A nucleic acid aptamer specifically binding to OX40 protein and its application
The SELEX technology screened out nucleic acid aptamers with high specificity and good stability, which solved the shortcomings of existing nucleic acid aptamers in human OX40 protein binding and achieved effective application in tumor immunotherapy.
Patent Information
- Application Number
- CN202111364534.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-11-17
- Publication Date
- 2024-12-27
- Estimated Expiration
- 2041-11-17
AI Technical Summary
The existing OX40/OX40L nucleic acid aptamers have problems such as low target specificity, insufficient binding affinity, large molecular weight and poor stability in practical applications, which limits their application in human tumor immunotherapy.
Nucleic acid aptamers with high specificity, low molecular weight, stable chemical properties, easy preservation and labeling, including specific DNA sequences and their derivatives, can bind efficiently through exponentially enriched ligand system evolution technology (SELEX). Human OX40 protein and improves its affinity and stability through modification and conjugate.
It achieves a high specific binding of OX40 protein, improves the stability and application potential of nucleic acid aptamers, and is suitable for the purification, detection, cell localization and tumor immunotherapy of OX40 protein.
Smart Images
Figure CN115386581B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a nucleic acid aptamer specifically binding to OX40 protein and an application thereof. Background Art
[0002] T cell activation is not only mediated by antigen stimulation of T cell receptors, but also by the induction of co-stimulatory signals through certain co-stimulatory molecules. LES of the co-stimulatory molecule tumor necrosis factor (TNF) superfamily plays an important role in regulating immune responses and inducing bidirectional signals. OX40 (CD 134) and OX40L (CD 252), members of the tumor necrosis factor receptor superfamily (TNFRSF) and tumor necrosis factor superfamily (TNFSF), play an important role in the proliferation and survival of T cells, and are also abnormally expressed in tumors, infectious, inflammatory and autoimmune diseases.
[0003] OX40, also known as Tnfrsf4 (Tumor necrosis factor receptor superfamily, member4), has a co-stimulatory function. It is a 50kD glycoprotein with a cytoplasmic tail, a transmembrane domain and an extracellular region. It is mainly expressed on the surface of activated CD4+ and CD8+ T cells, and binding to OX40L can stimulate the activation of CD8+ T cells. Through the co-activation effect of OX40 / OX40L signals, the functions of T cells, including cytokine production, proliferation and survival of T cells, will be further enhanced. OX40 antibody activator (Agonist) can reduce Tregs in tumors and improve anti-tumor activity. Currently available data show that a variety of OX40 antibody drugs have entered the clinical research stage, and more and more OX40 antibody drugs will enter the clinical stage in the future. The OX40 target drug research and development market has great development potential, and the feasibility of OX40 / OX40L nucleic acid aptamers with similar functions to its antibodies for tumor immunotherapy has also been widely studied.
[0004] Aptamers are DNA or RNA molecules separated by systematic evolution of ligands by exponential enrichment (SELEX). They can bind to other targets such as proteins, metal ions, small molecules, peptides, and even whole cells with high affinity and specificity, and therefore have broad prospects in biochemical analysis, environmental monitoring, basic medicine, and new drug synthesis. Compared with antibodies, aptamers have smaller molecular weights, better stability, easier modification, no immunogenicity, shorter production cycles, and can be synthesized artificially, eliminating a series of processes such as animal immunization, feeding, protein extraction, and purification.
[0005] Based on the screening principle of SELEX, the feasibility of using OX40 / OX40L aptamers for tumor immunotherapy has also been widely studied. At present, some researchers have published some OX40 aptamer sequences they have discovered, and verified their ability to resist tumor proliferation in mouse models. It was found that OX40 / OX40L aptamers and OX40 / OX40L antibodies have similar anti-tumor immune effects. However, these OX40 / OX40L aptamers have some disadvantages. For example, some aptamers target mouse OX40 / OX40L proteins, which are limited in practical application; some aptamers have large molecular weights, and their binding affinity for OX40 proteins is not very high, their specificity is poor, and their stability is not high. Therefore, there is a demand in this field for aptamers with higher binding affinity for human OX40 / OX40L proteins. Summary of the invention
[0006] Based on the technical problems existing in the background technology, the present invention proposes a nucleic acid aptamer, a conjugate of a nucleic acid aptamer, a derivative of a nucleic acid aptamer and their applications which can bind to OX40 protein and have high specificity, small molecular weight, stable chemical properties, and are easy to store and label.
