Chinese orchid flowering regulation gene CsFTL3 as well as encoding protein and application thereof

Abstract

The invention discloses a Chinese orchid flowering regulation gene CsFTL3 as well as an encoding protein and application thereof, and belongs to the field of plant molecular biology. The gene CsFTL3 for regulating and controlling flowering of Chinese cymbidium is separated from flower bud cDNA (complementary deoxyribonucleic acid) of a Chinese cymbidium variety 'Xiaoxiang', and 174 amino acids are encoded by the gene CsFTL3. Through construction of an expression vector of the CsFTL3 gene, overexpression in wild-type arabidopsis thaliana and heterologous overexpression of the CsFTL3 gene in the arabidopsis thaliana, it is found that bolting and flowering periods of the arabidopsis thaliana are significantly delayed, flower stems are significantly thickened and increased, the number of rosette leaves is significantly increased, and the growth period is prolonged, which indicates that the gene has the function of delaying the flowering time of the arabidopsis thaliana. The Chinese orchid flowering regulation and control gene can be used for molecular mechanism research of orchid flowering time, delay Chinese orchid flowering time, promote plant vegetative growth, prolong whole Chinese orchid viewing time and promote Chinese orchid genetic improvement and variety breeding.

Description

Technical Field

[0001] The present invention belongs to the field of plant molecular biology, and specifically relates to a flowering regulating gene of Cymbidium sinense CsFTL3 Its encoded protein and applications. Background Art

[0002] Cymbidium orchid is a traditional famous flower in my country with profound cultural heritage and important economic value, and its annual output value exceeds 10 billion yuan. The flowering period is one of the important factors that determine the ornamental value and economic benefits of Cymbidium orchid. However, there is a relative lack of research on the flowering period regulation mode and molecular mechanism of Cymbidium orchid, which seriously restricts the industrial development of Cymbidium orchid.

[0003] Flowering induction is a key step in determining the timing of flowering and is strictly regulated by multiple flowering pathways. In Arabidopsis, there are seven flowering induction pathways, including the photoperiod pathway, vernalization pathway, and autonomous pathway. Among these pathways, Flowering Locus T (FT) is a key integrator in the downstream of the flowering regulatory network. It belongs to the FT-like subfamily of the PEBP gene family, is highly conserved in plants, and is essential for plant flowering. In Arabidopsis, FT The gene is expressed in leaves and transported to the shoot apical meristem (SAM) after binding to the FTIP protein, where it interacts with the transcription factor FD and 14-3-3 protein to form a protein complex that promotes flowering. FT Genes usually have conserved flowering-promoting functions, such as in rice Hd3a ,tomato SFT ,corn ZCN8 etc. However, some FT Homologous genes also have the function of inhibiting flowering. For example, under long-day conditions, overexpression of barley HvFT4 Delays the flowering time of Phalaenopsis PhFT6 Overexpression in Arabidopsis showed the function of inhibiting flowering. Rice OsFTL12 interacts with GF14b and OsFD1 to form a floral inhibition complex, delaying the heading time. In recent years, researchers have also used comparative genomics, epigenetics and other methods to explore the role of OsFTL12 in different plants. FT The conservation and diversity of genes reveal the important role of these genes in plant evolution.

[0004] at present, FT The biological functions of homologous genes in Cymbidium orchids are still largely unknown, and it is impossible to accurately regulate the flowering period of Cymbidium orchids. In addition, the bud development cycle of many Cymbidium orchids is long, which hinders the development of the Cymbidium orchid industry. FTIdentifying homologous genes and analyzing their regulatory role in the flowering of Chinese orchids can provide powerful technical guidance for efficient plant growth and year-round flowering. At the same time, it will also provide excellent genetic resources and theoretical guidance for the precise regulation of the flowering period of orchid plants by molecular breeding using genetic transformation, gene editing and other technologies in the future. Summary of the invention

[0005] In order to overcome the shortcomings and deficiencies of the prior art, the present invention aims to provide a flowering regulating gene for Cymbidium orchids CsFTL3 The encoded protein and its application can delay the flowering time of transgenic plants, increase the growth period, and regulate the flowering period of plants.

