Method for preamplifying multi-target nucleic acid combined with fluorescence quantitative PCR detection

Abstract

The present invention relates to a method for pre-amplifying multiple target nucleic acids combined with fluorescence quantitative PCR detection. The target nucleic acids may be different types of nucleic acids or mixtures of different types of nucleic acids, and the number of target nucleic acids may be greater than 5, 10, 20, 50, 100, or 200. The pre-amplification products are used in the methods of detecting all the target nucleic acids after the pre-amplification by single or multiple fluorescence quantitative PCR multi-holes in the fields of pathogen detection, mutation detection, and drug screening. The method of multiple pre-amplification of multiple target nucleic acids combined with single or multiple fluorescence quantitative PCR detection can selectively amplify multiple targets, with high sensitivity, strong specificity, and low sample consumption. It has application value in the detection, diagnosis, and treatment of diseases.

Description

Technical Field

[0001] The present invention relates to the fields of detection, diagnosis, medicine, bioengineering, etc. Specifically, the present invention relates to a method for pre-amplifying multi-target nucleic acid combined with fluorescence quantitative PCR detection. Background Art

[0002] On the one hand, infectious diseases are caused by RNA (ribonucleic acid) viruses, DNA (deoxyribonucleic acid) viruses, bacteria, fungi and other pathogens. Rapid detection of the type of infectious pathogens is of particular importance for the treatment of critically ill infected patients. It is crucial for doctors to understand the infectious pathogens in a short time, formulate scientific medical plans in time, and select targeted drugs after determining the type of pathogen. It is crucial to save patients' lives and prevent the misuse and abuse of antibiotics. At present, many pathogens are still identified by separation and culture methods, which takes a long time (several days to a week), has low sensitivity and low efficiency, and often delays the treatment time. In recent years, the development of multiplex PCR has achieved the simultaneous detection of multiple types of infectious pathogens in a single tube reaction, which saves specimens very much. However, ordinary multiplex PCR has the problems of difficult and cumbersome optimization of different primers, difficulty in improving the detection flux of target genes, and very demanding reaction conditions and reaction systems. The biggest defect is that it is easy to have non-specific amplification and the amplification efficiency is inconsistent and low due to the mutual influence between primers. Therefore, how to solve these defects of multiplex PCR is particularly important.

[0003] There are existing methods in the prior art for amplifying multiple target nucleic acids and applying them to sequencing platforms, but whether they can be applied on a large scale to fluorescent quantitative PCR platforms remains to be verified.

[0004] Therefore, researching and developing methods for pre-amplifying multi-target nucleic acids combined with fluorescence quantitative PCR detection has great potential application value in the fields of detecting infectious diseases, gene mutations and drug screening. Summary of the invention

[0005] The object of the present invention is to provide a method for pre-amplifying multi-target nucleic acids combined with fluorescence quantitative PCR detection.

[0006] In a first aspect of the present invention, a method for detecting multiple target nucleic acids by multiple pre-amplification combined with fluorescent quantitative PCR is provided, comprising:

[0007] (a) providing a sample to be tested;

[0008] (b) for the sample described in (a), using a first primer pool to perform multiple pre-amplification on the target nucleic acid in the sample in a first reaction system to obtain a pre-amplification reaction mixture; wherein the first primer pool comprises N pairs of primers for pre-amplifying the target nucleic acid, wherein N ≥ 5 (preferably, 5 ≤ N ≤ 500; more preferably, 20 ≤ N ≤ 400);

[0009] (c) for the reaction mixture in the previous step, detecting the target nucleic acid in M ​​detection systems by fluorescence quantitative PCR, wherein M is ≥ 1 (preferably ≥ 5, 10, 20, 50, 100, 200),

[0010] Wherein, M / N=1-50, preferably, M / N=2-20;

[0011] Each detection system contains 1 to 6 target nucleic acids, preferably 2 to 3.

[0012] In another preferred example, the fluorescent quantitative PCR includes single-plex or multiplex PCR.

[0013] In another preferred example, the sample to be detected contains or is suspected of containing the target nucleic acid.

[0014] In another preferred embodiment, the sample to be detected contains S≥5, 10, 20, 50, 100, or 200 types of target nucleic acids.

[0015] In another preferred embodiment, N is ≥5, 10, 20, 50, 100, or 200.

[0016] In another preferred embodiment, the target nucleic acid is derived from a pathogen or a protein mutant.

[0017] In another preferred embodiment, the target nucleic acid is selected from the following group: single-stranded DNA, double-stranded DNA, cDNA, RNA, or a combination thereof.

[0018] In another preferred embodiment, the target nucleic acid includes a wild type or a mutant type.

[0019] In another preferred embodiment, the pathogen is selected from the following group: RNA virus, DNA virus, bacteria, fungus, or a combination thereof.

[0020] In another preferred embodiment, the DNA virus is selected from the group consisting of adenovirus, Chlamydia pneumoniae, Mycoplasma pneumoniae, Bordetella pertussis, Streptococcus pneumoniae, Haemophilus influenzae, Klebsiella pneumoniae, Moraxella catarrhalis and Mycobacterium tuberculosis, or a combination thereof.

[0021] In another preferred embodiment, the RNA virus is selected from the group consisting of metapneumovirus, rhinovirus, influenza A virus H1N1, parainfluenza virus 1, parainfluenza virus 2, parainfluenza virus 3, human coronavirus HCoV-HKU1, human coronavirus HCoV-OC43, human coronavirus HCoV-NL63 and human coronavirus HCoV-229E, or a combination thereof.

[0022] In another preferred embodiment, the protein mutant is an EGFR mutation, and the EGFR mutation is selected from the following group: c.2573T>G (p.L858R), c.2582T>A (p.L861Q), c.2369C>T (p.T790M), c.2303G>T (p.S768I), c.2240_2254del15 (p.L747_T751delLREAT), c.2237_2251del15 (p.E746_T751>A), c.2240_2257del18 (p.L747_P753>S), c.2239_2248TTAA GAGAAG>C(p.L747_A750>P), c.2237_2255>T(p.E746_S752>V), c.2236_2250del15(p.E746_A750delELREA), c.2235_2249del15(p.E746_A750delELREA), c.2300_2308dup(p.A767_V769dup), or a combination thereof.

[0023] In another preferred embodiment, the pre-amplification is performed in one reaction system.

[0024] In another preferred embodiment, step (b) and step (c) are carried out in the same reaction system.

[0025] In another preferred embodiment, the primer pairs for pre-amplifying the target nucleic acid independently and complementary bind to different target nucleic acids or different sequences in the same target nucleic acid.

[0026] In another preferred embodiment, the first reaction system comprises:

[0027] (i) a nucleic acid sample containing or suspected of containing the target nucleic acid;

[0028] (ii) a first primer pool comprising at least 5, 10, 20, 50, 100, 200 or more primer pairs for different pre-amplified target nucleic acids, wherein at least one primer of each primer pair is complementary to a portion of the target nucleic acid, and each primer pair has at least one blocking primer comprising a blocking group capable of blocking polymerase extension;

[0029] (iii) a first nucleic acid polymerase and a first buffer;

[0030] (iv) a deblocking agent, which enables the target nucleic acid to be polymerized by the nucleic acid polymerase through the blocking primer.

[0031] In another preferred embodiment, the pre-amplification is performed for 10-15 cycles, preferably, for 11-13 cycles.

[0032] In another preferred embodiment, the blocking group is located at the 3' end of each blocking primer.

[0033] In another preferred embodiment, the blocking group is selected from the following group: 2′, 3′-dideoxynucleotide, ribonucleotide residue, 2′, 3′SH nucleotide or 2′-O-PO3 nucleotide.

[0034] In another preferred embodiment, the blocking primer is further modified to reduce the amplification of unwanted nucleic acid.

[0035] In another preferred example, the modification is the introduction of at least one mismatched nucleotide into the primer.

[0036] In another preferred example, the mismatched nucleotide is 2-18 bp away from the nucleotide having the blocking group.

[0037] In another preferred embodiment, the mismatched nucleotide base is located at the 5' side of the nucleotide having the blocking group.

[0038] In another preferred embodiment, the length of each primer in the primer pair for pre-amplifying the target nucleic acid is independently 8 to 100 nucleotides; preferably, 8 to 80 nucleotides; preferably, 8 to 60 nucleotides; more preferably, 8 to 40 nucleotides; and most preferably, 8 to 20 nucleotides.

[0039] In another preferred embodiment, the deblocking agent is CS5 DNA polymerase, ampliTaq or KlenTaq polymerase with F667Y mutation, pyrophosphate or RNase H2, and the CS5 DNA polymerase has a mutation selected from G46E, L329A, Q601R, D640G, 1669F, S671F, E678G or a combination thereof.

[0040] In another preferred embodiment, nucleic acids other than the target nucleic acid in the sample are substantially not amplified in step (b), that is, no other non-specific amplification products are generated except for the amplification of the target nucleic acid.

[0041] In another preferred example, the first primer pool contains 10-50 pairs of primer pairs for pre-amplifying target nucleic acid.

[0042] In another preferred embodiment, each primer in the first primer pool is a blocking primer, the blocking group is located at the 3′ end of each blocking primer, and the blocking group is 2′, 3′-dideoxynucleotide.

[0043] In another preferred embodiment, the first primer pool comprises primer pairs selected from the following Table A:

[0044] Table A

[0045] name Upstream primer Downstream primer Pathogens Primer pair 1 SEQ ID NO.1 SEQ ID NO.2 Metapneumovirus Primer pair 2 SEQ ID NO.3 SEQ ID NO.4 Rhinovirus Primer pair 3 SEQ ID NO.5 SEQ ID NO.6 Influenza A virus H1N1 Primer pair 4 SEQ ID NO.7 SEQ ID NO.8 Parainfluenza virus 1 Primer pair 5 SEQ ID NO.9 SEQ ID NO.10 Parainfluenza virus 2 Primer pair 6 SEQ ID NO.11 SEQ ID NO.12 Parainfluenza virus 3 Primer pair 7 SEQ ID NO.13 SEQ ID NO.14 Human coronavirus HCoV-HKU1 Primer pair 8 SEQ ID NO.15 SEQ ID NO.16 Human coronavirus HCoV-OC43 Primer pair 9 SEQ ID NO.17 SEQ ID NO.18 Human coronavirus HCoV-NL63 Primer pair 10 SEQ ID NO.19 SEQ ID NO.20 Human coronavirus HCoV-229E Primer pair 11 SEQ ID NO.21 SEQ ID NO.22 Adenovirus group B Primer pair 12 SEQ ID NO.23 SEQ ID NO.24 Adenovirus group C Primer pair 13 SEQ ID NO.25 SEQ ID NO.26 Adenovirus group E Primer pair 14 SEQ ID NO.27 SEQ ID NO.28 Chlamydia pneumoniae Primer pair 15 SEQ ID NO.29 SEQ ID NO.30 Mycoplasma pneumoniae Primer pair 16 SEQ ID NO.31 SEQ ID NO.32 Bordetella pertussis Primer pair 17 SEQ ID NO.33 SEQ ID NO.34 Haemophilus influenzae Primer pair 18 SEQ ID NO.35 SEQ ID NO.36 Moraxella catarrhalis Primer pair 19 SEQ ID NO.37 SEQ ID NO.38 Streptococcus pneumoniae Primer pair 20 SEQ ID NO.39 SEQ ID NO.40 Klebsiella pneumoniae Primer pair 21 SEQ ID NO.41 SEQ ID NO.42 Mycobacterium tuberculosis

[0046] In another preferred embodiment, the detection system comprises:

[0047] (i) comprising the pre-amplification reaction mixture of step (b);

[0048] (ii) a second primer pool, comprising primer sets for L different target nucleic acids, wherein each target nucleic acid independently corresponds to a primer set, wherein the primer set comprises a primer pair and a probe for fluorescent PCR to be used together, wherein the primer pair and the probe for fluorescent PCR are independently complementary to or identical to a partial sequence of the target nucleic acid;

[0049] (iii) a second nucleic acid polymerase and a second buffer.