[0007] The present invention provides a nucleic acid aptamer that specifically binds to the OX40 protein, wherein the nucleotide sequence of the nucleic acid aptamer comprises at least one of the following three sequences:
[0008] (1) A DNA sequence as shown in any one of SEQ ID NOs: 1-4, wherein:
[0009] SEQ ID NO: 1 is
[0010] TCCAGCACTCCACGCATAACCCACACACCGTGTCTGCCCTCCGGTCCCCGCATTAGGTTATGCGTGCGACGGTGAA,
[0011] SEQ ID NO:2 is
[0012] TCCAGCACTCCACGCATAACTCCCGCTCCGATCGCGTGCGTTGACACCGTGTCCGGGTTATGCGTGCGACGGTGAA,
[0013] SEQ ID NO:3 is
[0014] TCCAGCACTCCACGCATAACCACATCGGTCGGGCTGCTCGAGGCTTGCGCAAACCAGTTATGCGTGCGACGGTGAA,
[0015] SEQ ID NO:4 is
[0016] TCCAGCACTCCACGCATAACCCCCCCCTGCACCCCAGGTCTTCCGCGCCCGGACGAGTTATGCGTGCGACGGTGAA;
[0017] (2) a DNA sequence that has 60% or more homology to the DNA sequence shown in any one of SEQ ID NOs: 1-4 and specifically binds to the OX40 protein, preferably 70% or more, 80% or more, 85% or more, 90% or more, 92% or more, 94% or more, 96% or more, 98% or more, or 99% or more;
[0018] (3) An RNA sequence transcribed from a DNA sequence shown in any one of SEQ ID NOs: 1-4 and specifically binding to OX40 protein.
[0019] In addition, those skilled in the art should understand that as an improvement to the above technical solution, a certain position on the nucleotide sequence of the above-mentioned nucleic acid aptamer can be modified, for example, phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium, or isotope connection, etc., provided that the nucleic acid aptamer sequence obtained after such modification has desirable properties, for example, it can have an affinity for binding to highly expressed OX40 protein that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.
[0020] On the other hand, the present invention also provides a conjugate of nucleic acid aptamers. Those skilled in the art should understand that as an improvement to the above technical solution, a fluorescent marker, such as a radioactive substance, a therapeutic substance, biotin, digoxin, a nanoluminescent material, a small peptide, siRNA or an enzyme marker, etc., can be connected to the nucleotide sequence of the above nucleic acid aptamer, provided that the nucleic acid aptamer sequence obtained after such modification has desirable properties, for example, it can have an affinity for binding to highly expressed OX40 protein equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.
[0021] In other words, the above aptamer sequences, whether partially substituted or modified, have substantially the same or similar molecular structures, physicochemical properties and functions as the original aptamers, and can be used to bind to highly expressed OX40 proteins.
[0022] As a general inventive concept, the present invention also provides a derivative of a nucleic acid aptamer, which is obtained by transforming the backbone of the nucleotide sequence of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer into a thiophosphate backbone, or transforming the nucleic acid aptamer or the conjugate of the nucleic acid aptamer into a peptide nucleic acid, provided that the derivatives have a molecular structure, physicochemical properties and functions that are substantially the same or similar to those of the original nucleic acid aptamer, and all bind to the highly expressed OX40 protein.
[0023] The term "phosphorothioate backbone" as used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to that the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA aptamers can be replaced by one or two sulfur atoms, resulting in a phosphorothioate backbone with phosphorothioate or phosphorodithioate bonds, respectively. Such phosphorothioate backbones are known to have increased binding affinity to their targets, as well as enhanced resistance to nuclease degradation.
