A method for detecting nucleic acid metabolic enzyme activity

Abstract

The present invention relates to a method for detecting the activity of a nucleic acid metabolic enzyme, and the steps are as follows: S1, artificially synthesizing a single-stranded nucleic acid fragment and a primer complementary to the 3′ end, and forming a template through annealing reaction; S2, reacting and purifying the template, reaction buffer, fluorescently modified nucleotide derivatives or fluorescently modified nucleotide derivative analogs, and the nucleic acid metabolic enzyme to be measured to obtain a primary purified product; S3, reacting and purifying the primary purified product, Taq reaction buffer, dNTP, and Taq DNA polymerase to obtain a secondary purified product; S4, analyzing the secondary purified product with a capillary electrophoresis instrument; S5, making a standard curve, and substituting the results in S4 into the standard curve to obtain the detection result. The invention is quick to operate, has accurate activity detection results, high sensitivity, and realizes high-throughput detection.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a method for detecting nucleic acid metabolic enzyme activity. Background Art

[0002] Nucleic acid metabolism, including DNA and RNA synthesis and degradation, is the basis of all nucleic acid research and related life science research. The standard activity detection method for nucleic acid metabolic enzymes involved in DNA replication and repair is to detect and measure the synthesis or degradation of radioactive or fluorescently labeled nucleic acid substrates by the product of DNA or RNA. For example, the isotope labeling method and the fluorescent dye method (PicoGreen or EvaGreen) combined with DNA are widely used in DNA quantification, and then applied to the activity detection method of nucleic acid metabolic enzymes to measure the synthesis activity or degradation activity of nucleic acid metabolic enzymes. In order to better study the reaction intermediates or by-products, more comprehensively capture the specific steps and details of the reaction pathway, and fully understand the activity of nucleases, polyacrylamide gel electrophoresis (PAGE) is widely used in experimental studies such as the analysis of substrates and the size distribution of intermediates, and further characterizes and standardizes nucleases. However, compared with the aforementioned radioactive or fluorescent labeling method, the analysis method of polyacrylamide gel electrophoresis has the disadvantages of long experimental time, low efficiency and low throughput, which limits the scope of nuclease analysis. Summary of the invention

[0003] In view of the existing deficiencies, the present invention provides a method for detecting nucleic acid metabolic enzyme activity.

[0004] The technical solution adopted by the present invention to solve the technical problem is: a method for detecting the activity of nucleic acid metabolic enzymes, characterized in that the steps are as follows:

[0005] S1, artificially synthesize a single-stranded nucleic acid fragment and a primer complementary to the 3′ end, and form a nucleic acid primer complex through annealing reaction, which is called template;

[0006] S2, adding the template, reaction buffer, fluorescently modified nucleotide derivative or fluorescently modified nucleotide derivative analog, and the nucleic acid metabolic enzyme to be measured into the same PCR tube, reacting in a PCR reactor to obtain an initial product, and performing kit purification on the initial product to obtain a primary purified product; the reaction conditions are a temperature of 45-65° C. and a time of 1 min;

[0007] S3, adding the primary purified product, Taq reaction buffer, dNTP, and Taq DNA polymerase into another PCR tube, reacting in a PCR reactor to obtain a secondary reaction product, and performing kit purification on the secondary reaction product to obtain a secondary purified product;

[0008] S4, analyzing the secondary purified product using a capillary electrophoresis instrument, collecting the separation spectrum and calculating the extension efficiency of the base per unit time;

[0009] S5, preparing a standard curve, substituting the extension efficiency calculated and analyzed in S4 into the standard curve to obtain the activity of the nucleic acid metabolizing enzyme to be measured; wherein the PCR reaction conditions in step S3 are a temperature of 10°C-90°C and a time of 10s-60min.

[0010] Preferably, the template is a single-stranded nucleic acid fragment with a length of 50-150 bp.

[0011] Preferably, the primer is 15-25 bp in length.

[0012] Preferably, the reaction conditions of step S3 are a temperature of 72° C. and a time of 20 min.

[0013] Preferably, the method for preparing the standard curve is as follows: in step S2, the nucleic acid metabolizing enzyme to be measured is replaced by a nucleic acid metabolizing enzyme of known activity diluted into different concentrations according to an activity gradient, and then the initial slopes of various gradient unit activities are obtained through steps S2, S3, and S4 in sequence, and a standard curve is prepared.