[0050] In another preferred embodiment, L is ≥5, 10, 20, 50, 100, or 200.

[0051] In another preferred embodiment, the structure (5′-3′) of the probe is as shown in Formula I:

[0052] Z1-Z2-Z3 I

[0053] in,

[0054] Z1 is a fluorescent group;

[0055] Z2 is a specific complementary nucleic acid sequence;

[0056] Z3 is a quenching group;

[0057] “-” is a chemical bond, a linker, or a linker consisting of 1-3 nucleotides.

[0058] In another preferred embodiment, the fluorescent group is selected from the following group: FAM, VIC, JOE, NED, TET, HEX, TAMRA, ROX, TEXASRED, CY3, CY5, CY5.5, and CY7.

[0059] In another preferred embodiment, the quenching group is selected from BHQ1, BHQ2, BHQ3, Dabcyl, MGB or TAMARA.

[0060] In another preferred embodiment, the second primer pool includes primer pairs and probes for fluorescent PCR selected from the following Table B:

[0061] Table B

[0062]

[0063] In another preferred embodiment, the first primer pool comprises primer pairs for pre-amplifying target nucleic acids for pre-amplifying 12 mutation sites of EGFR in one reaction system, wherein each primer is a blocking primer, the blocking group is located at the 3′ end of each blocking primer, and the blocking group is 2′, 3′-dideoxynucleotide.

[0064] In another preferred embodiment, the primer pair for pre-amplifying the target nucleic acid includes a primer pair selected from the following Table C:

[0065] Table C

[0066] name Upstream primer Downstream primer EGFR mutation Primer pair 1 SEQ ID NO.106 SEQ ID NO.107 p.L858R Primer pair 2 SEQ ID NO.108 SEQ ID NO.109 p.L861Q Primer pair 3 SEQ ID NO.110 SEQ ID NO.111 p.T790M Primer pair 4 SEQ ID NO.112 SEQ ID NO.113 p.S768I Primer pair 5 SEQ ID NO.114 SEQ ID NO.115 p.L747_T751delLREAT Primer pair 6 SEQ ID NO.116 SEQ ID NO.117 p.E746_T751>A Primer pair 7 SEQ ID NO.118 SEQ ID NO.119 p.L747_P753>S Primer pair 8 SEQ ID NO.120 SEQ ID NO.121 p.L747_A750>P Primer pair 9 SEQ ID NO.122 SEQ ID NO.123 p.E746_S752>V Primer pair 10 SEQ ID NO.124 SEQ ID NO.125 p.E746_A750delELREA Primer pair 11 SEQ ID NO.126 SEQ ID NO.127 p.E746_A750delELREA Primer pair 12 SEQ ID NO.128 SEQ ID NO.129 p.A767_V769dup

[0067] In another preferred embodiment, the second primer pool includes primer pairs and probes for fluorescent PCR selected from the following Table D:

[0068] Table D

[0069]

[0070] In another preferred embodiment, the minimum detection limit of the method is 2.5 copies / μL, preferably, 1.25 copies / μL.

[0071] In another preferred embodiment, the method is a non-diagnostic and non-therapeutic method.

[0072] In a second aspect of the present invention, a detection reagent for detecting a pathogen target nucleic acid is provided, wherein the detection reagent comprises a set of specific primer pairs, and the primer pair set is a primer pair selected from Table A.

[0073] In another preferred embodiment, the primer pair set comprises 21 pairs of primers shown as primer pairs 1-21 in Table A.

[0074] In another preferred embodiment, the specific primer pair set is used to pre-amplify pathogen target nucleic acid.

[0075] In another preferred embodiment, the detection reagent also includes a specific primer pair set and a probe for fluorescent quantitative PCR detection.

[0076] In another preferred example, the specific primer pair set and probe for fluorescent quantitative PCR detection include primer pairs and probes selected from Table B.

[0077] In another preferred embodiment, the pathogen is selected from the following group: RNA virus, DNA virus, bacteria, fungus, or a combination thereof.

[0078] In another preferred embodiment, the DNA virus is selected from the group consisting of adenovirus, Chlamydia pneumoniae, Mycoplasma pneumoniae, Bordetella pertussis, Streptococcus pneumoniae, Haemophilus influenzae, Klebsiella pneumoniae, Moraxella catarrhalis and Mycobacterium tuberculosis, or a combination thereof.

[0079] In another preferred embodiment, the RNA virus is selected from the group consisting of metapneumovirus, rhinovirus, influenza A virus H1N1, parainfluenza virus 1, parainfluenza virus 2, parainfluenza virus 3, human coronavirus HCoV-HKU1, human coronavirus HCoV-OC43, human coronavirus HCoV-NL63 and human coronavirus HCoV-229E, or a combination thereof.

[0080] In the third aspect of the present invention, there is provided a use of the detection reagent according to the second aspect of the present invention, wherein the reagent

[0081] (a) a kit for preparing a kit for detecting a pathogen target nucleic acid; or

[0082] (b) A kit for preparing a target nucleic acid for detecting EGFR protein mutations.

[0083] In a fourth aspect of the present invention, a kit for (a) detecting a pathogen target nucleic acid; or (b) detecting an EGFR protein mutation target nucleic acid is provided, the kit comprising:

[0084] A container A and a set of primer pairs for pre-amplifying a target nucleic acid located in the container; and / or

[0085] A container B and a specific primer pair set and probe for fluorescent quantitative PCR detection located in the container; and instructions for use.

[0086] In another preferred example, the primer pair set for pre-amplifying target nucleic acids comprises 3-50 primer pairs for specific pre-amplification of multiple target nucleic acids.

[0087] In another preferred embodiment, the kit for detecting pathogen target nucleic acid comprises:

[0088] A container A and a set of primer pairs for pre-amplifying a target nucleic acid located in the container, wherein the set of primer pairs for pre-amplifying a target nucleic acid comprises a primer pair selected from Table A; and / or

[0089] A container B and a specific primer pair set and probe for fluorescence quantitative PCR detection located in the container, wherein the primer pair set and the matching probe for fluorescence quantitative PCR include primer pairs and probes selected from Table B; and instructions for use.

[0090] In another preferred embodiment, the kit for detecting EGFR protein mutation target nucleic acid comprises:

[0091] a container A and a set of primer pairs for preamplifying a target nucleic acid located in the container, wherein the set of primer pairs for preamplifying a target nucleic acid comprises a primer pair selected from Table C; and / or

[0092] A container B and a specific primer pair set and probe for fluorescence quantitative PCR detection located in the container, wherein the primer pair set and matching probe for fluorescence quantitative PCR include primer pairs and probes selected from Table D; and instructions for use.

[0093] In another preferred embodiment, the container A and the container B are the same container.

[0094] In another preferred embodiment, the container B includes a plurality of reaction tubes, and each reaction tube contains 1 to 6 primer pairs and probes in the amounts required for one fluorescence quantitative PCR reaction.

[0095] In another preferred embodiment, the target nucleic acid is selected from the following group: single-stranded DNA, double-stranded DNA, cDNA, RNA, or a combination thereof.

[0096] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0097] Figure 1 The results of the fluorescent quantitative PCR of the method of the present invention for detecting 9 DNA pathogens; wherein, Figure 1 AK showed the test results of adenovirus group B and negative, adenovirus group C and negative, adenovirus group E and negative, Chlamydia pneumoniae and negative, Mycoplasma pneumoniae and negative, Bordetella pertussis and negative, Streptococcus pneumoniae and negative, Haemophilus influenzae and negative, Klebsiella pneumoniae and negative, Moraxella catarrhalis and negative, and Mycobacterium tuberculosis and negative, respectively.

[0098] Figure 2 The results of the fluorescent quantitative PCR of the method of the present invention for detecting 10 kinds of RNA viruses; wherein, Figure 2 AJ shows the test results of metapneumovirus and negative, rhinovirus and negative, influenza A virus H1N1 and negative, parainfluenza virus 1 and negative, parainfluenza virus 2 and negative, parainfluenza virus 3 and negative, human coronavirus HCoV-HKU1 and negative, human coronavirus HCoV-OC43 and negative, human coronavirus HCoV-NL63 and negative, and human coronavirus HCoV-229E and negative, respectively.

[0099] Figure 3 Results of fluorescence quantitative multiplex PCR detection of 6 RNA pathogens; among them, Figure 3 A shows the results of fluorescent quantitative multiplex PCR detection of human coronavirus HCoV-OC43, human coronavirus HCoV-NL63, and human coronavirus HCoV-229E and negative results; Figure 3B shows the results of fluorescence quantitative multiplex PCR for the detection of rhinovirus, metapneumovirus and parainfluenza virus 1 and negative results.

[0100] Figure 4 The results of fluorescence quantitative multiplex PCR detection of 12 EGFR mutations; among them, Figure 4 A-4L Display:

[0101] Among human EGFR mutations, p.L858R mutant, wild type and negative, among human EGFR mutations, p.L861Q mutant, wild type and negative, among human EGFR mutations, p.T790M mutant, wild type and negative, among human EGFR mutations, p.S768I mutant, wild type and negative, among human EGFR mutations, p.L747_T751delLREAT mutant, wild type and negative, among human EGFR mutations, p.E746_T751>A mutant, wild type and negative, among human EGFR mutations, p.L747_P75 3>S mutant, wild type and negative, p.L747_A750>P mutant, wild type and negative in human EGFR mutation, p.E746_S752>V mutant, wild type and negative in human EGFR mutation, p.E746_A750delELREA mutant, wild type and negative in human EGFR mutation, p.E746_A750delELREA mutant, wild type and negative in human EGFR mutation, and p.A767_V769dup mutant, wild type and negative in human EGFR mutation. DETAILED DESCRIPTION

[0102] The inventors have conducted extensive and in-depth research and, through a large number of screenings, have provided a method for multiple pre-amplification of multiple target nucleic acids for use in fluorescent quantitative PCR detection. The inventors have optimized the pre-amplification primers to obtain a specific primer pair set, which can efficiently and specifically amplify different types of target nucleic acids in the sample during the pre-amplification stage. Specifically, in the pre-amplification step, a sample containing RNA target nucleic acid, DNA target nucleic acid or a mixed target nucleic acid containing DNA and RNA is amplified using multiple pairs of pre-amplification primers for target nucleic acids in one tube, wherein the number of target nucleic acids can be greater than 5, 10, 20, 50, 100, 200. The amplification product with increased target nucleic acid abundance obtained after a tube of multiple pre-amplification is combined with a single or multiple fluorescent quantitative PCR multi-well detection of the target nucleic acid in the pre-amplification product, wherein the number of reaction wells of the fluorescent quantitative PCR is greater than 5, 10, 20, 50, 100, 200 or even more wells. The one-tube multiple pre-amplification of different types of target genes of the present invention will not produce cross reactions, which solves the problem of non-specific reactions that are prone to occur in multiple PCR reactions, has good specificity and very high sensitivity, and can reach 1.25 copies / μL. The present invention has been completed on this basis.