[0024] The term "peptide nucleic acid" used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to an artificially synthesized DNA molecule analog, first reported by Nielsen et al. in 1991. Oligonucleotide mimics linked by peptide bonds were synthesized using N-2-(aminoethyl)-glycine units instead of sugar-phosphate backbones as repeating structural units, and are called peptide nucleic acids. Since peptide nucleic acids (PNA) do not have phosphate groups like those on DNA or RNA, there is a lack of electrical repulsion between PNA and DNA, making the binding strength between the two greater than the binding strength between DNA.
[0025]
[0026] As a general inventive concept, the present invention also provides the use of the nucleic acid aptamer or the nucleic acid aptamer conjugate or the nucleic acid aptamer derivative in any one of the following groups:
[0027] (1) Purify OX40 protein or detect OX40 protein;
[0028] (2) Localization imaging of cells, tissues or living organisms expressing OX40;
[0029] (3) capturing cells or exosomes expressing OX40;
[0030] (4) Immunotherapy in tumor treatment.
[0031] As a general inventive concept, the present invention also provides the use of the nucleic acid aptamer or the nucleic acid aptamer conjugate or the nucleic acid aptamer derivative in the preparation of a drug for targeting tumors.
[0032] In one embodiment, the nucleic acid aptamer, its conjugate or derivative thereof, preferably the nucleic acid aptamer of the present invention can be used for OX40 protein purification or detection, and for detecting the expression level of OX40 in tumor tissue of a subject.
[0033] As a general inventive concept, the present invention also provides a kit comprising the nucleic acid aptamer or the conjugate of the nucleic acid aptamer or the derivative of the nucleic acid aptamer; preferably, the kit comprises any one or two nucleic acid aptamers, their conjugates or their derivatives shown in SEQ ID NO:1-4; more preferably, the kit comprises any one or two nucleic acid aptamers shown in SEQ ID NO:1-4.
[0034] As a general inventive concept, the present invention also provides the use of the nucleic acid aptamer or the nucleic acid aptamer conjugate or the nucleic acid aptamer derivative in the preparation of a kit, wherein the kit is used to select any one of the following groups:
[0035] (1) Purify OX40 protein or detect OX40 protein;
[0036] (2) Localization imaging of cells, tissues or living organisms expressing OX40;
[0037] (3) capturing cells or exosomes expressing OX40;
[0038] (4) Inhibit tumor proliferation and metastasis;
[0039] (5) Activate lymphocytes and promote cytokine release.
[0040] The present invention uses the in vitro exponential enrichment ligand systematic evolution (SELEX) technology to screen out nucleic acid aptamers that specifically bind to highly expressed OX40 proteins. Specifically, the inventors designed and synthesized a random single-stranded DNA library and corresponding primers to screen nucleic acid aptamers that are highly specific, small in molecular weight, chemically stable, easy to store and label, and can bind to highly expressed OX40 proteins, thereby screening out some nucleic acid aptamers that specifically bind to OX40 proteins, and detecting their binding ability to OX40 proteins.
[0041] The beneficial effects of the present invention are as follows:
[0042] The nucleic acid aptamer, its conjugate and its derivative provided by the present invention can bind to OX40 protein with high specificity, and has small molecular weight, stable chemical property, and is easy to store and label. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] Figure 1 This is the affinity detection data (SPR data) between OX40-29 and OX40 protein obtained by screening in Example 1 of the present invention.
[0044] Figure 2 This is the affinity detection data (SPR data) between OX40-92 and OX40 protein obtained by screening in Example 1 of the present invention.
[0045] Figure 3 This is the affinity detection data (SPR data) between OX40-10 and OX40 protein obtained by screening in Example 1 of the present invention.
[0046] Figure 4 This is the affinity detection data (SPR data) of OX40-61 and OX40 protein obtained by screening in Example 1 of the present invention.
[0047] Figure 5 The dot blot results of OX40-92. DETAILED DESCRIPTION
[0048] The technical solution of the present invention is described in detail below through specific embodiments.
[0049] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all conventional biochemical reagents, which can be purchased through commercial channels unless otherwise specified.
[0050] Example 1: Screening of ssDNA nucleic acid aptamers that specifically bind to OX40 protein
[0051] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequence:
[0052] Random single-stranded DNA library:
[0053] 5'-TCCAGCACTCCACGCATAAC-36N-GTTATGCGTGCGACGGTGAA-3'
[0054] Among them, "36N" represents a sequence formed by connecting 36 arbitrary nucleotide bases. The library was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.
