Primer probe and kit for detecting mutation sites of MMACHC gene

Abstract

The present invention provides a primer probe and a kit for detecting MMACHC gene mutation sites, which can simultaneously detect 14 mutation sites of MMACHC gene, including c.1A>G, c.81+1G>A, c.217C>T, c.315C>G, c.365A>T, c.394C>T, c.445-446delTG, c.481C>T, c.482G>A, c.565C>A, c.567dupT, c.609G>A, c.626-627delTG and c.658-660delAAG. The present invention is efficient and convenient, and 14 MMACHC mutation sites are detected by 3 amplification reaction systems at one time. The detection signal is enhanced by the adjacent double probe system, and the sensitivity reaches 1ng, so that a trace blood sample can detect multiple MMACHC gene mutation sites, which is beneficial to neonatal screening detection.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a primer probe and a kit for detecting mutation sites of MMACHC genes. Background Art

[0002] Methylmalonic acidemia (MMA) is the most common disease in organic acid metabolism disorders. It is a general term for the accumulation of methylmalonic acid in the body due to various reasons. It is an autosomal recessive inheritance and is divided into two types: simple methylmalonic acidemia and methylmalonic acidemia combined with homocystinemia. In China, MMA is mainly methylmalonic acidemia combined with homocystinemia, including three subtypes: cb1C, cb1D and cb1F. About 90% of them are cb1C type. The pathogenic gene is MMACHC, and there are hotspot mutation sites.

[0003] The age of onset of methylmalonic acidemia varies, and the clinical manifestations are often non-specific. It is often misdiagnosed as general perinatal brain damage, sepsis, acute or chronic encephalopathy, or brain degeneration. Common symptoms include feeding difficulties, vomiting, tachypnea, convulsions, dystonia, lethargy, and intellectual and motor lag or regression. Currently, clinical screening and clinical diagnosis of newborns mainly rely on tandem mass spectrometry and gas chromatography-mass spectrometry to detect metabolic markers. Mass spectrometry detection is easily interfered with, has a high false positive rate, and recalls for reexamination when abnormalities are found delay treatment time. Gene mutation detection is a reliable measure for diagnosis and genotyping, especially rapid MMACHC hotspot screening through newborn dried blood spots, which avoids reexamination sampling and improves patient diagnosis time and efficiency.

[0004] Currently, the main methods for detecting the MMCHC gene include Sanger sequencing, high-throughput sequencing technology, gene chips, and time-of-flight mass spectrometry technology. The clinical application and promotion of these methods are greatly restricted due to the cumbersome detection steps, expensive instruments, and detection throughput limitations. In particular, the existing methods require a large amount of anticoagulated blood samples for DNA purification before genetic testing. It is difficult to perform rapid genetic testing on the limited dried blood spot samples collected in newborn screening centers. Summary of the invention

[0005] The purpose of the present invention is to provide a primer probe and a kit for detecting MMACHC gene mutation sites based on a multicolor probe melting curve, which can detect trace blood samples, has rapid processing, is simple and fast, has high sensitivity, strong reliability and low cost, in view of the shortcomings of the prior art, such as the need for more anticoagulated blood samples, complicated pretreatment and detection operations, long time consumption, high detection cost, easy contamination and low throughput.

[0006] The present invention is conceived as follows: adjacent quenching double probes are used for melting curve analysis, and the adjacent double probe detection system is used in combination with two probes, a mutation detection probe is labeled with a fluorescent group, and a matching anchor probe is labeled with a quenching group, and the mutation detection probe and the anchor probe are adjacent to the target DNA binding position. In the process of generating the target product DNA by PCR amplification, the two probes are annealed and hybridized on the target DNA sequence, the fluorescent group is close to the quenching group, the fluorescence of the fluorescent group is quenched, and the fluorescence signal is low. As the temperature rises, the hybrid double strand slowly melts, the fluorescently labeled mutation detection probe is separated from the anchor probe, the distance between the fluorescent group and the quenching group becomes larger, the quenching effect gradually weakens, the fluorescence signal becomes stronger, and the temperature with the fastest change rate of the fluorescence signal is the melting point (Tm) value detected by the probe. The mutation detection probe covers the mutation site to be tested. Because of the presence of the mutation site, the mutation detection probe cannot be completely combined with the mutant site in the target, resulting in a decrease in the stability of the double-stranded structure, so Tm decreases in the melting curve analysis, thereby realizing the function of detecting the genetic gene mutation site.