[0006] The purpose of the present invention is achieved through the following technical solutions: The first object of the present invention is to provide a flowering regulating gene of Cymbidium sinense—— FTL3 , it is a typical representative of Chinese orchids, black orchid ( Cymbidium sinense ) variety'Xiaoxiang' flower bud cDNA was isolated, and its nucleotide sequence consists of 525 bases, as shown in SEQ ID NO: 1, and was named CsFTL3 .

[0007] The second object of the present invention is to provide a protein encoded by the above-mentioned Cymbidium flowering regulatory gene, which consists of 174 amino acid residues, as shown in SEQ ID NO:2.

[0008] The third object of the present invention is to provide a method comprising the flowering regulating gene of Cymbidium sinense CsFTL3 expression cassette, recombinant expression vector, transgenic cell, recombinant bacteria or transgenic material.

[0009] The starting vector of the expression vector is any binary vector that can be used for Agrobacterium transformation of plants or vector that can be used for plant microprojectile bombardment, such as pBI series vectors, pCAMBIA series vectors, pBin series vectors or other derived plant expression vectors. The present invention uses pOCA30 plasmid.

[0010] The host bacteria of the recombinant bacteria is Agrobacterium; preferably Agrobacterium GV3101.

[0011] A fourth object of the present invention is to provide CsFTL3 Genes, proteins encoded, including CsFTL3 Use of a gene expression cassette, a recombinant expression vector, a transgenic cell, a recombinant bacterium or a transgenic material in at least one of the following (a) to (e): (a) regulating the time of bolting and / or flowering of plants; (b) regulating the number of rosette leaves in plants; (c) regulating plant leaf color; (d) regulating plant flower stem traits; (e) Regulate the vegetative growth phase of plants.

[0012] Preferably, the plant is Arabidopsis thaliana, Cymbidium or the like.

[0013] Preferably, the flower stem traits include thickness, length and / or number.

[0014] Preferably, the application is by overexpression CsFTL3 It is achieved through genes; Specifically, overexpression in plants CsFTL3 After the gene is modified, the flowering time of the plant is delayed, the number of rosette leaves is increased, the leaf color of the plant is deepened, the flower stems are thickened, the flower stems are longer, the number of flower stems is reduced, and the growth period is extended.

[0015] A fifth object of the present invention is to provide a method for delaying plant flowering and / or increasing the number of rosette leaves, and / or extending the vegetative growth stage of a plant, comprising the steps of: CsFTL3 Genes are transformed into plant cells, tissues or organs, and then cultivated into plants, so that the CsFTL3 The gene is expressed in a plant to delay the time of flowering and / or increase the number of rosette leaves, and / or extend the vegetative growth stage of the plant.

[0016] Preferably, the plant is Arabidopsis thaliana, Cymbidium or the like.

[0017] Preferably, the transformation method comprises the inflorescence infection method.

[0018] The present invention uses molecular biological technology to find that the overexpression of the flowering regulatory gene in Arabidopsis thaliana can change the flowering characteristics of the plant and cause delayed flowering, indicating that the gene has the function of delaying the flowering of Arabidopsis thaliana. CsFTL3 The gene and the protein it encodes are used in the study of the regulatory pathways of flowering traits such as the flowering period of Chinese orchids. This can delay the flowering time of Chinese orchids, thereby increasing the flowering and viewing period of the entire Chinese orchid variety, and promote genetic improvement and variety selection of Chinese orchids.

[0019] Compared with the prior art, the present invention has the following advantages and effects: (1) The present invention isolates the key gene controlling flowering from the flower bud cDNA of the Chinese orchid variety 'Xiaoxiang' FTL3 , and named CsFTL3 Analysis of expression patterns in different tissues revealed that CsFTL3 The highest expression was in Cymbidium orchid. CsFTL3 The expression level drops rapidly during the flowering transition period, then remains at a low level until it is highly expressed again when the flower opens, which may play a role in the flowering transition of Cymbidium orchid.