[0014] Preferably, in step S2, the nucleic acid metabolizing enzyme to be measured is diluted into nucleic acid metabolizing enzymes of different concentrations according to a concentration gradient, and then each concentration of the nucleic acid metabolizing enzyme is sequentially subjected to steps S2, S3, and S4 to obtain the initial slope of the unit activity of each concentration, and substituted into the standard curve to obtain the relative activity unit.

[0015] Preferably, the capillary electrophoresis analysis is calculated based on the type of fluorescent dye and the peak size of the separation spectrum.

[0016] Preferably, the nucleic acid metabolizing enzyme comprises a high-throughput nucleic acid metabolizing enzyme.

[0017] Preferably, the fluorescently modified nucleotide derivatives and fluorescently modified nucleotide derivative analogs are nucleotide derivatives modified with a protecting group at the 3′ hydroxyl group and carrying a fluorescent labeling group on the base.

[0018] The beneficial effects of the present invention are as follows: the invention is quick to operate, has accurate activity detection results, high sensitivity, realizes high-throughput detection, and can achieve characterization accuracy down to a single nucleotide. In high-throughput capillary electrophoresis, fluorescently labeled nucleic acid substrates, intermediates, and products are separated by size and charge, and / or detected by laser excitation, and the injection of detection samples, gel electrophoresis, and data acquisition processes are all automated, so that 96 samples can be detected in a single experiment within one hour. It is applicable to the detection of all templates with or without fluorescent dyes, and also solves the problems of many operating steps, complex design of multiple fluorescent labels, environmental pollution caused by isotope labeling, and limitation of instrument resolution in the prior art. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is a schematic diagram of the principle of the present invention;

[0020] Figure 2 is the electrophoresis pattern obtained in Example 1 of the present invention; DETAILED DESCRIPTION

[0021] In order to more clearly illustrate the purpose, technical solutions and advantages of the embodiments of the present invention, the present invention will be further described in conjunction with the embodiments below, and a clear and complete description will be given. Obviously, the embodiments described are partial embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the protection scope of the present invention.

[0022] In the present invention, "extension" means connecting the modified nucleotide to the free 3' hydroxyl group of the second nucleotide by forming a phosphodiester bond with the 5' phosphate group of the fluorescently modified nucleotide derivative, and the second nucleotide to which the modified nucleotide is connected usually appears at the 3' end of the polynucleotide chain. "Extension" can be the ability to react with fluorescently modified nucleotide derivatives or analogs at low temperatures and / or within a wider temperature range, in a short time and / or within a wider time range. In the present invention, "extension" can be the ability to react when using a relatively low concentration of fluorescently modified nucleotides or analogs as substrates.

[0023] In the present invention, "fluorescently modified nucleotide derivatives" and "fluorescently modified nucleotide derivative analogs" refer to nucleotide derivatives that have been modified with a protecting group at the 3' sugar hydroxyl group and carry a fluorescent labeling group on the base. Such nucleotide derivatives or analogs can act as chain reaction terminators, making the chain reaction unable to continue after the addition of dNTPs. These terms can be used interchangeably.

[0024] In the present invention, the template is preferably a single-stranded nucleic acid fragment with a length of 99 bp, and the primer length is preferably 16-19 bp; the capillary electrophoresis instrument used is any instrument capable of performing capillary electrophoresis analysis, such as QSEP, CE, etc.; the diluent used to dilute the synthesized primers and template during the reaction can be sterile purified water or 1XTE (pH8.0); the principle of the invention is as follows Figure 1 As shown in Example 1

[0025] Single base extension efficiency determination (capillary electrophoresis determination method),

[0026] Design and synthesis of primers and templates:

[0027] Single-stranded nucleic acid sequence (5′-3′):

[0028] GACCGCGACTCCAGCCCTCTTACACCCAGTGGAGAAGCTCCCAACCAAGCTCTCTTGAGGATCTTGAAGGA AACTGAATTCAAAGTCGTCGCGGGATCA(SEQ ID NO.1)

[0029] Primer sequence (5′-3′):