[0007] To achieve the purpose of the present invention, in a first aspect, the present invention provides a primer set for detecting mutation sites of the MMACHC gene, the primer set comprising a primer pair I for detecting c.1A>G and c.81+1G>A sites, a primer pair II for detecting c.217C>T sites, a primer pair III for detecting c.315C>G, c.365A>T and c.394C>T sites, a primer pair IV for detecting c.445_446delTG and c.481C>T, c.482G>A sites, a primer pair V for detecting c.565C>A, c.567dupT, c.609G>A, c.626_627delTG and c.658_660delAAG sites;

[0008] Primer pair 1 includes an upstream primer as shown in SEQ ID NO: 1 and a downstream primer as shown in SEQ ID NO: 2;

[0009] Primer pair II includes an upstream primer as shown in SEQ ID NO:3 and a downstream primer as shown in SEQ ID NO:4;

[0010] Primer pair III includes an upstream primer as shown in SEQ ID NO:5 and a downstream primer as shown in SEQ ID NO:6;

[0011] Primer pair IV includes an upstream primer as shown in SEQ ID NO:7 and a downstream primer as shown in SEQ ID NO:8;

[0012] Primer pair V includes an upstream primer as shown in SEQ ID NO:9 and a downstream primer as shown in SEQ ID NO:10.

[0013] In a second aspect, the present invention provides probes for use with the primer set, including a mutation detection probe and an anchor probe; wherein the mutation detection probe is labeled with a fluorescent group at the 5' end, and the 3' end is modified with C3 Spacer, and the 3' end of the anchor probe is labeled with a fluorescent quenching group; or, the mutation detection probe is labeled with a fluorescent group at the 3' end, and the anchor probe is labeled with a fluorescent quenching group at the 5' end, and the 3' end is modified with C3 Spacer.

[0014] c. The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the 1A>G site are shown in SEQ ID NOs: 11 and 12, respectively;

[0015] The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.81+1G>A site are shown in SEQ ID NOs: 13 and 14, respectively;

[0016] The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.217C>T site are shown in SEQ ID NOs: 15 and 16, respectively;

[0017] The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.315C>G site are shown in SEQ ID NOs: 17 and 18, respectively;

[0018] The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.365A>T site are shown in SEQ ID NOs: 19 and 18, respectively;

[0019] The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.394C>T site are shown in SEQ ID NOs: 20 and 21, respectively;

[0020] The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.481C>T and c.445_446delTG sites are shown in SEQ ID NOs: 22 and 23, respectively;

[0021] The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.482G>A site are shown in SEQ ID NOs: 24 and 23, respectively;

[0022] The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.565C>A and c.567dupT sites are shown in SEQ ID NOs: 25 and 26, respectively;

[0023] The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.609G>A site are shown in SEQ ID NOs: 27 and 26, respectively;

[0024] The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.626_627delTG site are shown in SEQ ID NOs: 28 and 29, respectively;

[0025] The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.658_660delAAG site are shown in SEQ ID NOs: 30 and 31, respectively.

[0026] The fluorescent group is selected from at least one of FAM, HEX, CY5, ROX, etc., and the fluorescence quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, etc.

[0027] In a third aspect, the present invention provides a MMACHC gene mutation site detection kit, comprising a pretreatment solution, an amplification reaction solution and a mutation detection solution, wherein the mutation detection solution is selected from at least one of mutation detection solution A, mutation detection solution B and mutation detection solution C.

[0028] The pretreatment solution is: 5% Chelex-100+0.2M NaOH.

[0029] The amplification reaction solution (6.55ul) is: 0.5-2U hot start Taq enzyme, 0.05-0.2U UNG enzyme, 1-10nmol dNTP, 1-10nmol dUTP and 5ul 5×PCR buffer; wherein the 5×PCR buffer is composed of 150-350mMTris-HCl at pH 8.8, 10-20mM MgCl2, 0.5-2.5% BSA, 0-15% mannitol, 20-80mM (NH4)2SO4, 0-0.05% Tween20 and 5-25% trehalose, and is prepared with water; preferably, the amplification reaction solution (6.55ul) is: 2U hot start Taq enzyme, 0.2U UNG enzyme, 10nmol dNTP, 10nmol dUTP and 5ul 5×PCR buffer; wherein the 5×PCR buffer is composed of 350mM Tris-HCl at pH 8.8 It is composed of Tris-HCl, 20 mM MgCl2, 2.5% BSA, 15% mannitol, 80 mM (NH4)2SO4, 0.05% Tween20 and 25% trehalose, and is prepared in water.

[0030] The mutation detection solution A is: 1.5 pmol of the primer shown in SEQ ID NO:1, 20 pmol of the primer shown in SEQ ID NO:2, 1 pmol of the primer shown in SEQ ID NO:7, 10 pmol of the primer shown in SEQ ID NO:8, 5 pmol of the probe shown in SEQ ID NO:11, 7.5 pmol of the probe shown in SEQ ID NO:13, 5 pmol of the probe shown in SEQ ID NO:22, 5 pmol of the probe shown in SEQ ID NO:24, 5 pmol of the probe shown in SEQ ID NO:12, 7.5 pmol of the probe shown in SEQ ID NO:14 and 5 pmol of the probe shown in SEQ ID NO:23, prepared with water.