[0020] (2) The present invention constructs CsFTL3 Expression vectors of genes, overexpressed in wild-type Arabidopsis, heterologous overexpression in Arabidopsis CsFTL3 After the gene was introduced, it was found that the bolting and flowering period of Arabidopsis thaliana were significantly delayed, the flower stems were significantly thickened and lengthened, the number of rosette leaves was significantly increased, and the growth period was prolonged, indicating that the gene has the function of delaying the flowering of Arabidopsis thaliana. The flowering regulating gene of Cymbidium chinense of the present invention can be used for the molecular mechanism research of flowering time of orchidaceae plants, delay the flowering time of Cymbidium chinense and promote the vegetative growth of plants, prolong the overall viewing time of Cymbidium chinense, and promote the genetic improvement and variety selection of Cymbidium chinense. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 In Example 1 of the present invention, CsFTL3 Multiple sequence homology alignment.

[0022] Figure 2 In Example 1 of the present invention, CsFTL3 Phylogenetic tree analysis.

[0023] Figure 3 In Example 2 of the present invention, CsFTL3 Analysis of expression patterns in different organs of Cymbidium sinense. Note: A: phenotypes of different organs; B: CsFTL3 Expression analysis chart.

[0024] Figure 4 In Example 2 of the present invention, CsFTL3 Analysis of expression patterns in different flower development stages of Cymbidium sinense. Note: A: FD1-FD9 phenotypes at different flower development stages; B: CsFTL3 Expression analysis chart.

[0025] Figure 5 This is the electrophoresis diagram for identifying positive transgenic plants in Example 3 of the present invention. Note: Line 2-4 represents 3 transgenic lines.

[0026] Figure 6 This is the phenotypic analysis of transgenic Arabidopsis thaliana in Example 3 of the present invention. Note: A: CsFTL3 Late-flowering phenotype of transgenic Arabidopsis; B: Statistics of flowering time of Arabidopsis; C: Statistics of rosette leaves of Arabidopsis. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical scheme and beneficial technical effects of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the embodiments described in this specification are only for explaining the present invention, not for limiting the present invention, and the parameters, proportions, etc. of the embodiments can be selected according to local conditions without substantial impact on the results.

[0028] The pOCA30 plasmid in the embodiment is described in the literature "Liu D, Yu D. MicroRNA (miR396) negatively regulates expression of ceramidase-like genes in Arabidopsis [J]. Progress in Natural Science, 2009, 19(6): 781-785. DOI:10.1016 / j.pnsc.2008.09.006.”

[0029] Example 1 CsFTL3 Gene cloning and sequence analysis 1. RNA Extraction and cDNA Preparation Take about 2g of flower buds of the Molan variety 'Xiaoxiang' and freeze them in liquid nitrogen, grind them with a grinder, and then use the Fastpure Universal Plant Total RNA Isolation Kit to extract the total RNA of the flower buds, and store them in a -80℃ refrigerator for later use. The total RNA extracted above was reverse transcribed to generate cDNA using the HiScript III 1stStrand cDNA Synthesis Kit (+gDNA wiper) of Novezan, and stored in a -20℃ refrigerator.

[0030] 2. Target gene CsFTL3 Acquisition Using PCR primers CsFTL3 -F (ATGTCAGGGAGTTCTTCAAACC) and CsFTL3 -R (TTAAGTGAAGAATCTCCGACCACC), using the flower bud cDNA obtained in step 1 as a template, PCR was performed using the high-fidelity enzyme (2xPhanta Flash Master Mix (Dye Plus)) of Novizan. The PCR reaction system was 50 μl, including 25 μl of high-fidelity enzyme, 2 μl of each primer, 2 μl of cDNA, and ddH 2O to 50 μl. PCR reaction procedure: 95℃ pre-denaturation for 30s; 95℃ denaturation for 10s, 56℃ annealing for 5s, 72℃ extension for 5s, 35 cycles; finally 72℃ thorough extension for 1min. The PCR product was recovered by 1% agarose gel electrophoresis, and then the recovered product was connected to the cloning vector (5minTA / Blunt-ZeroCloningKit) and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the amplified fragment contained the complete CDS sequence of the target gene, consisting of 525 bases. The nucleotide sequence is shown in SEQ ID NO: 1, and it was named the black orchid period regulatory gene CsFTL3 Genes were transformed into CsFTL3 The nucleotide sequence was translated into a protein sequence (the sequence is shown in SEQ ID NO: 2), and the amino acid sequence of the protein encoded by it consisted of 174 amino acid residues, which was named as the black orchid flower period regulatory protein CsFTL3 protein. CsFTL3 The E. coli is currently stored in the Institute of Environmental Horticulture, Guangdong Academy of Agricultural Sciences.