[0103] The method of combining multiple pre-amplification with fluorescence quantitative PCR to detect multiple target nucleic acids of the present invention verifies the feasibility of multiple pre-amplification of multiple target nucleic acids for fluorescence quantitative PCR detection, and tests one tube of multiple pre-amplification products for single fluorescence quantitative PCR and multiple fluorescence quantitative PCR detection. One tube of pre-amplification products is sufficient for hundreds or even more wells of fluorescence quantitative PCR detection reactions, realizing the detection of medium and high throughput target genes.

[0104] the term

[0105] The term "multiplex pre-amplification" refers to the use of multiple pairs of specific primers to simultaneously amplify multiple target genes in one PCR reaction. In the present invention, the multiplex generally refers to ≥5-plex, preferably 20-400-plex, and more preferably 20-400-plex.

[0106] As used herein, "multiple pre-amplification of multiple target nucleic acids combined with single or multiplex fluorescent quantitative PCR detection" and "pre-amplification of multiple target nucleic acids combined with fluorescent quantitative PCR detection" can be used interchangeably, both referring to the method for detecting target nucleic acids described in the first aspect of the present invention.

[0107] Detection reagents and primers

[0108] The present invention provides a detection reagent for detecting a pathogen target nucleic acid, wherein the detection reagent comprises a specific primer pair set, wherein the primer pair set comprises 1-21 pairs of primers, and the sequences of the primers are shown in Table A below:

[0109] Table A

[0110]

[0111]

[0112] The primer pairs in Table A were used to preamplify pathogen target nucleic acids.

[0113] In addition, the detection reagent also includes a specific primer pair set and a probe for fluorescent quantitative PCR detection, and the specific primer pair set and the probe for fluorescent quantitative PCR detection include primer pairs and probes selected from Table B.

[0114] Table B

[0115]

[0116] In some embodiments of the present invention, the RNA of the pathogen is preamplified by reverse transcription of a primer pair to increase the abundance of the target nucleic acid, wherein the sequence of the primer pair is shown in Table 1, each primer pair contains two primers and can selectively hybridize with the target nucleic acid, and the primer has a dideoxynucleoside termination (blocking group) at its 3' end. Each primer has a sequence as shown in Table 1 below from 5'-3'.

[0117] Table 1. Primers for multiplex preamplification of pathogen RNA

[0118]

[0119]

[0120] Among them, the primer pair 1 specifically amplifies metapneumovirus; the primer pair 2 specifically amplifies rhinovirus; the primer pair 3 specifically amplifies influenza A virus H1N1; the primer pair 4 specifically amplifies parainfluenza virus 1; the primer pair 5 specifically amplifies parainfluenza virus 2; the primer pair 6 specifically amplifies parainfluenza virus 3; the primer pair 7 specifically amplifies human coronavirus HCoV-HKU1; the primer pair 8 specifically amplifies human coronavirus HCoV-OC43; the primer pair 9 specifically amplifies human coronavirus HCoV-NL63; and the primer pair 10 specifically amplifies human coronavirus HCoV-229E.

[0121] In some embodiments, the abundance of the target nucleic acid is first increased by multiple pre-amplification of the pathogen's DNA, wherein the sequences of the primer pairs are as shown in Table 2, each primer pair contains two primers and can selectively hybridize with the target nucleic acid, and the primers have a dideoxynucleoside termination at their 3′ ends.

[0122] Table 2. Primer pairs for multiplex preamplification of pathogen DNA

[0123]

[0124]

[0125] In some embodiments, fluorescent quantitative PCR detects the product of pre-amplified pathogen RNA, wherein the sequence of the primer set is as shown in Table 3, consisting of a pair of primer pairs and a probe, each primer pair contains two primers and can selectively hybridize with the target nucleic acid, and the probe has a fluorescent group at its 5' end and a quenching group at the 3' end, wherein, in addition to the fluorescent group FAM in Table 3, the fluorescent group can also be selected from VIC, JOE, NED, TET, HEX, TAMRA, ROX, TEXASRED, CY3, CY5, CY5.5, CY7; in addition to the quenching group BHQ1 in Table 3, the quenching group can also be selected from BHQ2, BHQ3, MGB or TAMARA:

[0126] Table 3. Primers and probes for quantitative PCR detection of RNA pathogens

[0127]

[0128]

[0129] In some embodiments, fluorescent quantitative PCR detects the product of pre-amplified pathogen DNA, wherein the sequence of the primer set is as shown in Table 4, consisting of a pair of primer pairs and a probe, each primer pair contains two primers and can selectively hybridize with the target nucleic acid, and the probe has a fluorescent group at its 5' end and a quenching group at its 3' end, wherein, in addition to the fluorescent group FAM listed in Table 4, the fluorescent group can also be selected from VIC, JOE, NED, TET, HEX, TAMRA, ROX, TEXASRED, CY3, CY5, CY5.5, CY7; in addition to the quenching group BHQ1 listed in Table 4, the quenching group can also be selected from BHQ2, BHQ3, MGB or TAMARA.

[0130] Table 4. Primers and probes for fluorescent quantitative PCR detection of DNA pathogens

[0131]

[0132]

[0133] Kit and its application

[0134] The present invention also provides a kit for (a) detecting a pathogen target nucleic acid; or (b) detecting an EGFR protein mutation target nucleic acid, the kit comprising:

[0135] A container A and a set of primer pairs for pre-amplifying a target nucleic acid located in the container; and / or

[0136] A second container B and a primer pair set and a matching probe for fluorescent quantitative PCR located in the container; and

[0137] Instructions for use.

[0138] In another preferred embodiment, the container A and the container B are the same container.

[0139] In another preferred example, the primer pair set for pre-amplifying target nucleic acids comprises 3-50 primer pairs for specific pre-amplification of multiple target nucleic acids.

[0140] In another preferred embodiment, the target nucleic acid is selected from the following group: single-stranded DNA, double-stranded DNA, cDNA, RNA, or a combination thereof.

[0141] When the kit is used to detect pathogen target nucleic acid, the primer pair set for pre-amplifying the target nucleic acid includes primer pairs selected from Table A, and / or the primer pair set and matching probes for fluorescent quantitative PCR include primer pairs and probes selected from Table B.

[0142] When the kit is used to detect EGFR protein mutant target nucleic acid, the primer pair set for pre-amplifying the target nucleic acid includes primer pairs selected from Table C, and / or the primer pair set and matching probes for fluorescent quantitative PCR include primer pairs and probes selected from Table D.

[0143] In another preferred embodiment, the container A and the container B are the same container.

[0144] Detection method of the present invention

[0145] In a first aspect, the present invention provides a method for pre-amplifying DNA multi-target nucleic acid combined with fluorescent quantitative PCR detection, wherein the method comprises:

[0146] (a) When preamplifying multiple DNA target nucleic acids simultaneously in one tube, providing a reaction mixture, the reaction mixture comprising:

[0147] (i) a DNA nucleic acid sample containing or suspected of containing the multiple target nucleic acids;

[0148] (ii) the primer pool comprises at least 5 pairs of primers for different target nucleic acid types, wherein at least one primer of each target nucleic acid primer pair is complementary to a portion of the target nucleic acid, and each primer pair has at least one blocking primer, wherein the blocking primer comprises a blocking group capable of blocking polymerase extension;

[0149] (iii) nucleic acid polymerase and buffer;

[0150] (iv) a deblocking agent, which enables the target nucleic acid to be polymerized by the nucleic acid polymerase through the blocking primer;

[0151] (v) the reaction conditions of the reaction mixture for pre-amplification of the target nucleic acid.

[0152] (b) When using fluorescent quantitative PCR for single or multiplex detection of target nucleic acid in the pre-amplification product, a reaction mixture is provided, the reaction mixture comprising:

[0153] (i) comprising (a) nucleic acid products after pre-amplification of multiple target nucleic acids;

[0154] (ii) the primer pool comprises at least one primer set for different target nucleic acid types, each target nucleic acid corresponds to a primer set, the primer set comprises a primer pair and a probe, wherein each primer pair and probe are complementary to or identical to the sequence of the target nucleic acid;

[0155] (iii) nucleic acid polymerase and buffer;

[0156] (iv) the reaction conditions of the reaction mixture for detecting the target nucleic acid by fluorescent quantitative PCR.

[0157] In some embodiments, the multi-target nucleic acid is a single-stranded or double-stranded DNA. In some embodiments, the blocking group is located at the 3' end of each blocking primer, and the blocking group is a 2', 3'-dideoxynucleotide. In some embodiments, the modification is to introduce at least one mismatched nucleotide in the primer. In some embodiments, the method is used for selective enrichment of mutant nucleic acids in a sample, and the sample comprises a wild-type nucleic acid. In some embodiments, the reaction mixture comprises at least 11 or more different types of primer pairs. In some embodiments, the length of each of the primers is 8 to 100 nucleotides. In some embodiments, the different types of primer pairs can complementarily bind to different target nucleic acids or different sequences in the same target nucleic acid. In some embodiments, the deblocking agent is ampliTaq or KlenTaq polymerase, pyrophosphate or RNase H2 with a F667Y mutation.

[0158] In a second aspect, the present invention provides a method for pre-amplifying RNA multi-target nucleic acid combined with fluorescent quantitative PCR detection, wherein the method comprises:

[0159] (a) When preamplifying multiple RNA target nucleic acids simultaneously in one tube, providing a reaction mixture, the reaction mixture comprises:

[0160] (i) an RNA nucleic acid sample containing or suspected of containing the multiple target nucleic acids;

[0161] (ii) the primer pool comprises at least 5 or more primer pairs of different target nucleic acid types, wherein at least one primer of each target nucleic acid primer pair is complementary to a portion of the target nucleic acid, and each primer pair has at least one blocking primer, wherein the blocking primer comprises a blocking group capable of blocking polymerase extension;

[0162] (iii) nucleic acid polymerase and buffer;

[0163] (iv) a deblocking agent, which enables the target nucleic acid to be polymerized by the nucleic acid polymerase through the blocking primer;

[0164] (v) the reaction conditions of the reaction mixture for pre-amplification of the target nucleic acid.