[0031] The mutation detection solution B is: 1 pmol of the primer shown in SEQ ID NO:5, 10 pmol of the primer shown in SEQ ID NO:6, 1 pmol of the primer shown in SEQ ID NO:9, 0.4 μM of the primer shown in SEQ ID NO:10, 5 pmol of the probe shown in SEQ ID NO:17, 5 pmol of the probe shown in SEQ ID NO:19, 5 pmol of the probe shown in SEQ ID NO:20, 5 pmol of the probe shown in SEQ ID NO:28, 5 pmol of the probe shown in SEQ ID NO:18, 5 pmol of the probe shown in SEQ ID NO:21 and 5 pmol of the probe shown in SEQ ID NO:29, prepared in water.

[0032] The mutation detection solution C is: 1.5 pmol of the primer shown in SEQ ID NO:3, 15 pmol of the primer shown in SEQ ID NO:4, 1 pmol of the primer shown in SEQ ID NO:9, 10 pmol of the primer shown in SEQ ID NO:10, 5 pmol of the probe shown in SEQ ID NO:15, 5 pmol of the probe shown in SEQ ID NO:25, 5 pmol of the probe shown in SEQ ID NO:27, 5 pmol of the probe shown in SEQ ID NO:30, 5 pmol of the probe shown in SEQ ID NO:16, 5 pmol of the probe shown in SEQ ID NO:26 and 5 pmol of the probe shown in SEQ ID NO:31, prepared with water.

[0033] In a fourth aspect, the present invention provides use of the kit in detecting mutation sites in the MMACHC gene.

[0034] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0035] (I) Efficient and convenient, with multiple detection sites. One test detects 14 common MMACHC gene mutation sites through three amplification reaction systems.

[0036] (ii) The detection signal is enhanced by the adjacent dual-probe system, with a sensitivity of 2ng, which enables the detection of multiple MMACHC gene mutation sites in trace blood samples (3mm dried blood spots, 3ul whole blood), without adding additional blood samples, which is beneficial for newborn screening.

[0037] (III) Through a reaction system containing amplification stabilizers and optimizers, PCR amplification of genomic DNA from trace blood samples without purification can be achieved. The pre-treatment can be completed in 15 minutes and the entire test can be completed in about 2.5 hours, which is time-saving and provides a rapid clinical detection solution. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a detection effect diagram of the reaction system A in a preferred embodiment of the present invention. Among them, 1 is the FAM fluorescence signal, detecting the c.445_446delTG site; 2 is the HEX fluorescence signal, detecting the c.81+1G>A site; 3 is the ROX fluorescence signal, detecting the c.481C>T and c.482G>A sites; 4 is the CY5 fluorescence signal, detecting the c.1A>G site.

[0039] Figure 2 This is a detection effect diagram of the reaction system B in a preferred embodiment of the present invention. Among them, 1 is the FAM fluorescence signal, detecting the c.394C>T site; 2 is the HEX fluorescence signal, detecting the c.626_627delTG site; 3 is the ROX fluorescence signal, detecting the c.365A>T site; 4 is the CY5 fluorescence signal, detecting the c.315C>G site.

[0040] Figure 3 This is a detection effect diagram of the reaction system C in a preferred embodiment of the present invention. Among them, 1 is the FAM fluorescence signal, detecting the c.565C>A and c.567dupT sites; 2 is the HEX fluorescence signal, detecting the c.217C>T site; 3 is the ROX fluorescence signal, detecting the c.609G>A site; 4 is the CY5 fluorescence signal, detecting the c.658_660delAAG site.

[0041] Figure 4 The homozygous mutation and wild-type detection of each site in the reaction system A in the preferred embodiment of the present invention. Among them, A is the wild-type and homozygous mutant detection of the c.445_446delTG site; B is the wild-type and homozygous mutant detection of the c.81+1G>A site; C is the wild-type and homozygous mutant detection of the c.1A>G site; D is the wild-type and homozygous mutant detection of the c.481C>T and c.482G>A sites.

[0042] Figure 5 The homozygous mutation and wild-type detection of each site in the reaction system B in the preferred embodiment of the present invention. Among them, A is the wild-type and homozygous mutant detection of the c.394C>T site; B is the wild-type and homozygous mutant detection of the c.626_627delTG site; C is the wild-type and homozygous mutant detection of the c.315C>G site; D is the wild-type and homozygous mutant detection of the c.365A>T site.