[0031] 3. CsFTL3 Gene sequence analysis The conserved domains of CsFTL3 protein were analyzed through the Conserved Domain Search function of the NCBI database, and it was found that CsFTL3 had a highly conserved PEBP-domain of the PEBP family and a GxHR module, but did not have the conserved sequence DPDxP.

[0032] Molan CsFTL3 Genes were searched for homologous sequences in NCBI, and the amino acid coding sequences were compared using MEGA software ( Figure 1 ), and construct an evolutionary tree ( Figure 2 The results showed that CsFTL3 and yellow flower palatine lip orchid ( Maxillaria aurea )MaFT1a-3 (QLM02171.1) has 90.80% homology with Dendrobium officinale ( Dendrobium catenatum )DcHd3a-like (XP_020703352.1) has 89.66% homology with Phalaenopsis ( Phalaenopsis equestris )PeHd3a-like (XP_020599121.1) has 84.48% homology with orange red Öleran ( Elleanthus aurantiacus ) EaFT1a (QLM02138.1) has 79.65% homology with Crimson Calyx orchid ( Masdevallia coccinea ) McFT1a (QLM02156.1) has 78.41% homology with Dendrobium officinale (Dendrobium catenatum )DcHd3a (XP_020703351.1) has 76.88% homology with Pseudomonas rothenbergii ( Miltoniopsis roezlii ) MrFT1a (QLM02181.1) has 75.86% homology with Vindrinaceae ( Masdevallia wendlandiana ) MwFT1a (QLM02161.1) has 77.58% homology with Shenzhen Pseudo-Orchidaceae ( Apostasia shenzhenica )AsHd3a (PKA64473.1) has 68.97% homology.

[0033] Example 2 CsFTL3 Expression patterns in Cymbidium sinense 1. RNA Extraction and cDNA Preparation About 2 g of samples from different organs (roots, stems, leaves, flowers, fruits) and different flower development stages (FD1-FD9) of the Molan variety 'Xiaoxiang' were quickly frozen in liquid nitrogen, ground with a grinder, and the total RNA of the flower buds was extracted using the Fastpure UniversalPlant Total RNA Isolation Kit from Novezan, and stored in a -80 ℃ refrigerator for later use. The total RNA extracted above was reverse transcribed into cDNA using the Thermo Scientific RevertAid First StrandcDNASynthesis Kit from Thermo Fisher Scientific and stored in a -20 ℃ refrigerator.

[0034] 2. qRT-PCR detection Using forward primer qRT- CsFT L3-F (CTTCGATCAGTCAGTGAGGTT) and reverse primer qRT- CsFTL3 -R (AACACGCAGATCTTCTCCTC), in different tissues and organs and at different flower development stages of Mo Lan CsFTL3 Gene expression was analyzed by qRT-PCR. CsActin -F(GGTGATGTGCTGGATCCTTT) and qRT- CsActin -R (TACTGGATTGGTTGGGCTTG) primer, amplification Actin As an internal reference. qRT-PCR reaction program: 95℃ pre-denaturation for 30s; 95℃ denaturation for 5s, 60℃ annealing for 30s, 40 cycles. Real-time fluorescence quantitative reaction was performed using qTOWER 2.2 fluorescence quantitative PCR instrument from Jena, Germany, and the operation was carried out according to the instructions of Taq Pro Universal SYBR qPCR Master Mix kit.

[0035] 3. Expression Analysis The qRT-PCR results were analyzed and it was found that CsFTL3 The gene was expressed most highly in the flowers of the different organs of Cymbidium sinense, followed by the stems ( Figure 3 ); In different stages of the development of black orchid, CsFTL3 It was highly expressed in the buds from FD1 to FD2, and was lowly expressed at the beginning of the flowering period at FD3. It was not until the petals were fully opened at FD9 that the expression level increased significantly ( Figure 4 ).