[0055] Primer information is shown in Table 1 and was synthesized by Nanjing GenScript Biotechnology Co., Ltd.
[0056] Table 1 Primers and their sequences
[0057]
[0058] Among them, S in the primer name represents the forward primer, A in the primer name represents the reverse primer, the 19 A in the sequence represents the polyA tail composed of 19 adenylic acids (A), and "Spacer 18" represents the 18-atom hexaethylene glycol spacer. The structural formulas of the three "Spacer 18" are shown in Formulas I-III below. The structural formula of "Spacer 18" used in the above 3' end primer is shown in Formula I.
[0059]
[0060] The primers were prepared into 100 μM stock solution using MES buffer (MES: 100 mM, NaCl: 150 mM, KCl: 1 mM, MgCl2: 1 mM, CaCl2: 1 mM; pH 6.0, 25°C) and stored at -20°C for future use.
[0061] 2. Magnetic bead screening
[0062] The magnetic bead method was used for screening, and a total of six rounds of screening were performed. The screening process of each round is shown in Table 2.
[0063] Table 2 OX40 protein aptamer screening process
[0064]
[0065]
[0066] The specific screening methods are as follows:
[0067] 1) Carboxyl magnetic beads to immobilize OX40 protein
[0068] Take 50 μl carboxyl magnetic beads (Invitrogen, Dynabeads TM MyOne TM Carboxylic Acid, #65012), washed 4 times with 200μl ultrapure water, fished the magnetic beads with a magnet, and removed the supernatant. Take the prepared NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution), mix them in equal volumes, add them to the magnetic beads, incubate at 25℃ for 20 minutes to activate the carboxyl groups on the surface of the magnetic beads, and wash the magnetic beads twice with MES buffer for use.
[0069] Take 80 μl of OX40 protein (the OX40 protein was molecularly cloned and expressed in Escherichia coli using the gene sequence of amino acids 18-132 of NCBI Reference Sequence: NP_054862.1) (concentration of 0.1 mg / ml), add 20 μl of pH 3.0 glycine hydrochloride solution, mix well, and add to the above-mentioned activated magnetic beads. Incubate at 25°C on a vertical mixer for 50 minutes, and the OX40 protein is coupled to the surface of the magnetic beads through the amino groups on the protein surface.
[0070] After the coupling is completed, place the coupling tube on a magnetic rack, discard the supernatant, take 100μl 1M ethanolamine pH8.5 and add it to the magnetic beads, incubate on a 25℃ vertical mixer for 10min to block the unreacted activation sites on the surface of the magnetic beads. Place it on a magnetic rack and discard the blocking solution. Wash the magnetic beads 4 times with 200μl MES and mark them as MB-OX40.
[0071] 2) Reverse screening
[0072] The magnetic beads with BSA protein (labeled as MB-BSA) were used for reverse screening. The method of coupling BSA protein was the same as that of coupling OX40 protein. The concentration of BSA protein was 0.5 mg / ml and diluted with 10 mM NaAC solution at pH 4.0. Each round of magnetic bead screening was performed with BSA reverse screening protein magnetic beads before the positive screening with OX40 protein as the target. The reverse screening steps were as follows: the prepared single-stranded nucleotide library was renatured and incubated with 50 μl MB-BSA magnetic beads and incubated at 25°C on a vertical rotator for 30 minutes. Place it on a magnetic stand and collect the supernatant. The supernatant was used as the single-stranded nucleotide library for positive screening with MB-OX40 magnetic beads.
[0073] 3) Magnetic bead screening
[0074] Take 1OD of random single-stranded nucleotide library, centrifuge at 14000rpm for 10 minutes, centrifuge the library to the bottom of the tube, dissolve it to 10μM with MES buffer, and distribute it to PCR tubes for denaturation treatment. The processing process is as follows: set the PCR instrument program to 95℃ for 10 minutes. The purpose of this step is to unwind the folded chain, then keep it at 4℃ for 5 minutes, and then keep it at 25℃ for 5 minutes. Add the processed library to 50μl of MB-BSA magnetic beads, mix well, and incubate at 25℃ on a vertical mixer for 30 minutes. Place it on a magnetic stand, collect the supernatant, mark it as pool-, and use the supernatant as a single-stranded nucleotide library for positive screening with MB-OX40 magnetic beads.