[0165] (b) When using fluorescent quantitative PCR for single or multiplex detection of target nucleic acid in the pre-amplification product, a reaction mixture is provided, the reaction mixture comprising:

[0166] (i) comprising (a) nucleic acid products after pre-amplification of multiple target nucleic acids;

[0167] (ii) the primer pool comprises at least one primer set for different target nucleic acid types, each target nucleic acid corresponds to a primer set, the primer set comprises a primer pair and a probe, wherein each primer pair and probe are complementary to or identical to the sequence of the target nucleic acid;

[0168] (iii) nucleic acid polymerase and buffer;

[0169] (iv) the reaction conditions of the reaction mixture for detecting the target nucleic acid by fluorescent quantitative PCR.

[0170] In some embodiments, the reverse transcription primer is a random primer or a plurality of gene-specific primers. In some embodiments, the multi-target nucleic acid is RNA. In some embodiments, the blocking group is located at the 3′ end of each blocking primer, and the blocking group is a 2′, 3′-dideoxynucleotide. In some embodiments, the modification is the introduction of at least one mismatched nucleotide in the primer. In some embodiments, the reaction mixture comprises at least 10 or more different types of primer pairs. In some embodiments, the length of each of the primers is 8 to 100 nucleotides. In some embodiments, the different types of primer pairs can complementarily bind to different target nucleic acids or different sequences in the same target nucleic acid. In some embodiments, the deblocking agent is ampliTaq or KlenTaq polymerase, pyrophosphate or RNase H2 with a F667Y mutation.

[0171] In a third aspect, based on the application of the second aspect of the invention, a method for simultaneously pre-amplifying RNA and DNA multi-target nucleic acid combined with fluorescent quantitative PCR detection is provided, wherein the method comprises:

[0172] (a) providing a reaction mixture, the reaction mixture comprising:

[0173] (i) a mixed nucleic acid sample of RNA and DNA containing or suspected of containing the target nucleic acid;

[0174] (ii) reverse transcription primer;

[0175] (iii) the primer pool comprises at least 5 primer pairs of different target nucleic acid types, wherein at least one primer of each target nucleic acid primer pair is complementary to a portion of the target nucleic acid, and each primer pair has at least one blocking primer, wherein the blocking primer comprises a blocking group capable of blocking polymerase extension;

[0176] (iv) nucleic acid polymerase;

[0177] (v) a deblocking agent, which enables the target nucleic acid to be polymerized by the nucleic acid polymerase through the blocking primer;

[0178] (vi) reaction conditions of the reaction mixture for simultaneously pre-amplifying the RNA and DNA multiple target nucleic acids.

[0179] (b) When using fluorescent quantitative PCR for single or multiplex detection of target nucleic acid in the pre-amplification product, a reaction mixture is provided, the reaction mixture comprising:

[0180] (i) comprising (a) nucleic acid products after pre-amplification of multiple target nucleic acids;

[0181] (ii) the primer pool comprises at least one primer set for different target nucleic acid types, each target nucleic acid corresponds to a primer set, the primer set comprises a primer pair and a probe, wherein each primer pair and probe are complementary to or identical to the sequence of the target nucleic acid;

[0182] (iii) nucleic acid polymerase and buffer;

[0183] (iv) the reaction conditions of the reaction mixture for detecting the target nucleic acid by fluorescent quantitative PCR.

[0184] In some embodiments, the reverse transcription primer is a random primer or a plurality of gene-specific primers. In some embodiments, the multi-target nucleic acid is a mixed nucleic acid of RNA and DNA. In some embodiments, the blocking group is located at the 3′ end of each blocking primer, and the blocking group is a 2′, 3′-dideoxynucleotide. In some embodiments, the modification is the introduction of at least one mismatched nucleotide in the primer. In some embodiments, the reaction mixture comprises at least 21 different types of primer pairs. In some embodiments, the length of each of the primers is 8 to 100 nucleotides. In some embodiments, the different types of primer pairs can complementarily bind to different target nucleic acids or different sequences in the same target nucleic acid. In some embodiments, the deblocking agent is ampliTaq or KlenTaq polymerase, pyrophosphate or RNase H2 with a F667Y mutation.

[0185] The main advantages of the present invention include

[0186] (1) The present invention solves the problem of multiple pre-amplification of different types of multi-target nucleic acids or mixtures of different types of nucleic acids in one tube. The number of target nucleic acids can be greater than 5, 10, 20, 50, 100, 200, thereby increasing the abundance of target nucleic acids. One tube of multiple pre-amplification products can be combined with fluorescent quantitative PCR to perform multi-well medium- and high-throughput target gene detection, single-well single-plex or single-well multiple detection of target nucleic acids, and the number of detection reaction wells can be greater than 5, 10, 20, 50, 100, 200, thereby achieving medium- and high-throughput multi-target nucleic acid detection.

[0187] (2) The present invention uses a very small amount of sample, the process operation is simple and the detection time is short.

[0188] (3) The present invention has the advantages that one tube of multiple pre-amplification products can realize hundreds or even more fluorescence quantitative PCR detection reactions, detect multiple targets at one time, have very low cost, and are economical and efficient;

[0189] (4) The method of multiple pre-amplification of multiple target nucleic acids combined with fluorescent quantitative PCR multi-well detection provided by the present invention has the great advantages of high detection sensitivity and super specificity. There will be no cross-reaction between different types of target genes in one tube of multiple pre-amplification, which solves the problem of non-specific reactions that are prone to occur in multiple PCR reactions, while maintaining a very high sensitivity of 1.25 copies / μL.

[0190] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where no detailed conditions are specified are generally performed under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0191] Example 1 Detection of pathogens by combining multiple pre-amplification of DNA type multi-target nucleic acid with single-plex fluorescence quantitative PCR detection

[0192] (1) Preparation of multiple pre-amplification primer pairs and fluorescent quantitative PCR primer sets:

[0193] The nucleic acid sequences of nine DNA pathogens including adenovirus (group B, group C, group E), Chlamydia pneumoniae, Mycoplasma pneumoniae, Bordetella pertussis, Streptococcus pneumoniae, Haemophilus influenzae, Klebsiella pneumoniae, Moraxella catarrhalis, and Mycobacterium tuberculosis were obtained from GenBank. Clustalw2 Alignment software was used for homology comparison analysis to determine the conserved sequence regions of each type of target. Then, suitable sequences were selected within the conserved regions. Primer Primier 3.0 software was used to design 11 pairs of specific preamplification primers and 11 sets of fluorescence quantitative PCR primer sets, as shown in Table 2 Primer pairs for preamplification of DNA pathogens and Table 4 Primers and probes for fluorescence quantitative PCR detection of DNA pathogens

[0194] (2) Preparation of DNA reference:

[0195] According to the conserved sequence regions of each type of target of adenovirus group B, adenovirus group C, adenovirus group E, Chlamydia pneumoniae, Mycoplasma pneumoniae, Bordetella pertussis, Streptococcus pneumoniae, Haemophilus influenzae, Klebsiella pneumoniae, Moraxella catarrhalis and Mycobacterium tuberculosis, pcDNA3.1 plasmid was used as a vector, and BamHI and EcoRI restriction sites were used as insertion sites in the multiple cloning site to construct 11 plasmids of the pathogens. Each plasmid reference was diluted with TE buffer in a 10-fold gradient from 5x10 6 Dilute to 5x10 copies / μl 3 Copies / μl, 5x10 for each plasmid reference 3 Copies / μl was used as the mother solution to prepare 11 DNA pathogen plasmid mixed references, in which the concentration of each plasmid was 50 copies / μl.

[0196] (3) Multiple pre-amplification of DNA and multiple target nucleic acids:

[0197] Multiplex polymerase chain reaction (multiplex PCR) was performed to selectively amplify 11 amplicons (products amplified from the target nucleic acid region) of 11 pathogen plasmid mixed references, using DNA pathogen preamplification primers in Table 2. A pool containing 11 primer pairs (each primer containing a dideoxynucleotide at its 3′ end and a primer concentration of 0.5 μM) was added to a single PCR tube containing 11 pathogen plasmid mixed references (each at 50 copies / μl) and 25 μL amplification reaction mixture, and DNase / RNase-free water was added to a final volume of 50 μL, wherein the amplification reaction mixture contained 0.2 mM dNTP, 3 mM MgCl2, 90 nM pyrophosphate and 2 units of KlenTaq-S DNA polymerase. The PCR tube was placed on an ABI Veriti 96-well gradient PCR instrument in the United States and the following temperature curve was run to obtain the amplicon library of DNA multi-target nucleic acid amplification: 95°C for 2 minutes; 95°C for 15 seconds, 60°C for 120 seconds, 12 cycles; maintained at 4°C.

[0198] (4) Single-plex fluorescence quantitative PCR detection of DNA pathogens

[0199] Single-plex fluorescence quantitative PCR was performed to detect 11 DNA pathogens, using the DNA pathogen detection primers and probes in Table 4. Single pathogen detection reaction system: 1 μl (3) amplicon was taken as template, 5 μl of 2x probe method enzyme reaction solution (Biovuetech, Cat. No. 9000025), a pathogen primer set (primer concentration of 0.3 μM, probe concentration of 0.2 uM) and water without DNase / RNase were added to a total volume of 10 μL. 11 reaction wells were required for the detection of 11 DNA pathogens. The following program was run on the American ABI 7900 real-time fluorescence quantitative PCR instrument: 95°C for 10 minutes; 95°C for 15 seconds, 60°C for 60 seconds, 40 cycles, and FAM fluorescence signal was collected at 60°C, with ROX as the reference fluorescence.

[0200] The experimental results are as follows Figure 1 As shown. Among them, Figure 1 AK showed the test results of adenovirus group B and negative, adenovirus group C and negative, adenovirus group E and negative, Chlamydia pneumoniae and negative, Mycoplasma pneumoniae and negative, Bordetella pertussis and negative, Streptococcus pneumoniae and negative, Haemophilus influenzae and negative, Klebsiella pneumoniae and negative, Moraxella catarrhalis and negative, and Mycobacterium tuberculosis and negative, respectively.

[0201] Example 2 Detection of pathogens by combining multiple pre-amplification of RNA-type multi-target nucleic acids with single-plex fluorescence quantitative PCR detection

[0202] (1) Preparation of multiple pre-amplification primer pairs and fluorescent quantitative PCR primer sets:

[0203] The nucleic acid sequences of 10 RNA viruses including metapneumovirus, rhinovirus, influenza A virus H1N1, parainfluenza virus 1, parainfluenza virus 2, parainfluenza virus 3, human coronavirus HCoV-HKU1, human coronavirus HCoV-OC43, human coronavirus HCoV-NL63 and human coronavirus HCoV-229E were obtained from GenBank. Clustalw2 Alignment software was used for homology comparison analysis to determine the conserved sequence regions of each type of target. Then, suitable sequences were selected within the conserved regions, and Primer Primier 3.0 software was used to design 10 pairs of specific pre-amplification primer pairs and 10 sets of fluorescence quantitative PCR primer sets, as shown in Table 1 Multiple pre-amplification RNA pathogen primer pairs and Table 3 Primers and probes for fluorescence quantitative PCR detection of RNA pathogens.