[0036] Example 3 CsFTL3 Functional analysis of gene overexpression in Arabidopsis 1. Plant overexpression vector construction The pOCA30 plasmid was double-digested (the restriction site was Sac I and Sal Ⅰ, Takara), recovered and purified to obtain linearized vector; according to the sequence design of double restriction site CsFTL3 Homologous recombination primer pOCA30- CsFTL3 -F ( CTCTCGAGCTTTCGCGAGCTC ATGTCAGGGAGTTCTTCAAACCTT) and pOCA30-Cs FTL3 -R( CTT GCATGCCTGCAGGTCGAC TTAAGTGAAGAATCTCCGACCACC), and the target fragment was recovered and purified. The linearized vector and the target fragment were homologously recombined using the seamless cloning kit (CloneExpress Ultra One Step Cloning Kit). After sequencing verification, the recombinant plasmid was named pOCA30- CsFTL3 , will soon CsFTL3 The gene was inserted into the pOCA30 plasmid.

[0037] 2. Transformation of Arabidopsis thaliana plants 2.1 Agrobacterium transformation Take out competent cells of Agrobacterium GV3101 from -80℃ freezer and thaw on ice, add 200 ng of pOCA30- CsFTL3Plasmid, stand on ice for 5 minutes, liquid nitrogen for 5 minutes, 37℃ water bath for 5 minutes, ice bath for 5 minutes. Then add 700μL LB culture medium without antibiotics to the clean bench and mix well by pipetting, and put it into a shaking incubator at 28℃ and 200rpm for culture. After 1-2 hours, centrifuge (5000rpm, 3 min) to collect bacteria, remove the supernatant in the clean bench, and resuspend the remaining about 100 μL of bacterial solution by pipetting, and transfer 50 μL of bacterial solution to LB solid culture medium plate containing 50 μg / mLSpec+25 μg / mL Rif antibiotics, and culture it upside down in a 28℃ incubator for 2-3 days.

[0038] Pick up the monoclonal bacteria with round growth and put them into LB liquid medium containing 50μg / mLSpec+25μg / mL Rif antibiotics, culture them in a shaker at 28℃ and 200rpm overnight (12-16h), and verify the positive bacteria with PCR. Pipette 1mL of the verified bacterial solution into 50mL LB liquid medium containing 50μg / mLSpec+25μg / mL Rif antibiotics, and culture them in a shaker at 28℃ and 200rpm overnight until the OD value of the bacterial solution reaches 1.0. Centrifuge the bacterial solution at 5000rpm for 5 min to collect the bacteria, and discard the supernatant. Use 5% sucrose solution to shake and mix the bacterial blocks, resuspend the suspension to an OD value of 0.4-0.6, add 0.15% acetosyringone (AS), keep it in the dark for 2-3 hours to activate the bacteria, and finally add 0.015% Silwet-77 to prepare for infection.

[0039] 2.2 Inflorescence infection method to transform wild-type Arabidopsis One day before infection, cut off the siliques and opened flowers on the plants and water the plants thoroughly. Soak the inflorescence of Arabidopsis in the resuspended bacterial solution of Agrobacterium obtained in step 2.1 for 10-15 seconds, ensuring that the bacterial solution fully covers the surface of the inflorescence, and then place the infected plants in a 23-25℃, high humidity environment away from light for more than 16 hours, and then return the plants to the climate box for normal cultivation. Repeat the infection once a week thereafter, for a total of 3 times, to improve the transformation efficiency.

[0040] 2.3 Resistance screening of transgenic Arabidopsis The T0 generation seeds harvested after three times of infection were planted and harvested to obtain T1 generation mustard seeds. The harvested T1 generation Arabidopsis seeds were sown on 1 / 2MS medium containing 50μg / mL Kan resistance, refrigerated at 4 ℃ for 2 days, and moved to an artificial climate box for 10 days before transplanting. Arabidopsis with green leaves and normal root systems on the culture medium (in the culture medium containing Kan antibiotics, only positive plants will show green leaves, while false positive plants will have yellow leaves) were selected and transplanted into the substrate for cultivation, and planted together with wild-type Arabidopsis, and cultured in a climate box under long-day conditions at 22 ℃.