[0043] Figure 6 This is the detection of homozygous mutation and wild type at each site of reaction system C in the preferred embodiment of the present invention. Among them, A is the detection of wild type and homozygous mutation at c.565C>A and c.567dupT sites; B is the detection of wild type and homozygous mutation at c.217C>T site; C is the detection of wild type and homozygous mutation at c.609G>A site; D is the detection of wild type and homozygous mutation at c.658_660delAAG site.

[0044] Figure 7 The c.1A>G site mutation is detected in clinical samples in a preferred embodiment of the present invention.

[0045] Figure 8 The c.81+1G>A site mutation was detected in clinical samples in a preferred embodiment of the present invention.

[0046] Fig. 9 The c.315C>G site mutation is detected in clinical samples in a preferred embodiment of the present invention.

[0047] Fig.10 The c.365A>T site mutation is detected in clinical samples in a preferred embodiment of the present invention.

[0048] Fig.11 The c.394C>T site mutation is detected in clinical samples in a preferred embodiment of the present invention.

[0049] Fig.12 The c.445_446delTG site mutation is detected in clinical samples in a preferred embodiment of the present invention.

[0050] Fig.13 The c.481C>T site mutation is detected in clinical samples in a preferred embodiment of the present invention.

[0051] Fig.14 The c.482G>A site mutation was detected in clinical samples in a preferred embodiment of the present invention.

[0052] Fig.15 The c.565C>A site mutation is detected in clinical samples in a preferred embodiment of the present invention.

[0053] Fig.16 The c.567dupT site mutation is detected in clinical samples in a preferred embodiment of the present invention.

[0054] Fig.17 The c.609G>A site mutation is detected in clinical samples in a preferred embodiment of the present invention.

[0055] Fig.18 The c.658_660delAAG site mutation is detected in clinical samples in a preferred embodiment of the present invention. DETAILED DESCRIPTION

[0056] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0057] In the present invention, the nucleotide sequence of the MMACHC gene in normal human genomic DNA can refer to bases 45500229 to 45513382 of Genbank accession number NC_000001.11.

[0058] Hot-start Taq enzyme was purchased from Sangon Biotechnology (Shanghai) Co., Ltd., catalog number B110003-2500.

[0059] UNG enzyme was purchased from Sangon Biotechnology (Shanghai) Co., Ltd., catalog number B110042-0200.

[0060] Example 1 Preparation and use of MMACHC gene mutation detection reagent

[0061] The MMACHC gene mutation detection reagent provided in this embodiment can simultaneously detect mutations at 14 sites of the MMACHC gene, including c.1A>G, c.81+1G>A, c.217C>T, c.315C>G, c.365A>T, c.394C>T, c.445_446delTG, c.481C>T, c.482G>A, c.565C>A, c.567dupT, c.609G>A, c.626_627delTG and c.658_660delAAG.

[0062] 1. Preparation of primers

[0063] Multiple pairs of primers were designed for the sequences of the 14 mutation sites. Through screening and combination, a group of primers with good specificity and effect were finally selected. The amplification primers and preferred combination sequences of each mutation site are shown in Table 1. Primers were synthesized according to the primer sequences in Table 1.

[0064] Table 1 Primer related information

[0065]

[0066] 2. Preparation of probe

[0067] Probes were prepared according to the information in Table 2. Among them, FP1-FP11 are mutation detection probes, and Q1-Q9 are anchor probes.

[0068] The fluorescent group is one of FAM, HEX, CY5, and ROX, the fluorescent quenching group is one of BHQ1, BHQ2, or BHQ3 that can match the fluorescent group, and C3 Spacer is a blocking group that prevents the probe from extending as a primer at the 3' end of the probe DNA sequence. The mutation detection probe and the anchor probe are used in combination, the mutation detection probe is 5' labeled with a fluorescent group and 3' modified with C3 Spacer, and the matching anchor probe is 3' labeled with a fluorescent quenching group; or the mutation detection probe is 3' labeled with a fluorescent group, and the matching anchor probe is 5' labeled with a fluorescent quenching group and 3' modified with C3 Spacer.

[0069] Because some mutation sites are close to each other, c.315C>G and c.365A>T sites share a quencher probe Q4, c.445_446delTG and c.481C>T, c.482G>A share a quencher probe Q6, and c.565C>A, c.567dupT and c.609G>A share a quencher probe Q7.