[0075] The library after counter-screening was added to 50 μl MB-OX40 magnetic beads and incubated at 25°C for 50 minutes on a vertical mixer. The beads were placed on a magnetic stand, the supernatant was discarded, the magnetic beads were retained, and the magnetic beads were washed 4 times with 200 μl MES. After washing, the magnetic beads were added to 200 μl MES boiling water bath for 10 minutes, and the supernatant was collected and labeled as elution-OX40.
[0076] The nucleic acid molecules in elution-OX40 were used as templates and amplified by emulsion PCR (ePCR). The method is as follows: add all template elution-OX40 to 2 ml PCR mix and mix well, add 4 times the volume of ePCR microdroplet generation oil, and vortex to prepare emulsion. The emulsion was divided into 100 μl / tube and added to the PCR tube. The amplification conditions were as follows: 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 60 seconds, 60℃ annealing for 60 seconds, 72℃ extension for 60 seconds, a total of 35 cycles, and stored at 4℃. ePCR microdroplet generation oil was purchased from Anhui Aptamy Biotechnology Co., Ltd. (Cat. No.: EPO100). The formula of PCR mix is shown in Table 3.
[0077] Table 3 ePCR mix formula
[0078] Reagents Total volume 1000 μl <![CDATA[ddH2O]]> 866μl 10*pfu enzyme buffer 100μl dNTPmix (10mM) 20μl Forward primer lib18S1-FAM (100 μM) 5μl Reverse primer lib18A2-ployA (100 μM) 5μl Pfu enzyme 4μl(200U)
[0079] The amplified product was purified with n-butanol: all ePCR products were collected in a 15 ml conical bottom centrifuge tube, 2 volumes of n-butanol were added, and the mixture was shaken on a vortex mixer to mix thoroughly; the mixture was centrifuged at 9000 rpm (revolutions / minute) at 25°C for 10 minutes on a desktop centrifuge; the upper phase (n-butanol) was removed to obtain concentrated PCR amplified products, TBE / urea denaturation buffer was added at a volume ratio of 1:1, and the DNA was denatured by boiling for 15 minutes, followed by an ice bath for 1 minute. All samples were subjected to urea denatured polyacrylamide gel electrophoresis at a voltage of 400 V until bromophenol blue reached the bottom of the gel to separate the extended FAM-labeled chain from the reverse chain. The formula of 7 M urea denatured polyacrylamide gel is shown in Table 4.
[0080] Table 4 Denaturing polyacrylamide gel formula
[0081] Element Dosage Urea 3.78g 40% Polyacrylamide 1.8ml 5*TBE 1.8ml <![CDATA[ddH2O]]> 2.25ml 10% APS 60μl TEMED 15μl
[0082] Gel excision to recover FAM-labeled chains: Take out the gel and place it on a plastic film, Ex (nm): 495, Em (nm): 517 to detect the FAM-labeled ssDNA we need; Use a clean blade to cut the target band directly, transfer the gel strip to a 1.5ml EP tube and crush it, add 1ml ddH2O and boil in a water bath for 10 minutes to transfer the ssDNA in the gel to the solution, centrifuge to remove the gel fragments, and keep the supernatant. The supernatant is purified with n-butanol, the method is: add 2 volumes of n-butanol, shake on a vortex mixer to mix thoroughly; desktop centrifuge, 9000rpm (revolutions / minute) at 25°C centrifuge for 10 minutes; remove the upper phase (n-butanol), and dialyze the DNA single chain with a 3KD dialysis bag overnight, which can be used as the library for the next round of screening;
[0083] The magnetic bead method was used to repeat 6 rounds of screening. Each operation used the secondary library obtained in the previous operation as the starting nucleic acid library. During the screening process, SPR was used to detect the changes in the recognition ability of the DNA single-stranded library for the OX40 protein. When the recognition ability of the DNA single-stranded library for the OX40 protein met the requirements, that is, the binding ability of the screened DNA single-stranded library to the target was higher than that of the initial input library for the screening, the obtained products were cloned and sequenced to finally obtain nucleic acid aptamers.