[0041] 3. Phenotypic Analysis of Transgenic Arabidopsis DNA was extracted from leaves of transgenic plants using primers pOCA30-F (TTGGAGAGGACACGCTGAAA) and pOCA30- CsFTL3 -R was used for PCR reaction, and wild-type Arabidopsis thaliana WT was used as a negative control. The PCR products were subjected to agarose gel electrophoresis, and samples with bands of corresponding sizes were identified as positive plants, indicating that the target DNA fragment had been successfully inserted into the plant genome ( Figure 5 ). Each positive plant was harvested and planted to the T3 generation to obtain a stable phenotype. Three transgenic positive lines (Line2, Line3, and Line4) were selected for statistical phenotypic traits. The flowering time was calculated from the date of plant transplantation to the date of bolting 1 cm. The number of rosette leaves was calculated when the flowering period was recorded, and other phenotypes were calculated at the same time.

[0042] The results of the study found that overexpression CsFTL3 The flowering time of transgenic Arabidopsis plants with the gene was about 35 days later than that of wild-type plants on average, and the number of rosette leaves increased by about 21 ( Figure 6 In addition, the transgenic lines all showed characteristics such as darker leaf color, thicker and longer flower stems, and a decrease in the number of flower stems.

[0043] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Cymbidium flowering regulatory protein CsFTL3, characterized by: Its amino acid sequence is shown in SEQ ID NO:

2.

2. A Cymbidium flowering regulation gene encoding the Cymbidium flowering regulation protein CsFTL3 described in claim 1 FTL3 .

3. The flowering regulating gene of Cymbidium sinense according to claim 2 FTL3 , characterized in that: The nucleotide sequence thereof is shown in SEQ ID NO:

1.

4. The biological material related to the flowering regulatory protein CsFTL3 of Cymbidium sinense according to claim 1, characterized in that: Any one or more combinations of the following biological materials: (1) Containing the gene according to claim 2 or 3 FTL3 expression cassette; (2) Containing the gene according to claim 2 or 3 FTL3 A recombinant expression vector; (3) a recombinant expression vector containing the expression cassette described in (1); (4) Containing the gene according to claim 2 or 3 FTL3 Recombinant bacteria; (5) A recombinant bacterium containing the expression cassette described in (1); (6) A recombinant bacterium containing the recombinant expression vector described in (2) or (3); (7) Containing the gene according to claim 2 or 3 FTL3 transgenic cells; (8) A transgenic cell containing the expression cassette described in (1); (9) A transgenic cell containing the recombinant expression vector described in (2) or (3).

5. The flowering regulatory protein CsFTL3 of Cymbidium indica according to claim 1, and the flowering regulatory gene of Cymbidium indica according to any one of claims 2 to 3 FTL3 Or the use of the biomaterial according to claim 4 in at least one of the following (a) to (e), characterized in that: (a) regulating the time of bolting and / or flowering of plants; (b) regulating the number of rosette leaves in plants; (c) regulating plant leaf color; (d) regulating plant flower stem traits; (e) Regulate the vegetative growth phase of plants.

6. The use according to claim 5, characterized in that: The plants are Arabidopsis thaliana and Cymbidium sinense; The flower stem traits include thickness, length and / or number.

7. The use according to claim 5, characterized in that: The application is through overexpression FTL3 It is achieved through genes.

8. The use according to claim 7, characterized in that: Overexpression in plants FTL3 After the gene is modified, the flowering time of the plant is delayed, the number of rosette leaves is increased, the leaf color of the plant is deepened, the flower stems are thickened, the flower stems are longer, the number of flower stems is reduced, and the growth period is extended.

9. A method for delaying flowering of a plant and / or increasing the number of rosette leaves, and / or extending the vegetative growth phase of a plant, characterized in that: The steps include: The flowering regulating gene of Cymbidium sinense according to claim 2 or 3 FTL3 Transformed into plant cells, tissues or organs, and then cultivated into plants, so that the FTL3 The gene is expressed in a plant to delay the time of flowering and / or increase the number of rosette leaves, and / or extend the vegetative growth stage of the plant.

10. The method according to claim 9, characterized in that: The plants are Arabidopsis thaliana and Cymbidium sinense; The transformation method includes the inflorescence infection method.

Images