[0070] Table 2 Probe related information

[0071]

[0072] 3. Preparation of MMACHC gene mutation detection reagent

[0073] The pretreatment solution consists of a solute and a solvent. The solvent is water. The solute and its concentration are: 5% Chelex-100, 0.2M NaOH. Chelex-100 is purchased from Bio-Rad Biomedical Products (Shanghai) Co., Ltd., and NaOH is purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0074] Each amplification reaction solution is composed of a solvent and a solute, the solvent is water, and the solute and its concentration are: 0.305U / ul hot start Taq enzyme, 0.038U / ul UNG enzyme, 0.4mM dNTP, 0.4mM dUTP, 5×PCR buffer and water, wherein the 5×PCR buffer contains an amplification optimizer, which is composed of 75mM Tris-HCl (pH 8.8), 4mM MgCl2, 0.5% BSA, 3% mannitol, 16mM (NH4)2SO4, 0.01% Tween20, and 5% trehalose. The above reagents (except BSA) were purchased from Sangon Biotech (Shanghai) Co., Ltd., and BSA was purchased from Sigma.

[0075] The amount of amplification reaction solution (for one person) is shown in Table 3.

[0076] Table 3 Amplification reaction solution dosage

[0077] Reagents 1 serving (μl) 5×PCR buffer 5 5U / ul Hot-Taq enzyme (Shanghai Biotechnology Co., Ltd.) 0.4 10mM dNTP (Shanghai Biotech) 1 100mM dUTP (Shanghai Biotech) 0.1 5U / ul UDG enzyme (Shanghai Biotech) 0.05 total 6.55

[0078] Mutation detection solution A consists of a solvent and a solute, the solvent is water, and the solute and its concentration are shown in Tables 4 and 5.

[0079] Table 4 Solute, concentration and dosage of mutation detection solution A

[0080]

[0081] Table 5 Solutes, concentrations and dosages of mutation detection solution B

[0082]

[0083] Mutation detection solution C consists of a solvent and a solute, the solvent is water, and the solute and its concentration are shown in Table 6.

[0084] Table 6 Solute, concentration and dosage of mutation detection solution C

[0085]

[0086] 4. MMACHC gene mutation detection method

[0087] (1) Pretreatment of samples to be tested

[0088] Add 100ul of pretreatment solution to the sample to be tested (3mm dried blood spot or 3ul whole blood), heat it at 95°C for 10min to obtain a mixed solution, centrifuge the mixed solution at 5000rpm for 5min to obtain an extract.

[0089] (2) Configure the detection reaction system

[0090] Mix 6.55ul of the amplification reaction solution and 2ul of the detection genome template (test sample extract, plasmid or purified genomic DNA) with 6ul of mutation detection solution A, B, and C respectively, make up to 25ul with deionized water, and centrifuge to remove bubbles to obtain detection reaction system A, detection reaction system B, and detection reaction system C.

[0091] (3) Detection

[0092] Fluorescence quantitative PCR instrument (Shanghai Hongshi SLAN-96S) was used to perform PCR amplification and melting curve analysis on the above detection reaction system.

[0093] PCR amplification procedure:

[0094] 50℃2min, 95℃10min;

[0095] 95℃10s; 62℃10s; 72℃20s; 15 cycles;

[0096] 95℃10s; 56℃15s; 72℃20s; 50 cycles;

[0097] Melting curve analysis procedure:

[0098] Melting curve analysis was performed at 95°C for 1 min, 37°C for 3 min, and 40°C to 80°C at a temperature rising at a rate of 0.04°C / s, and the fluorescence signals of FAM, HEX, ROX, and CY5 were collected simultaneously.

[0099] (4) Results analysis

[0100] The Tm value of each channel of the reaction detection system is obtained according to the fluorescence signal by the configuration software of the fluorescence quantitative PCR instrument.

[0101] The Tm value is based on the value automatically judged by the instrument. However, when the instrument cannot give a Tm value, the Tm value can be obtained by adjusting the baseline or manual judgment.

[0102] In the standard control test, the FAM / HEX / CY5 / ROX channels in the reaction systems A / B / C all had melting peaks with Tm within the reference value range (Table 7), and the negative control had no clear melting peak, so the amplification system for this test was effective.

[0103] For the test samples, if the melting peak is missing in the FAM / HEX / CY5 / ROX channels in the reaction systems A / B / C, it means that the corresponding site amplification has failed, the test results are invalid, and the samples need to be re-extracted for testing.

[0104] Test samples, and compare the melting peaks that appear in the FAM / HEX / CY5 / ROX channels in reaction systems A / B / C with the wild-type melting peaks to determine whether a mutation has occurred based on the Tm difference.

[0105] If there is only a wild-type peak, the corresponding gene locus is wild-type;

[0106] If there is only a mutant peak, it is a homozygous mutant at the corresponding gene locus;

[0107] If both wild-type peaks and mutant peaks appear at the same time, it means the corresponding gene locus is a homozygous mutant.