[0084] In the screening method, the screening pressure can be increased round by round to improve the enrichment of the aptamers and shorten the screening process. The increased screening pressure includes reducing the amount of the single-stranded DNA library, the amount of the target protein and the incubation time of the two, increasing the washing time, the number of washings and increasing the amount of the counter-screening magnetic beads.
[0085] 3. Analyze and identify the nucleic acid aptamers obtained after multiple screenings. After cloning and sequencing the obtained enriched library products, select several sequences to be synthesized by Shanghai Bioengineering and test affinity.
[0086] In subsequent tests, four sequences were determined to have strong binding abilities. After truncating the four sequences, nucleic acid aptamers shown in SEQ ID NO: 1-4 were obtained, and after verification, they had ideal affinity for binding to OX40 protein. They were named OX40-29, OX40-92, OX40-10 and OX40-61, respectively.
[0087] Example 2: Surface Plasmon Resonance (SPR) Detection of Affinity between OX40 Aptamer and OX40 Protein
[0088] 1. The nucleic acid aptamers OX40-29 (SEQ ID NO: 1), OX40-92 (SEQ ID NO: 2), OX40-10 (SEQ ID NO: 3) and OX40-61 (SEQ ID NO: 4) synthesized by Shanghai Biotechnology were diluted with MES buffer to: 0.390625, 1.5625, 12.5, 25, 50 nM; and 0.78125, 1.5625, 3.125, 6.25, 12.5 nM, respectively.
[0089] 2. The OX40 protein prepared in Example 1 was coupled to the BSA chip surface: first, the chip was cleaned with 50 mM NaOH, 20 μl was injected, and the flow rate was 10 μl / min. Then, equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1 M aqueous solution) were mixed and 50 μl was injected to activate the chip at a flow rate of 5 μl / min. The OX40 protein was diluted with 10 mM sodium acetate at pH 4.0 to a final concentration of 50 μg / mL and then injected. The injection volume was 50 μL, the flow rate was 5 μL / min, and the OX40 protein coupling amount was 5000 Ru. After the injection was completed, ethanolamine was injected to seal the chip at a flow rate of 5 μL / min and 50 μL was injected.
[0090] 3. Detection: Use a surface plasmon resonance instrument (GE Healthcare, model: Biacore T200) to set the kinetic detection parameters, injection 30 μL / min*3min, dissociation 30 μL / min*5min, regeneration 1M NaCl 30 μL / min*0.5min, and inject the diluted nucleic acid aptamers OX40-29 and OX40-92 of various concentrations in sequence.
[0091] Affinity test data can be found in Figure 1 (OX40-29) and Figure 2 (OX40-92), these data indicate that both OX40-29 and OX40-92 were detected to have strong binding with OX40 protein by SPR instrument, and the KD values were 3.438nM and 0.9944nM, respectively.
[0092] Example 3: Identification of the affinity of OX40-92 nucleic acid aptamer to OX40 protein by dot blot hybridization
[0093] 1. Take a 10cm×5cm nitrocellulose membrane (purchased from Millipore), dilute the OX40 protein with MES to the following concentrations: 0.5 / 0.17 / 0.05 / 0.017 / 0.005mg / ml. Spot 1ul on the nitrocellulose membrane and air dry. At the same time, dilute the control protein (CD172) to 0.5mg / ml, spot on the membrane and air dry.
[0094] 2. After drying, block with 10% BSA at room temperature for 6 hours. After blocking, wash with MES 3 times, aspirate clean, and place on a shaker during washing, 10 minutes each time.
[0095] 3. Dilute the biotin-modified nucleic acid aptamer OX40-92 to 1uM and denature it: denature it at 95°C for 10 minutes, then immediately place it in an ice bath for 5 minutes, and then equilibrate it at room temperature for 10 minutes.