[0204] (2) Preparation of RNA reference products:

[0205] According to the conserved sequence regions of various types of targets obtained in (1), pcDNA3.1 plasmid was used as a vector, and AscI and AgeI restriction sites were used as insertion sites in the multiple cloning site to construct 10 plasmids of the virus described in (1). Using various types of viral plasmids as templates, each plasmid was linearized with restriction endonuclease AgeI, and in vitro transcription was performed according to the steps in the instructions of TranscriptAid T7 High Yield Transcription Kit (Thermo Scientific). The transcription product was then digested with DNA according to the instructions of RapidOut DNA Removal Kit (Thermo Scientific) to obtain purified RNA, which was quantified with a Thermo Nanodrop 2000 spectrophotometer and stored at -70°C as in vitro transcribed RNA reference products. Each viral in vitro transcribed RNA reference product was diluted in a 10-fold gradient from 5x10 6 Dilute to 5x10 copies / μl 3 Copies / μl, with 5x10 RNA reference for each virus in vitro transcription 3 Copies / μl was used as the mother solution to prepare 10 kinds of viral in vitro transcribed RNA mixed reference products, in which the concentration of each viral RNA was 50 copies / μl.

[0206] (3) Multiple pre-amplification of RNA multiple target nucleic acids:

[0207] Reverse transcription multiplex polymerase chain reaction (multiplex RT-PCR) was performed to selectively amplify 10 amplicons (products amplified from the target nucleic acid region) of 10 viral in vitro transcribed RNA mixed references using RNA pathogen preamplification primers in Table 1. A pool containing 10 primer pairs (each primer containing a dideoxynucleotide at its 3′ end and a primer concentration of 0.5 μM) (see Table 1) was added to a single PCR tube containing 10 viral in vitro transcribed RNA mixed references (each at 50 copies / μl) and 25 μl of amplification reaction mixture, and DNase / RNase-free water was added to a final volume of 50 μl, wherein the amplification reaction mixture contained 10 uM Random primer (N6), 0.2 mM dNTP, 3 mM MgCl2, 90 nM pyrophosphate and 2 units of KlenTaq-S DNA polymerase. The PCR tube was placed on an ABI Veriti 96-well gradient PCR instrument and the following temperature curve was run to obtain the amplicon library for RNA multi-target nucleic acid amplification: 25°C for 5 minutes; 42°C for 15 minutes; 95°C for 2 minutes; 95°C for 15 seconds, 60°C for 120 seconds, 12 cycles; and maintained at 4°C.

[0208] (4) Single-plex fluorescence quantitative PCR detection of RNA viruses

[0209] Single-plex fluorescence quantitative PCR was performed to detect 10 RNA viruses, using the RNA pathogen detection primers and probes in Table 3. Single RNA virus detection reaction system: 1 μl (3) amplicon was taken as template, 5 μl of 2x probe method enzyme reaction solution (Biovuetech, Cat. No. 9000025), a virus primer set (primer concentration of 0.3 μM, probe concentration of 0.2 uM) and water without DNase / RNase were added to a total volume of 10 μL. 10 reaction wells were set for 10 RNA virus detection. The following program was run on the American ABI7500Fast real-time fluorescence quantitative PCR instrument: 95°C for 10 minutes; 95°C for 15 seconds, 60°C for 60 seconds, 40 cycles, and 60°C to collect FAM, VIC, Texas Red, TAMRA and CY5 fluorescence signals, with ROX as the reference fluorescence.

[0210] The experimental results are as follows Figure 2 As shown. Among them, Figure 2 AJ shows the test results of metapneumovirus and negative, rhinovirus and negative, influenza A virus H1N1 and negative, parainfluenza virus 1 and negative, parainfluenza virus 2 and negative, parainfluenza virus 3 and negative, human coronavirus HCoV-HKU1 and negative, human coronavirus HCoV-OC43 and negative, human coronavirus HCoV-NL63 and negative, and human coronavirus HCoV-229E and negative, respectively.

[0211] Example 3 Detection of pathogens by combining multiplex preamplification of RNA and DNA multi-target nucleic acid mixture with single and multiplex fluorescence quantitative PCR detection

[0212] (1) Preparation of RNA and DNA reference materials:

[0213] The 11 DNA pathogen plasmid mixed reference products of Example 2 (each pathogen plasmid DNA concentration is 50 copies / μl) and the 10 RNA virus in vitro RNA mixed reference products of Example 2 (each virus in vitro transcribed RNA concentration is 50 copies / μl) are used as reference products.

[0214] (2) Multiplex pre-amplification of RNA and DNA multi-target nucleic acid mixtures:

[0215] Reverse transcription multiplex polymerase chain reaction (multiplex RT-PCR) was performed to selectively amplify 21 amplicons (products amplified from the target nucleic acid region) of 21 pathogen RNA and DNA mixed references using RNA pathogen preamplification primers in Table 1 and DNA pathogen preamplification primers in Table 2. A pool containing 21 primer pairs (each primer containing a dideoxynucleotide at its 3′ end and a primer concentration of 0.5 μM) was added to a single PCR tube containing 21 pathogen RNA and DNA mixed references (50 copies / μl each) and 25 μl of amplification reaction mixture, and DNase / RNase-free water was added to a final volume of 50 μl, wherein the amplification reaction mixture contained 10 uM Random primer (N6), 0.2 mM dNTP, 3 mM MgCl2, 90 nM pyrophosphate and 2 units of KlenTaq-S DNA polymerase. The PCR tubes were placed on a US ABI Veriti 96-well gradient PCR instrument and the following temperature curve was run to obtain the amplicon library for RNA and DNA multi-target nucleic acid amplification: 25°C for 5 minutes; 42°C for 15 minutes; 95°C for 2 minutes; 95°C for 15 seconds, 60°C for 120 seconds, 12 cycles; and maintained at 4°C.

[0216] (3) Single and multiplex fluorescence quantitative PCR detection of RNA and DNA pathogens

[0217] (a) Perform single-plex fluorescence quantitative single-plex PCR to detect 21 RNA and DNA pathogens, using the RNA pathogen detection primer probes in Table 3 and the DNA pathogen detection primer probes in Table 4. Single pathogen detection reaction system: Take 1 μl (3) amplicon as template, add 5 μl of 2x probe method enzyme reaction solution (Biovuetech, Cat. No. 9000025), a pathogen primer set (primer concentration of 0.3 μM, probe concentration of 0.2 uM) and add DNase / RNase-free water to a total volume of 10 μL. 21 reaction wells are required for the detection of 21 pathogens. The following program is run on the American ABI 7500Fast real-time fluorescence quantitative PCR instrument: 95°C for 10 minutes; 95°C for 15 seconds, 60°C for 60 seconds, 40 cycles, and collect FAM, VIC, Texas Red, TAMRA and CY5 fluorescence signals at 60°C, with ROX as the reference fluorescence.

[0218] (b) Perform multiplex fluorescence quantitative PCR to detect 6 RNA pathogens, using the RNA pathogen detection primers and probes in Table 3. Single-well multiple pathogen detection reaction system: Take 1μl (3) amplicon as template, add 5μl of 2x probe method enzyme reaction solution (Biovuetech, Cat.No.9000025), the primer pool contains primer sets for three different pathogens (each primer concentration is 0.3μM, each probe concentration is 0.2uM) and supplement with DNase / RNase-free water to a total volume of 10μL. Two reaction wells are set for the detection of 6 pathogens. The primer pool in well 1 is the primer set combination of human coronavirus HCoV-NL63, human coronavirus HCoV-OC43 and human coronavirus HCoV-229E, and the primer pool in well 2 is the primer set combination of rhinovirus, metapneumovirus and parainfluenza virus 1. The following program was run on an ABI 7500fast real-time fluorescence quantitative PCR instrument: 95°C for 10 min; 95°C for 15 s, 60°C for 60 s, 40 cycles, and collection of FAM, VIC, Texas Red, TAMRA and CY5 fluorescence signals at 60°C, with ROX as the reference fluorescence.

[0219] The experimental results of fluorescence quantitative multiplex PCR are as follows Figure 3 As shown. Among them, Figure 3 A and 3B show the results of fluorescence quantitative multiplex PCR detection of human coronavirus HCoV-OC43, human coronavirus HCoV-NL63, and human coronavirus HCoV-229E and negative results, respectively; Figure 3 B shows the results of fluorescence quantitative multiplex PCR for the detection of rhinovirus, metapneumovirus and parainfluenza virus 1 and negative results.

[0220] Example 4 Sensitivity evaluation of multiplex preamplification of multiple target nucleic acids combined with fluorescence quantitative PCR detection method

[0221] (1) Preparation of sensitivity reference materials:

[0222] To evaluate the detection sensitivity of the method, the concentration was 5x10 4 11 kinds of DNA pathogen plasmid mixed references were prepared from the mother solution, each of which had a concentration of 500 copies / μl. They were diluted with TE buffer to the following gradient concentrations as sensitivity references:

[0223] 50 copies / μl sensitivity reference;

[0224] 5 copies / μl sensitivity reference;

[0225] 2.5 copies / μl sensitivity reference;

[0226] 1.25 copies / μl sensitivity reference.

[0227] (2) Pre-amplification of DNA multi-target nucleic acids and detection of DNA pathogens by fluorescent quantitative PCR are the same as in Example 1.

[0228] (3) The sensitivity test results are shown in Table 5.

[0229] Table 5. Sensitivity test results for detecting DNA pathogens

[0230]

[0231] From the test results, it can be seen that the minimum detection limit of this method for simultaneous detection of adenovirus group B, adenovirus group C, adenovirus group E, Chlamydia pneumoniae, Mycoplasma pneumoniae, Bordetella pertussis, Streptococcus pneumoniae, Haemophilus influenzae, Klebsiella pneumoniae, Moraxella catarrhalis and Mycobacterium tuberculosis is 2.5 copies / μL. Except for adenovirus group C and Streptococcus pneumoniae, the detection limit of other DNA pathogens can even be detected at 1.25 copies / μL, indicating that this method has a very high sensitivity.

[0232] Example 5 Preparation of specific reference materials for multiple pre-amplification of multi-target nucleic acids combined with fluorescent quantitative PCR detection method:

[0233] To evaluate the detection specificity of the method, 5x10 4 The following RNA and DNA pathogen-specific reference samples were prepared from the mother solution at copies / μl, with a total of 18 mixed template pools. Each mixed template pool lacked a pathogen reference sample, see Table 6, where the concentration of each pathogen was 500 copies / μl.

[0234] Table 6. 18 mixed template pools

[0235]

[0236] (2) Pre-amplification of multi-target nucleic acids and detection of pathogens by fluorescent quantitative PCR are the same as in Example 3.

[0237] (3) The specificity test results are shown in Table 7.

[0238] Table 7. Specificity test results

[0239]

[0240]

[0241] The test results show that in a specific DNA and RNA mixed template pool, when a certain template is not contained, the fluorescent quantitative PCR in this method will give a negative result (Ct=40) for detecting this template. In other words, there will be no cross reaction between the numerous templates (amplicon library) in the template pool and the pathogen primers, indicating that this detection method has extremely high specificity.