[0108] There is no melting peak in each channel of the negative control detection reaction system. If there is a melting peak in the fluorescence channel of the negative control, it means that the experimental results are invalid and it is recommended to repeat the experiment.

[0109] There are no melting peaks in each channel of the standard control detection reaction system, indicating that there is a problem with the experiment. It is recommended to check whether the reagents are within the validity period or whether the PCR reaction program is set correctly.

[0110] Table 7 Reference value range of standard control melting peak Tm

[0111] Reaction system FAM channel HEX Channel ROX Channel Cy5 channel A 63.5±1.0℃ 64.5±1.0℃ 66.5±1.0℃ 68.0±1.0℃ B 62.5±1.0℃ 62.5±1.0℃ 68.5±1.0℃ 71.0±1.0℃ C 63.5±1.0℃ 65.0±1.0℃ 67.5±1.0℃ 75.0±1.0℃

[0112] The Tm value of each channel of the detection reaction system is recorded as Tm, and the Tm value of each channel of the standard control detection reaction system is recorded as Tm 标准对照 , through the formula ΔTm=Tm-Tm 标准对照 Obtain the ΔTm value, and determine whether the sample to be tested has the corresponding gene mutation, and the type of mutation according to the ΔTm value. According to the changes in the Tm values ​​of the melting peaks of the sample to be tested and the standard control in each channel in the multicolor probe melting curve analysis results, it is judged whether the sample to be tested contains the corresponding gene mutation, and the type of gene mutation. It involves reading the Tm values ​​of the sample to be tested and the standard control (automatically obtained by the configuration software of the fluorescent PCR instrument), and the standard control is used as a correction to reduce the melting point error caused by different instruments and personnel operations. Subtract the Tm value of each channel of the standard control from the Tm value of each channel of the sample to be tested to obtain the ΔTm of each channel, and judge whether the sample to be tested contains mutations and the type of mutations according to the ΔTm value of each channel (Tables 8 to 10).

[0113] Table 8

[0114]

[0115]

[0116] Table 9

[0117]

[0118] Table 10

[0119]

[0120] The detection results of reaction systems A, B, and C are shown in Figure 1 to Figure 3 .

[0121] Example 2 Detection sensitivity test

[0122] The reaction system was prepared according to Example 1, and blood DNA was purified using a genome purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and gradient dilution was performed. 10 ng, 5 ng, 2.5 ng, 1.25 ng, 0.625 ng, 0.312 ng, 0.156 ng, and 0.078 ng of genomic DNA were added to each reaction system, respectively. The detection method was the same as the "MMACHC gene mutation detection method" in Example 1.

[0123] The c.626_627delTG site had no signal at 0.156ng and 0.078ng, but had a good signal above 0.312ng. The other sites had good signals within the detected concentration range, so the detection sensitivity was set to 1ng / 25ul reaction system to ensure the quality of the detection signal.

[0124] Example 3 Detection of MMACHC gene mutation sites

[0125] The sample of this embodiment is a plasmid (relevant information is shown in Table 11), which contains the wild-type or mutant gene sequence of the MMACH gene site to be tested (commissioned to Sangon Biotechnology (Shanghai) Co., Ltd. to complete the preparation, and the sequence of each gene site was synthesized by gene synthesis and cloned into the PUC-57 plasmid).

[0126] Table 11 Gene synthesis contains each MMACHC gene site sequence plasmid

[0127]

[0128]

[0129] Plasmid Z1-Z8 was diluted to 0.1 pg / ul, and 2 ul was taken as a homozygous mutation template for amplification detection together with normal human genomic DNA. The MMACHC gene mutation detection kit prepared in Example 1 was used to detect the sample to be tested, and the detection method was the same as that in Example 1.

[0130] Test results such as Figures 4 to 6 As shown, this kit can effectively detect the wild type and homozygous mutant type of the gene locus to be tested.

[0131] Example 4 Clinical Sample Verification

[0132] In this embodiment, the samples to be tested are 15 clinical dry blood spot samples with confirmed MMACHC gene mutations and 20 normal dry blood spot samples. The MMACHC gene mutation detection reagent prepared in Example 1 is used to detect the samples to be tested, and the detection method is the same as that in Example 1. Sanger sequencing verification is used as a control.

[0133] The mutation site detection results are shown in Figure 7 to Figure 18 The success rate and accuracy of the kit of the present invention for clinical positive samples were 100%, which was consistent with the Sanger sequencing verification results (Table 12).