[0030] TGATCCCGCGACGACT (SEQ ID NO. 2)

[0031] TGATCCCGCGACGACTTT(SEQ ID NO.3)

[0032] TGATCCCGCGACGACTTTG(SEQ ID NO.4)

[0033] TGATCCCGCGACGACTTTGAATT(SEQ ID NO.5)

[0034] It is used to detect the reaction ability of different nucleic acid metabolizing enzymes with different fluorescently modified nucleotide derivatives or analogs. A universal template and one of four different fluorescently labeled nucleotides or analogs are added to the reaction system for extension reaction. The reaction is started by adding the nucleic acid metabolizing enzyme to be detected to the reaction system. Within 1 minute after the reaction is completed, a capillary electrophoresis analyzer is used to analyze the extension of a fluorescently modified base at the 3′ end of the universal template. The extension efficiency per unit time is calculated by calculating the ratio of the fluorescence peak area of ​​the electrophoresis graph, such as Figure 2 As shown in , by changing the concentration gradient of the added nucleic acid metabolizing enzyme, the extension efficiency of the nucleic acid metabolizing enzyme at different concentrations is obtained, and the activity of the nucleic acid metabolizing enzyme can be calculated by substituting it into the standard curve.

[0035] Example 2

[0036] Single base extension error determination (capillary electrophoresis determination)

[0037] Design and synthesis of primers and templates:

[0038] Single-stranded nucleic acid sequence (5′-3′):

[0039] GACCGCGACTCCAGCCCTCTTACACCCAGTGGAGAAGCTCCCAACCAAGCTCTCTTGAGGATCTTGAAGGA AACTGAATTCAAAGTCGTCGCGGGATCA(SEQ ID NO.1)

[0040] Primer sequence (5′-3′):

[0041] TGATCCCGCGACGACT (SEQ ID NO. 2)

[0042] TGATCCCGCGACGACTTT(SEQ ID NO.3)

[0043] TGATCCCGCGACGACTTTG(SEQ ID NO.4)

[0044] TGATCCCGCGACGACTTTGAATT(SEQ ID NO.5)

[0045] It is used to detect the reactivity of different nucleic acid metabolizing enzymes with different fluorescently modified nucleotide derivatives. A universal template and one of four different fluorescently labeled nucleotides (wrong nucleotides that do not match the template) are added to the reaction system for extension reaction. The reaction is initiated by adding the nucleic acid metabolizing enzyme to be detected to the reaction system. After the reaction is completed, a capillary electrophoresis analyzer is used to analyze the extension of a fluorescently modified base at the 3′ end of the universal template within 1 minute. The extension efficiency of the incorporated wrong nucleotide per unit time is calculated by calculating the ratio of the fluorescence peak area of ​​the electrophoresis graph.

[0046] It should be understood that those skilled in the art may make improvements or changes based on the above description, and all such improvements and changes should fall within the scope of protection of the appended claims of the present invention.

[0047] Nucleotide sequence listing

[0048] <110> Shenzhen Mingyi Intelligent Manufacturing Technology Co., Ltd.

