterized in that: The invention contains the Guangdong Arthrospore 20GD2519A or its spores as claimed in claim 1 as an active ingredient.

3. Use of the Guangdong Arthrospore 20GD2519A described in claim 1 or the biological preparation described in claim 2 in controlling pine wood nematodes.

4. A method for controlling pine wood nematodes, characterized in that: The method comprises applying the Guangdong Arthrospore 20GD2519A described in claim 1 or the biological agent described in claim 2 to pine trees to prevent and control pine wood nematodes.

5. The method according to claim 4, characterized in that The method is to inoculate the bacterial liquid or spore liquid of Guangdong Arthralgia 20GD2519A on the wounds of the pine tree stems.

6. The method according to claim 5, characterized in that A sterile scalpel was used to make a 1 cm wound on the stem of the pine seedling at a downward angle of about 80°, and the wound was filled with sterile cotton to receive the Guangdong joint spore 20GD2519A spore suspension, and then the Guangdong joint spore 20GD2519A suspension was connected, and finally the wound was wrapped with a sealing film.

Images