[0134] Table 12

[0135]

[0136]

[0137] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention. Sequence Listing <110> Suzhou Ganjiang Biotechnology Co., Ltd. <120> Primer probe and kit for detecting mutation sites of MMACHC gene <130> KHP221112596.9 <160> 31 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <400> 1 acttcattcc ccagcaagct c 21 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <400> 2 atgcccggcc tcgaccac 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 cacgcctgcc atgtttgacc 20 <210> 4 <211> twenty three <212> DNA <213> Artificial Sequence <400> 4 agccttcctc acctctctaa cac 23 <210> 5 <211> twenty three <212> DNA <213> Artificial Sequence <400> 5 cctcggacaa ggtcataact ccc 23 <210> 6 <211> twenty three <212> DNA <213> Artificial Sequence <400> 6 gcctcccatc cagaacaaag cta 23 <210> 7 <211> twenty one <212> DNA <213> Artificial Sequence <400> 7 gggacctcca tgaccttgct t 21 <210> 8 <211> twenty one <212> DNA <213> Artificial Sequence <400> 8 ggtaagtcca atcacgccag t 21 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <400> 9 ctgccccaac atcgtggac 19 <210> 10 <211> twenty three <212> DNA <213> Artificial Sequence <400> 10 cagatgaggt agcagagctc aca 23 <210> 11 <211> 16 <212> DNA <213> Artificial Sequence <400> 11 tgcgctatgg agccga 16 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <400> 12 agtcgcagag ctgaagcaga agatc 25 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <400> 13 ggtttacccc ttccaggtta gtttatc 27 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <400> 14 ggacacgcta tgtccttttg gcttcg 26 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <400> 15 ctgccacctc cgaatgctga 20 <210> 16 <211> twenty four <212> DNA <213> Artificial Sequence <400> 16 tgacccagtg gaccagtgtg tggc 24 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <400> 17 tgctgactac gaggtgcacc 20 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <400> 18 caaccgacgccccaagatcctggcccag 28 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <400> 19 cagcagccca tgtagctgg 19 <210> 20 <211> twenty three <212> DNA <213> Artificial Sequence <400> 20 ctactaccaa cgacaagatg tgg 23 <210> twenty one <211> twenty three <212> DNA <213> Artificial Sequence <400> twenty one ggctgaccca tgggggaacc agg 23 <210> twenty two <211> twenty three <212> DNA <213> Artificial Sequence <400> twenty two cgcatatcag gtgtgtgcat aca 23 <210> twenty three <211> twenty two <212> DNA <213> Artificial Sequence <400> twenty three ccccgatttg ggggctggtt tg 22 <210> twenty four <211> 19 <212> DNA <213> Artificial Sequence <400> twenty four catccgagggtagtgctg 19 <210> 25 <211> 19 <212> DNA <213> Artificial Sequence <400> 25 caagagctga ccgtatcgc 19 <210> 26 <211> 27 <212> DNA <213> Artificial Sequence <400> 26 ctactcgaag gcttcaatttccactgg 27 <210> 27 <211> twenty one <212> DNA <213> Artificial Sequence <400> 27 gtgattggac ttaccgggat g 21 <210> 28 <211> twenty one <212> DNA <213> Artificial Sequence <400> 28 gtgattggac ttaccgggat g 21 <210> 29 <211> 27 <212> DNA <213> Artificial Sequence <400> 29 ctactcgaag gcttcaatttccactgg 27 <210> 30 <211> 34 <212> DNA <213> Artificial Sequence <400> 30 gcgctactca gaagagcaga aggcctacttctcc 34 <210> 31 <211> 29 <212> DNA <213> Artificial Sequence <400> 31 ctccacctgc ccaacgattg gccctattg 29