[0242] Example 6 Detection of EGFR mutations by multiplex preamplification of DNA and multiple target nucleic acids combined with singlex fluorescence quantitative PCR detection

[0243] (1) Preparation of multiple pre-amplification primer pairs and fluorescent quantitative PCR primer sets:

[0244] Twelve common human EGFR mutations were obtained from COSMIC, including c.2573T>G (p.L858R), c.2582T>A (p.L861Q), c.2369C>T (p.T790M), c.2303G>T (p.S768I), c.2240_2254del15 (p.L747_T751delLREAT), c.2237_2251del15 (p.E746_T751>A), c.2240_2257del18 (p.L747_P 753>S), c.2239_2248TTAAGAGAAG>C(p.L747_A750>P), c.2237_2255>T(p.E746_S752>V), c.2236_2250del15(p.E746_A750delELREA), c.2235_2249del15(p.E746_A750delELREA), c.2300_2308dup(p.A767_V769dup), 12 pairs of specific pre-amplification primer pairs and 12 sets of fluorescence quantitative PCR primer sets were designed using Primer Primier 3.0 software. The pre-amplification primer pairs are shown in Table 8, and the mutation detection fluorescence quantitative PCR primer sets are shown in Table 9.

[0245] Table 8. Multiplex preamplification EGFR mutation primer pairs

[0246]

[0247]

[0248] Table 9. Primers and probes for detecting EGFR mutations by fluorescence quantitative PCR

[0249]

[0250]

[0251] (2) Preparation of DNA reference:

[0252] According to 12 common human EGFR mutations including c.2573T>G (p.L858R), c.2582T>A (p.L861Q), c.2369C>T (p.T790M), c.2303G>T (p.S768I), c.2240_2254del15 (p.L747_T751delLREAT), c.2237_2251del15 (p.E746_T751>A), c.2240_2257del18 (p.L747_P753>S), c.2239_2248TTAAGAGAAG>C (p.L747_A750>P ), c.2237_2255>T(p.E746_S752>V), c.2236_2250del15(p.E746_A750delELREA), c.2235_2249del15(p.E746_A750delELREA), c.2300_2308dup(p.A767_V769dup) and the full-length wild-type nucleic acid sequence corresponding to all the above mutation sites were constructed using pcDNA3.1 plasmid as a vector and BamHI and EcoRI restriction sites as insertion sites in the multiple cloning site to construct 12 mutant plasmids and 1 wild-type plasmid. The wild-type plasmid reference was diluted to 10 4 copies / μl, each mutant plasmid reference was used with the above 10 4 The wild-type plasmid was diluted to 100 copies / μl to prepare 12 plasmid references with a mutation frequency of 1%.

[0253] (3) Multiple pre-amplification of EGFR mutation target nucleic acids:

[0254] Multiplex polymerase chain reaction (multiplex PCR) was performed to selectively amplify 12 amplicons (products amplified from the target nucleic acid region) in 12 EGFR mutant plasmids in the wild-type plasmid background without amplifying the wild-type plasmid, using the multiplex pre-amplification EGFR mutant primer pairs in Table 8. A pool containing 12 primer pairs (each primer containing a dideoxynucleotide at its 3′ end and a primer concentration of 0.5 μM) (see Table 8) was added to the pool containing 12 EGFR mutant plasmid references (12 10 4100 copies / μl, mutation frequency 1%) and wild plasmid reference and 25 μL amplification reaction mixture, add DNase / RNase-free water to a final volume of 50 μL, the amplification reaction mixture contains 0.2mM dNTP, 3mM MgCl2, 90nM pyrophosphate and 2 units of KlenTaq-S DNA polymerase. The PCR tube is placed on the American ABI Veriti 96-well gradient PCR instrument and the following temperature curve is run to obtain the amplicon library of DNA multi-target nucleic acid amplification: 95°C for 2 minutes; 95°C for 15 seconds, 65°C for 120 seconds, 12 cycles; maintained at 4°C.

[0255] (4) Single-plex fluorescence quantitative PCR detection of EGFR mutations

[0256] Perform single-plex fluorescence quantitative PCR to detect 12 EGFR mutations, using the primer probes for fluorescence quantitative PCR detection of EGFR mutations in Table 9. Single pathogen detection reaction system: Take 1μl (3) amplicon as template, add 5μl of 2x probe method enzyme reaction solution (Biovuetech, Cat.No.9000025), a pathogen primer set (primer concentration is 0.3μM, probe concentration is 0.2uM), see Table 9, and add DNase / RNase-free water to a total volume of 10μL. 11 reaction wells need to be set up for 11 DNA pathogen detection. Run the following program on the American ABI 7900 real-time fluorescence quantitative PCR instrument: 95℃ for 10 minutes; 95℃ for 15 seconds, 60℃ for 60 seconds, 40 cycles, collect FAM fluorescence signal at 60℃, and use ROX as reference fluorescence.

[0257] The experimental results are as follows Figure 4 shown.

[0258] (5) The results are shown in Table 10

[0259] Table 10. Detection results of 12 EGFR mutations

[0260]

[0261] The results show that the method of the present invention improves the abundance of EGFR mutation multi-target nucleic acids by multiple selective pre-amplification in one tube, and can easily detect 1% EGFR mutation content or even lower abundance EGFR mutations in combination with fluorescent quantitative PCR, and has a low Ct value and a strong signal, which can well distinguish mutant and wild-type templates, and has excellent detection sensitivity and specificity in gene mutation detection.

[0262] discuss:

[0263] 1. The present invention provides a method for multiple preamplification of DNA or RNA target nucleic acids and multiple preamplification of DNA or RNA target nucleic acid mixtures in one tube

[0264] Compared with the method of amplifying target nucleic acid disclosed in the prior art, the prior art only studies multiple pre-amplification of DNA target nucleic acid and applies it to the sequencing platform, but does not further study and elaborate multiple pre-amplification of RNA target nucleic acid or mixed target nucleic acid of DNA and RNA. The present invention further optimizes the amplification method, and realizes multiple pre-amplification of multiple target nucleic acids in one tube through optimized pre-amplification primers. Among them, the target nucleic acid can be different types of nucleic acids (RNA target nucleic acid or DNA target nucleic acid) or a mixture of different types of nucleic acids, and the number of target nucleic acids can be greater than 5, 10, 20, 50, 100, 200.

[0265] 2. The present invention realizes medium- and high-throughput detection of target genes by multiple pre-amplification of multiple target nucleic acids, and the amplified products are used for single or multiple fluorescence quantitative PCR multi-well detection.

[0266] After multiple pre-amplification of multiple target nucleic acids in one tube, the amplified products can be applied to the fields of sequencing, electrophoresis, mass spectrometry and dry chemical reactions, as well as to fluorescent quantitative PCR detection, but there is no related research on the application of amplified products to fluorescent quantitative PCR in the prior art. The method in the present invention involves multiple pre-amplification of multiple target nucleic acids in one tube, increasing the abundance of target nucleic acids, and combining single or multiple fluorescent quantitative PCR multi-well detection of target nucleic acids in pre-amplified products. Among them, the number of detection reaction wells can be greater than 5, 10, 20, 50, 100, 200, that is, the present invention verifies the feasibility of multiple pre-amplification of multiple target nucleic acids for fluorescent quantitative PCR detection, and tests a tube of multiple pre-amplification products for single fluorescent quantitative PCR and multiple fluorescent quantitative PCR detection. In particular, one tube of product is sufficient for hundreds or even more wells of fluorescent quantitative PCR detection reactions, thereby realizing the detection of medium and high throughput target genes.

[0267] 3. The method of multiple pre-amplification multi-target nucleic acid reaction combined with fluorescence quantitative PCR detection in one tube is a two-step reaction, which requires opening the tube after the first step of multiple pre-amplification, and taking the amplified product for the second step of fluorescence quantitative PCR detection reaction. Improper tube opening operation can easily lead to pollution of the environment and instruments and equipment, so the operation requirements are relatively high. The inventor is currently conducting research on the one-step method. Specifically, multiple pre-amplification multi-target nucleic acid detection is performed in one tube, and the results are directly obtained, thereby further optimizing the method of the present invention.