[0049] <120> A method for detecting nucleic acid metabolic enzyme activity

[0050] <160> 5

[0051] <210> 1

[0052] <211> 99

[0053] <212> DNA

[0054] <213> Artificial sequence

[0055] <400> 1

[0056] GACCGCGACT CCAGCCCTCT TACACCCAGT GGAGAAGCTC CCAACCAAGC TCTCTTGAGG

[0057] ATCTTGAAGG AAACTGAATT CAAAGTCGTC GCGGGATCA

[0058] <210> 2

[0059] <211> 16

[0060] <212> DNA

[0061] <213> Artificial sequence

[0062] <400> 2

[0063] TGATCCCGCG ACGACT

[0064] <210> 3

[0065] <211> 18

[0066] <212> DNA

[0067] <213> Artificial sequence

[0068] <400> 3

[0069] TGATCCCGCG ACGACTTT

[0070] <210> 4

[0071] <211> 19

[0072] <212> DNA

[0073] <213> Artificial sequence

[0074] <400> 4

[0075] TGATCCCGCG ACGACTTTG

[0076] <210> 5

[0077] <211> twenty three

[0078] <212> DNA

[0079] <213> Artificial sequence

[0080] <400> 5

[0081] TGATCCCGCG ACGACTTTGA ATT <110> Shenzhen Mingyi Intelligent Manufacturing Technology Co., Ltd. <120> A method for detecting nucleic acid metabolic enzyme activity <160> 5 <210> 1 <211> 99 <212> DNA <213> Artificial sequence <400> 1 GACCGCGACT CCAGCCCTCT TACACCCAGT GGAGAAGCTC CCAACCAAGC TCTCTTGAGG ATCTTGAAGG AAACTGAATT CAAAGTCGTC GCGGGATCA <210> 2 <211> 16 <212> DNA <213> Artificial sequence <400> 2 TGATCCCGCG ACGACT <210> 3 <211> 18 <212> DNA <213> Artificial sequence <400> 3 TGATCCCGCG ACGACTTT <210> 4 <211> 19 <212> DNA <213> Artificial sequence <400> 4 TGATCCCGCG ACGACTTTG <210> 5 <211> twenty three <212> DNA <213> Artificial sequence <400> 5 TGATCCCGCG ACGACTTTGA ATT

Claims

1. A method for detecting nucleic acid metabolic enzyme activity, characterized in that The steps are as follows: S1, artificially synthesize a single-stranded nucleic acid fragment and a primer complementary to the 3′ end, and form a nucleic acid primer complex through annealing reaction, which is called template; S2, adding the template, reaction buffer, fluorescently modified nucleotide derivatives or fluorescently modified nucleotide derivative analogs, and the nucleic acid metabolic enzyme to be measured into the same PCR tube, reacting in a PCR reactor to obtain an initial product, and performing kit purification on the initial product to obtain a primary purified product; The reaction conditions are a temperature of 45-65° C. and a reaction time of 1 min. The fluorescently modified nucleotide derivatives and fluorescently modified nucleotide derivative analogs are nucleotide derivatives modified with a protective group at the 3′ hydroxyl group and carrying a fluorescent labeling group on the base. S3, adding the primary purified product, Taq reaction buffer, dNTP, and Taq DNA polymerase into another PCR tube, reacting in a PCR reactor to obtain a secondary reaction product, and performing kit purification on the secondary reaction product to obtain a secondary purified product, the reaction conditions are temperature 72°C, time 20 min; S4, analyzing the secondary purified product using a capillary electrophoresis instrument, collecting the separation spectrum and calculating the extension efficiency of the base per unit time; S5, preparing a standard curve, substituting the extension efficiency analyzed and calculated in S4 into the standard curve to obtain the activity of the nucleic acid metabolizing enzyme to be measured.

2. The method for detecting nucleic acid metabolic enzyme activity according to claim 1, characterized in that : The template is a single-stranded nucleic acid fragment with a fragment length of 50-150 bp.

3. The method for detecting nucleic acid metabolic enzyme activity according to claim 1, characterized in that : The primer length is 15-25 bp.

4. The method for detecting nucleic acid metabolic enzyme activity according to claim 1, characterized in that The method for preparing the standard curve is as follows: in step S2, the nucleic acid metabolizing enzyme to be measured is replaced by a nucleic acid metabolizing enzyme of known activity which is diluted into different concentrations according to an activity gradient, and then the initial slopes of various gradient unit activities are obtained through steps S2, S3, and S4 in sequence, and a standard curve is prepared.

5. The method for detecting nucleic acid metabolic enzyme activity according to claim 1, characterized in that : In the step S2, the nucleic acid metabolizing enzyme to be measured is diluted into nucleic acid metabolizing enzymes of different concentrations according to a concentration gradient, and then each concentration of the nucleic acid metabolizing enzyme is sequentially subjected to steps S2, S3, and S4 to obtain the initial slope of the unit activity of each concentration, and substituted into the standard curve to obtain the relative activity unit.

6. The method for detecting nucleic acid metabolic enzyme activity according to claim 1, characterized in that The capillary electrophoresis analysis is calculated based on the type of fluorescent dye and the peak size of the separation spectrum.

7. The method for detecting nucleic acid metabolic enzyme activity according to claim 1, characterized in that :The nucleic acid metabolizing enzyme includes a high-throughput nucleic acid metabolizing enzyme.

Images