Claims

1. A primer set and a probe for detecting a mutation site of the MMACHC gene, characterized in that: The primer set includes a primer pair I for detecting c.1A>G and c.81+1G>A sites, a primer pair II for detecting c.217C>T sites, a primer pair III for detecting c.315C>G, c.365A>T and c.394C>T sites, a primer pair IV for detecting c.445_446 delTG and c.481C>T, c.482G>A sites, and a primer pair V for detecting c.565C>A, c.567dupT, c.609G>A, c.626_627delTG and c.658_660 delAAG sites; Primer pair 1 includes an upstream primer as shown in SEQ ID NO: 1 and a downstream primer as shown in SEQ ID NO: 2; Primer pair II includes an upstream primer as shown in SEQ ID NO:3 and a downstream primer as shown in SEQ ID NO:4; Primer pair III includes an upstream primer as shown in SEQ ID NO:5 and a downstream primer as shown in SEQ ID NO:6; Primer pair IV includes an upstream primer as shown in SEQ ID NO:7 and a downstream primer as shown in SEQ ID NO:8; Primer pair V includes an upstream primer as shown in SEQ ID NO:9 and a downstream primer as shown in SEQ ID NO:10; The probe includes a mutation detection probe and an anchor probe; wherein the 5' end of the mutation detection probe is labeled with a fluorescent group, and the 3' end is modified with C3 Spacer, and the 3' end of the anchor probe is labeled with a fluorescent quenching group; or, the 3' end of the mutation detection probe is labeled with a fluorescent group, and the 5' end of the anchor probe is labeled with a fluorescent quenching group, and the 3' end is modified with C3 Spacer; c. The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the 1A>G site are shown in SEQ ID NOs: 11 and 12, respectively; The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.81+1G>A site are shown in SEQ ID NOs: 13 and 14, respectively; The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.217C>T site are shown in SEQ ID NOs: 15 and 16, respectively; The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.315C>G site are shown in SEQ ID NOs: 17 and 18, respectively; The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.365A>T site are shown in SEQ ID NOs: 19 and 18, respectively; The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.394C>T site are shown in SEQ ID NOs: 20 and 21, respectively; The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.445_446 delTG site are shown in SEQ ID NOs: 22 and 23, respectively; The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.481C>T and c.482G>A sites are shown in SEQ ID NOs: 24 and 23, respectively; The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.565C>A and c.567dupT sites are shown in SEQ ID NOs: 25 and 26, respectively; The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.609G>A site are shown in SEQ ID NOs: 27 and 26, respectively; The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.626_627delTG site are shown in SEQ ID NOs: 28 and 29, respectively; The nucleotide sequences of the mutation detection probe and anchor probe corresponding to the c.658_660 delAAG site are shown in SEQ ID NOs: 30 and 31, respectively.

2. The primer set and probe according to claim 1, characterized in that: The fluorescent group is selected from at least one of FAM, HEX, CY5, and ROX, and the fluorescence quenching group is selected from at least one of BHQ1, BHQ2, and BHQ3.

3. A kit for detecting mutation sites of MMACHC gene, characterized in that: It comprises a pre-treatment solution, an amplification reaction solution and a mutation detection solution, wherein the mutation detection solution is selected from mutation detection solution A, mutation detection solution B and mutation detection solution C; The pretreatment solution is: 5% Chelex-100 + 0.2M NaOH; The amplification reaction solution comprises: 0.5-2U hot start Taq enzyme, 0.05-0.2U UNG enzyme, 1-10 nmol dNTP, 1-10nmol dUTP and 5ul 5×PCR buffer; wherein the 5×PCR buffer is composed of 150-350 mM Tris-HCl at pH 8.8, 10-20 mM MgCl2, 0.5-2.5% BSA, 0-15% mannitol, 20-80 mM (NH4)2SO4, 0-0.05% Tween20 and 5-25% trehalose, and is prepared with water; The mutation detection solution A is: 1.5 pmol of the primer shown in SEQ ID NO:1, 20 pmol of the primer shown in SEQ ID NO:2, 1 pmol of the primer shown in SEQ ID NO:7, 10 pmol of the primer shown in SEQ ID NO:8, 5 pmol of the probe shown in SEQ ID NO:11, 7.5 pmol of the probe shown in SEQ ID NO:13, 5 pmol of the probe shown in SEQ ID NO:22, 5 pmol of the probe shown in SEQ ID NO:24, 5 pmol of the probe shown in SEQ ID NO:12, 7.5 pmol of the probe shown in SEQ ID NO:14 and 5 pmol of the probe shown in SEQ ID NO:23, prepared in water; The mutation detection solution B is: 1 pmol of the primer shown in SEQ ID NO:5, 10 pmol of the primer shown in SEQ ID NO:6, 1 pmol of the primer shown in SEQ ID NO:9, 0.4 μM of the primer shown in SEQ ID NO:10, 5 pmol of the probe shown in SEQ ID NO:17, 5 pmol of the probe shown in SEQ ID NO:19, 5 pmol of the probe shown in SEQ ID NO:20, 5 pmol of the probe shown in SEQ ID NO:28, 5 pmol of the probe shown in SEQ ID NO:18, 5 pmol of the probe shown in SEQ ID NO:21 and 5 pmol of the probe shown in SEQ ID NO:29, prepared in water; The mutation detection solution C is: 1.5 pmol of the primer shown in SEQ ID NO:3, 15 pmol of the primer shown in SEQ ID NO:4, 1 pmol of the primer shown in SEQ ID NO:9, 10 pmol of the primer shown in SEQ ID NO:10, 5 pmol of the probe shown in SEQ ID NO:15, 5 pmol of the probe shown in SEQ ID NO:25, 5 pmol of the probe shown in SEQ ID NO:27, 5 pmol of the probe shown in SEQ ID NO:30, 5 pmol of the probe shown in SEQ ID NO:16, 5 pmol of the probe shown in SEQ ID NO:26 and 5 pmol of the probe shown in SEQ ID NO:31, prepared with water.

Images