[0268] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application. Sequence Listing <110> Shanghai Xiangqiong Biotechnology Co., Ltd. <120> Method for preamplifying multi-target nucleic acid combined with fluorescence quantitative PCR detection <130> P2021-0842 <160> 165 <170> SIPOSequenceListing 1.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <400> 1 gcggaggaag gggtttgg 18 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <400> 2 agcaagaagg ggctgcttt 19 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <400> 3 tcctccggcc cctgaatg 18 <210> 4 <211> twenty two <212> DNA <213> Artificial Sequence <400> 4 attgtcacca taagcaattg at 22 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <400> 5 aatctggaat atcagatggg ataca 25 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <400> 6 accacaactg cctgtcttat c 21 <210> 7 <211> twenty two <212> DNA <213> Artificial Sequence <400> 7 aaagaacaac cacaaccaca ga 22 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 tgttgccagt tccttcttca 20 <210> 9 <211> twenty three <212> DNA <213> Artificial Sequence <400> 9 tagctgaact gagacttgct ttc 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 aggtgataga tcccgcttcc 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <400> 11 tttgctcttg gaccgacaa 19 <210> 12 <211> twenty two <212> DNA <213> Artificial Sequence <400> 12 tggattggca taagccattg at 22 <210> 13 <211> twenty three <212> DNA <213> Artificial Sequence <400> 13 tggttattct gtcacaccat ttg 23 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <400> 14 agatttacaacctactacacctgaa 25 <210> 15 <211> twenty one <212> DNA <213> Artificial Sequence <400> 15 aatgtggccg ttgaattatt t 21 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <400> 16 gtgcttccaa cacacgtcta 20 <210> 17 <211> twenty three <212> DNA <213> Artificial Sequence <400> 17 attctttatgg tggagcgtct att 23 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <400> 18 aacctgaacacatttacccttaaac 25 <210> 19 <211> twenty three <212> DNA <213> Artificial Sequence <400> 19 aacgtgtcgt taaattgcag aac 23 <210> 20 <211> twenty one <212> DNA <213> Artificial Sequence <400> 20 taatgcctcc atcaccttca c 21 <210> twenty one <211> 17 <212> DNA <213> Artificial Sequence <400> twenty one cccggttgga gcctaag 17 <210> twenty two <211> 17 <212> DNA <213> Artificial Sequence <400> twenty two ggctcgctcc cgtaaac 17 <210> twenty three <211> 16 <212> DNA <213> Artificial Sequence <400> twenty three tgccaggtcc gctaca 16 <210> twenty four <211> 17 <212> DNA <213> Artificial Sequence <400> twenty four caccgcttcg tggactt 17 <210> 25 <211> twenty three <212> DNA <213> Artificial Sequence <400> 25 ggcggtaaac atattaggaa cca 23 <210> 26 <211> twenty three <212> DNA <213> Artificial Sequence <400> 26 ccacacattt cagtacctca atc ​​23 <210> 27 <211> twenty four <212> DNA <213> Artificial Sequence <400> 27 agctacactg tacattgaag ggca 24 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <400> 28 ttccgtagga aatagtagat agacg 25 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <400> 29 tgtgcttagt ggtgggggtg 20 <210> 30 <211> twenty two <212> DNA <213> Artificial Sequence <400> 30 ttgttggtgg aggaggtgtt tc 22 <210> 31 <211> 16 <212> DNA <213> Artificial Sequence <400> 31 ggctggacgg gcaatc 16 <210> 32 <211> 17 <212> DNA <213> Artificial Sequence <400> 32 aggcccgaat cacacca 17 <210> 33 <211> twenty one <212> DNA <213> Artificial Sequence <400> 33 gctgcttgta gttcmtctaa c 21 <210> 34 <211> twenty two <212> DNA <213> Artificial Sequence <400> 34 cgaaataaac ggtgttgtaa cg 22 <210> 35 <211> twenty four <212> DNA <213> Artificial Sequence <400> 35 gctagacta aagtagatgt tacc 24 <210> 36 <211> twenty one <212> DNA <213> Artificial Sequence <400> 36 aacgcccaca tttgctaatg g 21 <210> 37 <211> twenty one <212> DNA <213> Artificial Sequence <400> 37 actacgccat gagtgttatc g 21 <210> 38 <211> twenty three <212> DNA <213> Artificial Sequence <400> 38 gtcacaccca attcattcat tcc 23 <210> 39 <211> 19 <212> DNA <213> Artificial Sequence <400> 39 agtgccagca aatcaacct 19 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <400> 40 acttcagcct tggcaactc 19 <210> 41 <211> 17 <212> DNA <213> Artificial Sequence <400> 41 gacaagcggc tcaacga 17 <210> 42 <211> 18 <212> DNA <213> Artificial Sequence <400> 42 atcgagggtg tgccattg 18 <210> 43 <211> 18 <212> DNA <213> Artificial Sequence <400> 43 gcggaggaag gggtttgg 18 <210> 44 <211> 19 <212> DNA <213> Artificial Sequence <400> 44 agcaagaagg ggctgcttt 19 <210> 45 <211> 33 <212> DNA <213> Artificial Sequence <400> 45 cggggagctcc gtaatttaca tggtgcagct gcc 33 <210> 46 <211> 18 <212> DNA <213> Artificial Sequence <400> 46 tcctccggcc cctgaatg 18 <210> 47 <211> twenty two <212> DNA <213> Artificial Sequence <400> 47 attgtcacca taagcaattg at 22 <210> 48 <211> 28 <212> DNA <213> Artificial Sequence <400> 48 ggatgggacc gactactttg ggtgtccg 28 <210> 49 <211> 25 <212> DNA <213> Artificial Sequence <400> 49 aatctggaat atcagatggg ataca 25 <210> 50 <211> twenty one <212> DNA <213> Artificial Sequence <400> 50 accacaactg cctgtcttat c 21 <210> 51 <211> 35 <212> DNA <213> Artificial Sequence <400> 51 atgcagtggg gttttcggag acaatccacg cccta 35 <210> 52 <211> twenty two <212> DNA <213> Artificial Sequence <400> 52 aaagaacaac cacaaccaca ga 22 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <400> 53 tgttgccagt tccttcttca 20 <210> 54 <211> 32 <212> DNA <213> Artificial Sequence <400> 54 cccaccaact cctgaacacg acgcaacagc aa 32 <210> 55 <211> twenty three <212> DNA <213> Artificial Sequence <400> 55 tagctgaact gagacttgct ttc 23 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <400> 56 aggtgataga tcccgcttcc 20 <210> 57 <211> 34 <212> DNA <213> Artificial Sequence <400> 57 caacagggca atgggccaca atcaatcctg cagt 34 <210> 58 <211> 19 <212> DNA <213> Artificial Sequence <400> 58 tttgctcttg gaccgacaa 19 <210> 59 <211> twenty two <212> DNA <213> Artificial Sequence <400> 59 tggattggca taagccattg at 22 <210> 60 <211> 33 <212> DNA <213> Artificial Sequence <400> 60 acatgcacaa agggcagggt tcctggtgtc ctt 33 <210> 61 <211> twenty three <212> DNA <213> Artificial Sequence <400> 61 tggttattct gtcacaccat ttg 23 <210> 62 <211> 25 <212> DNA <213> Artificial Sequence <400> 62 agatttacaacctactacacctgaa 25 <210> 63 <211> 32 <212> DNA <213> Artificial Sequence <400> 63 ttggtcgccg cgtcctggat tgtggattcc ta 32 <210> 64 <211> twenty one <212> DNA <213> Artificial Sequence <400> 64 aatgtggccg ttgaattatt t 21 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <400> 65 gtgcttccaa cacacgtcta 20 <210> 66 <211> 31 <212> DNA <213> Artificial Sequence <400> 66 caagcgcagt gttcgacacc acccagagct t 31 <210> 67 <211> twenty three <212> DNA <213> Artificial Sequence <400> 67 attctttatgg tggagcgtct att 23 <210> 68 <211> 25 <212> DNA <213> Artificial Sequence <400> 68 aacctgaacacatttacccttaaac 25 <210> 69 <211> 33 <212> DNA <213> Artificial Sequence <400> 69 tcgggcccac gttcctcacc ctagtatgga tgg 33 <210> 70 <211> twenty three <212> DNA <213> Artificial Sequence <400> 70 aacgtgtcgt taaattgcag aac 23 <210> 71 <211> twenty one <212> DNA <213> Artificial Sequence <400> 71 taatgcctcc atcaccttca c 21 <210> 72 <211> 32 <212> DNA <213> Artificial Sequence <400> 72 atgccgggca agatgaaggt caaggccacc aa 32 <210> 73 <211> 17 <212> DNA <213> Artificial Sequence <400> 73 cccggttgga gcctaag 17 <210> 74 <211> 17 <212> DNA <213> Artificial Sequence <400> 74 ggctcgctcc cgtaaac 17 <210> 75 <211> 28 <212> DNA <213> Artificial Sequence <400> 75 cggtttccgc gacaagcgag ggtttggc 28 <210> 76 <211> 18 <212> DNA <213> Artificial Sequence <400> 76 ggtccgctac aacccttt 18 <210> 77 <211> 19 <212> DNA <213> Artificial Sequence <400> 77 ttcgtggact ttgacgact 19 <210> 78 <211> twenty three <212> DNA <213> Artificial Sequence <400> 78 cgaggatggc ttgctgcacc tgg 23 <210> 79 <211> 19 <212> DNA <213> Artificial Sequence <400> 79 cctgtgatgc tggatgtga 19 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <400> 80 catcgctaga gccaaactca 20 <210> 81 <211> 28 <212> DNA <213> Artificial Sequence <400> 81 agctgaggcc cgatcacttg gtgctggc 28 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <400> 82 tgaagggcat actgacgagc 20 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <400> 83 ttccctgctt tcggagatgc 20 <210> 84 <211> 29 <212> DNA <213> Artificial Sequence <400> 84 tgctttagga gcacgacgag ccaatgcga 29 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <400> 85 gggttcttca ggctcaggtc 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <400> 86 gaggtgtttc cgtcactcgt 20 <210> 87 <211> 26 <212> DNA <213> Artificial Sequence <400> 87 agtgagtggg tggcttgtgg ggcagt 26 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <400> 88 gacgggcaat ccttcagctt 20 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <400> 89 tcacaccaag gtcgtacagc 20 <210> 90 <211> 25 <212> DNA <213> Artificial Sequence <400> 90 aaaggggtac ggccggcctg gtcgc 25 <210> 91 <211> 19 <212> DNA <213> Artificial Sequence <400> 91 gcaatggtgc tgctcaaac 19 <210> 92 <211> 19 <212> DNA <213> Artificial Sequence <400> 92 gtagttgcgg gttgatcgt 19 <210> 93 <211> 29 <212> DNA <213> Artificial Sequence <400> 93 ttgaagatca gcaacagagt atccgccaa 29 <210> 94 <211> twenty three <212> DNA <213> Artificial Sequence <400> 94 gtagatgtta ccagccgtaa tgc 23 <210> 95 <211> twenty one <212> DNA <213> Artificial Sequence <400> 95 aacgcccaca tttgctaatg g 21 <210> 96 <211> twenty three <212> DNA <213> Artificial Sequence <400> 96 aagccaacac caacaccgcc tgc 23 <210> 97 <211> twenty one <212> DNA <213> Artificial Sequence <400> 97 actacgccat gagtgttatc g 21 <210> 98 <211> 18 <212> DNA <213> Artificial Sequence <400> 98 gcgacggtga acaggttt 18 <210> 99 <211> 31 <212> DNA <213> Artificial Sequence <400> 99 agcgcgagct cttcctgatg ttcgagatgg c 31 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <400> 100 gcaaatcaac ctgcggatac 20 <210> 101 <211> 20 <212> DNA <213> Artificial Sequence <400> 101 tcacaccaag gtcgtacagc 20 <210> 102 <211> 28 <212> DNA <213> Artificial Sequence <400> 102 atacgcttcg cgacgatcgc acctgccc 28 <210> 103 <211> 18 <212> DNA <213> Artificial Sequence <400> 103 tggtcgccaa cgtctaca 18 <210> 104 <211> 19 <212> DNA <213> Artificial Sequence <400> 104 gtagttgcgg gttgatcgt 19 <210> 105 <211> 28 <212> DNA <213> Artificial Sequence <400> 105 ttcaacgtca ggccggctgc accaacga 28 <210> 106 <211> 26 <212> DNA <213> Artificial Sequence <400> 106 catgtcaaga tcacagaatt tgggcg 26 <210> 107 <211> twenty one <212> DNA <213> Artificial Sequence <400> 107 gcgtgctggc tgacctaaag c 21 <210> 108 <211> 32 <212> DNA <213> Artificial Sequence <400> 108 gtcaagatca cagaatttgg gctggccaaa ca 32 <210> 109 <211> twenty two <212> DNA <213> Artificial Sequence <400> 109 tgacctaaag ccacctcctt ac 22 <210> 110 <211> 29 <212> DNA <213> Artificial Sequence <400> 110 tgcctcacct ccaccgtcca gctcatcat 29 <210> 111 <211> twenty three <212> DNA <213> Artificial Sequence <400> 111 tattgtcttt gtgttcccgg aca 23 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <400> 112 tccatgtgcc cctccttctg 20 <210> 113 <211> 30 <212> DNA <213> Artificial Sequence <400> 113 gcaggcggca cacgtggggg ttgtccacga 30 <210> 114 <211> 31 <212> DNA <213> Artificial Sequence <400> 114 agttaaaatt cccgtcgcta tcaaggaatc t 31 <210> 115 <211> twenty three <212> DNA <213> Artificial Sequence <400> 115 ccccacacag caaagcagaa act 23 <210> 116 <211> 27 <212> DNA <213> Artificial Sequence <400> 116 agttaaaatt cccgtcgcta tcaaggc 27 <210> 117 <211> twenty three <212> DNA <213> Artificial Sequence <400> 117 ccccacacag caaagcagaa act 23 <210> 118 <211> 31 <212> DNA <213> Artificial Sequence <400> 118 aagttaaaat tcccgtcgct atcaaggaat c 31 <210> 119 <211> twenty three <212> DNA <213> Artificial Sequence <400> 119 ccccacacag caaagcagaa act 23 <210> 120 <211> 29 <212> DNA <213> Artificial Sequence <400> 120 agttaaaatt cccgtcgcta tcaaggaac 29 <210> 121 <211> twenty three <212> DNA <213> Artificial Sequence <400> 121 ccccacacag caaagcagaa act 23 <210> 122 <211> 30 <212> DNA <213> Artificial Sequence <400> 122 gaaagttaaa attcccgtcg ctatcaaggt 30 <210> 123 <211> twenty three <212> DNA <213> Artificial Sequence <400> 123 ccccacacag caaagcagaa act 23 <210> 124 <211> 31 <212> DNA <213> Artificial Sequence <400> 124 gagaaagtta aaattcccgt cgctatcaag a 31 <210> 125 <211> twenty three <212> DNA <213> Artificial Sequence <400> 125 ccccacacag caaagcagaa act 23 <210> 126 <211> 33 <212> DNA <213> Artificial Sequence <400> 126 ggtgagaaag ttaaaattcc cgtcgctatc aaa 33 <210> 127 <211> twenty three <212> DNA <213> Artificial Sequence <400> 127 ccccacacag caaagcagaa act 23 <210> 128 <211> 20 <212> DNA <213> Artificial Sequence <400> 128 tccatgtgcc cctccttctg 20 <210> 129 <211> 18 <212> DNA <213> Artificial Sequence <400> 129 ttgtccacgc tggccacg 18 <210> 130 <211> 18 <212> DNA <213> Artificial Sequence <400> 130 gatcacagaa tttgggcg 18 <210> 131 <211> 28 <212> DNA <213> Artificial Sequence <400> 131 ctgggtgcgg aagagaaaga ataccatg 28 <210> 132 <211> 20 <212> DNA <213> Artificial Sequence <400> 132 tgacctaaag ccacctcctt 20 <210> 133 <211> 20 <212> DNA <213> Artificial Sequence <400> 133 gaatttgggc tggccaaaca 20 <210> 134 <211> 28 <212> DNA <213> Artificial Sequence <400> 134 ctgggtgcgg aagagaaaga ataccatg 28 <210> 135 <211> 20 <212> DNA <213> Artificial Sequence <400> 135 tgacctaaag ccacctcctt 20 <210> 136 <211> twenty three <212> DNA <213> Artificial Sequence <400> 136 acctccaccg tccagctcat ctt 23 <210> 137 <211> 28 <212> DNA <213> Artificial Sequence <400> 137 agctcatgcc cttcggctgc ctcctgga 28 <210> 138 <211> 20 <212> DNA <213> Artificial Sequence <400> 138 tgtctttgtg ttcccggaca 20 <210> 139 <211> 20 <212> DNA <213> Artificial Sequence <400> 139 tccatgtgcc cctccttctg 20 <210> 140 <211> twenty three <212> DNA <213> Artificial Sequence <400> 140 cgtgcctctc cctccctcca gga 23 <210> 141 <211> twenty four <212> DNA <213> Artificial Sequence <400> 141 ggcacacgtg ggggttgtcc acaa 24 <210> 142 <211> 20 <212> DNA <213> Artificial Sequence <400> 142 ccgtcgctat caaggaatct 20 <210> 143 <211> 28 <212> DNA <213> Artificial Sequence <400> 143 aagccaacaa ggaaatcctc gatgtgag 28 <210> 144 <211> 19 <212> DNA <213> Artificial Sequence <400> 144 cccacacagc aaagcagaa 19 <210> 145 <211> 20 <212> DNA <213> Artificial Sequence <400> 145 ccgtcgctat caaggcatct 20 <210> 146 <211> 28 <212> DNA <213> Artificial Sequence <400> 146 aagccaacaa ggaaatcctc gatgtgag 28 <210> 147 <211> 19 <212> DNA <213> Artificial Sequence <400> 147 cccacacagc aaagcagaa 19 <210> 148 <211> 20 <212> DNA <213> Artificial Sequence <400> 148 ccgtcgctat caaggaatcg 20 <210> 149 <211> 28 <212> DNA <213> Artificial Sequence <400> 149 aagccaacaa ggaaatcctc gatgtgag 28 <210> 150 <211> 19 <212> DNA <213> Artificial Sequence <400> 150 cccacacagc aaagcagaa 19 <210> 151 <211> 20 <212> DNA <213> Artificial Sequence <400> 151 ccgtcgctat caaggaacca 20 <210> 152 <211> 28 <212> DNA <213> Artificial Sequence <400> 152 aagccaacaa ggaaatcctc gatgtgag 28 <210> 153 <211> 19 <212> DNA <213> Artificial Sequence <400> 153 cccacacagc aaagcagaa 19 <210> 154 <211> 20 <212> DNA <213> Artificial Sequence <400> 154 ccgtcgctatcaaggttccg 20 <210> 155 <211> 28 <212> DNA <213> Artificial Sequence <400> 155 aagccaacaa ggaaatcctc gatgtgag 28 <210> 156 <211> 19 <212> DNA <213> Artificial Sequence <400> 156 cccacacagc aaagcagaa 19 <210> 157 <211> 20 <212> DNA <213> Artificial Sequence <400> 157 ccgtcgctat caagacatct 20 <210> 158 <211> 28 <212> DNA <213> Artificial Sequence <400> 158 aagccaacaa ggaaatcctc gatgtgag 28 <210> 159 <211> 19 <212> DNA <213> Artificial Sequence <400> 159 cccacacagc aaagcagaa 19 <210> 160 <211> 20 <212> DNA <213> Artificial Sequence <400> 160 ccgtcgctat caaaacatct 20 <210> 161 <211> 28 <212> DNA <213> Artificial Sequence <400> 161 aagccaacaa ggaaatcctc gatgtgag 28 <210> 162 <211> 19 <212> DNA <213> Artificial Sequence <400> 162 cccacacagc aaagcagaa 19 <210> 163 <211> 20 <212> DNA <213> Artificial Sequence <400> 163 tccatgtgcc cctccttctg 20 <210> 164 <211> twenty three <212> DNA <213> Artificial Sequence <400> 164 cgtgcctctc cctccctcca gga 23 <210> 165 <211> 18 <212> DNA <213> Artificial Sequence <400> 165 ttgtccacgc tggccacg 18

Claims

1. A non-diagnostic and non-therapeutic method for multiple pre-amplification combined with fluorescent quantitative PCR to detect multiple target nucleic acids, comprising: (a) providing a sample to be tested; (b) for the sample described in (a), using a first primer pool to perform multiple pre-amplification on the target nucleic acid in the sample in a first reaction system to obtain a pre-amplification reaction mixture; wherein the primers in the first primer pool are N pairs of primers for pre-amplifying the target nucleic acid, and N is 10; The sequences of the primer pairs are as follows: (c) For the reaction mixture in the previous step, the target nucleic acid is detected in M ​​detection systems by fluorescence quantitative PCR, where M≥1. Where, M / N=1-50; Among them, there are 1-6 target nucleic acids in each detection system; The first reaction system comprises: (i) a nucleic acid sample containing or suspected of containing the target nucleic acid; (ii) a first primer pool, wherein at least one primer in each primer pair is complementary to a portion of the target nucleic acid, and both primers in each primer pair are blocking primers, each of which comprises a blocking group capable of blocking polymerase extension, wherein the blocking group is located at the 3' end of each blocking primer; (iii) a first nucleic acid polymerase and a first buffer; (iv) a deblocking agent, which enables the target nucleic acid to be polymerized by the nucleic acid polymerase through the blocking primer; The pre-amplification is performed for 10-15 cycles; The blocking group is selected from the group consisting of 2',3'-dideoxynucleotides, ribonucleotide residues, 2',3'-SH nucleotides or 2'-O-PO3 nucleotides; The detection system comprises: (i) comprising the pre-amplification reaction mixture of step (b); (ii) a second primer pool, wherein the primers in the second primer pool are primer sets for L different target nucleic acids, wherein each target nucleic acid independently corresponds to a primer set, and the primer set consists of a primer pair and a probe for fluorescent PCR used in combination, wherein the primer pair and the probe for fluorescent PCR are independently complementary to or identical to a partial sequence of the target nucleic acid; (iii) a second nucleic acid polymerase and a second buffer; The sequences of the primer pairs and probes for the fluorescent quantitative PCR are as follows:

2. The method according to claim 1, characterized in that The fluorescent quantitative PCR includes single-plex or multiplex PCR.

3. The method according to claim 1, characterized in that The target nucleic acid is selected from the group consisting of single-stranded DNA, double-stranded DNA, RNA, or a combination thereof.

4. The method according to claim 1, characterized in that The target nucleic acid is cDNA.

5. The method according to claim 1, wherein The deblocking agent is CS5 DNA polymerase, ampliTaq or KlenTaq polymerase with F667Y mutation, pyrophosphate or RNase H2, wherein the CS5 DNA polymerase has a mutation selected from G46E, L329A, Q601R, D640G, I669F, S671F, E678G or a combination thereof.

6. The method according to claim 1, characterized in that M / N=2-20.

7. The method according to claim 1, characterized in that The step (b) and step (c) are carried out in the same reaction system.

8. A detection reagent for detecting a pathogen target nucleic acid, characterized in that: The detection reagent comprises a specific primer pair set and a specific primer pair set and a probe for fluorescent quantitative PCR detection. The primers in the specific primer pair set are N pairs of primers for pre-amplifying target nucleic acids, where N is 10, and the sequences of the primer pairs are as follows: The sequences of the primers and probes in the specific primer pair set for fluorescent quantitative PCR detection are as follows:

9. Use of the detection reagent as claimed in claim 8 in preparing a kit for detecting pathogen target nucleic acid.

10. A kit for detecting a pathogen target nucleic acid, characterized in that: The kit comprises: A container A and a set of primer pairs for pre-amplifying a target nucleic acid located in the container; and A container B and a specific primer pair set and probe for fluorescent quantitative PCR detection located in the container; and instructions for use; The primer pairs for preamplifying the target nucleic acid are concentrated into 10 pairs of primer pairs for specific preamplification of multiple target nucleic acids; The sequences of the primer pairs in the primer pair set for pre-amplifying the target nucleic acid are as follows: The sequences of the specific primer pair set and probe for fluorescent quantitative PCR detection are as follows:

11. A kit for detecting EGFR protein mutation target nucleic acid, characterized in that: The kit comprises: A container A and a set of primer pairs for pre-amplifying a target nucleic acid located in the container; and A container B and a specific primer pair set and probe for fluorescent quantitative PCR detection located in the container; and instructions for use; The primer pair set for preamplifying target nucleic acids is 12 pairs of primer pairs for specific preamplification of multiple target nucleic acids; The sequences of the primer pairs in the primer pair set for pre-amplifying the target nucleic acid are as follows: The sequences of the specific primer pairs and probes used for fluorescent quantitative PCR detection are as follows:

12. The kit according to claim 10 or 11, characterized in that The container B includes a plurality of reaction tubes, and each reaction tube contains 1 to 6 primer pairs and probes in the amounts required for one fluorescence quantitative PCR reaction.

Images