[0096] 4. The renatured aptamers and the proteins on the nitrocellulose membrane were incubated on a shaker at room temperature for 2 hours.
[0097] 5. After incubation, wash three times with MEST (containing 0.5‰ tween20), placing on a shaker for 10 minutes each time.
[0098] 6. Add HRP-labeled streptavidin (purchased from Bio-Time, catalog number A0303) prepared with MES at a dilution of 1:10000 (v / v) and incubate on a shaker at room temperature for 30 minutes.
[0099] 7. Wash MEST 3 times, placing on a shaker for 10 minutes each time.
[0100] 8. Add color developing solution (BeyoECL Star ultra-sensitive ECL chemiluminescence kit, purchased from Beyotime, item number P0018A, solution A and solution B are the solutions provided by the kit) at a ratio of solution A: solution B = 1:1 (v / v), and develop color at room temperature for 1 minute.
[0101] 9. Imaging system observation and photography: The instrument used is ImageQuant from GE Healthcare Life Sciences TM LAS 4000 digital imaging system.
[0102] The results are as follows Figure 5 As shown, the experimental group showed obvious coloration, while the control CD172 protein did not show any coloration. This indicates that the biotin-modified aptamer OX40-92 can be used for the detection of membrane hybridization OX40 protein and does not bind to the control protein CD172. Figure 5It also includes the changes in the concentration gradient of each protein and the control protein. It can be seen that as the concentration of OX40 protein decreases, the color of the colored spots becomes lighter, which shows that OX40-92 can be used for the detection of membrane hybridization OX40 protein with high sensitivity. The aptamer obtained by the present invention does not bind to the CD172 protein.
[0103] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention. SEQUENCE LISTING <110> Anhui Province Angpu Tomai Biotechnology Co., Ltd. <120> A nucleic acid aptamer specifically binding to OX40 protein and its application <130> 2021 <160> 4 <170> PatentIn version 3.3 <210> 1 <211> 76 <212> DNA <213> Synthesis <400> 1 TCCAGCACTCCACGCATAACCCACACACCGTGTCTGCCCTCCGGTCCCCGCATTAGGTTATGCGTGCGACGGTGAA 76 <210> 2 <211> 76 <212> DNA <213> Synthesis <400> 2 TCCAGCACTCCACGCATAACTCCCGTCCCGATCGCGTGCGTTGACACCGTGTCCGGGTTATGCGTGCGACGGTGAA 76 <210> 3 <211> 76 <212> DNA <213> Synthesis <400> 3 TCCAGCACTCCACGCATAACCACATCGGTCGGGCTGCTCGAGGCTTGCGCAAACCAGTTATGCGTGCGACGGTGAA 76 <210> 4 <211> 76 <212> DNA <213> Synthetic <400> 4 TCCAGCACTCCACGCATAACCCCCCCCTGCACCCCAGGTCTTCCGCGCCCGGACGAGTTATGCGTGCGACGGTGAA 76
Claims
1. A nucleic acid aptamer that specifically binds to OX40 protein, characterized in that: The nucleotide sequence of the nucleic acid aptamer includes a DNA sequence shown in any one of SEQ ID NOs: 1-4, wherein: SEQ ID NO: 1 is TCCAGCACTCCACGCATAACCCACACACCGTGTCTGCCCTCCGGTCCCCGCATTAGGTTATGCGTGCGACGGTGAA, SEQ ID NO:2 is TCCAGCACTCCACGCATAACTCCCGCTCCGATCGCGTGCGTTGACACCGTGTCCGGGTTATGCGTGCGACGGTGAA, SEQ ID NO:3 is TCCAGCACTCCACGCATAACCACATCGGTCGGGCTGCTCGAGGCTTGCGCAAACCAGTTATGCGTGCGACGGTGAA, SEQ ID NO:4 is TCCAGCACTCCACGCATAACCCCCCCCTGCACCCCAGGTCTTCCGCGCCCGGACGAGTTATGCGTGCGACGGTGAA.
2. The nucleic acid aptamer that specifically binds to OX40 protein according to claim 1, characterized in that: The nucleotide sequence of the nucleic acid aptamer is modified and the modified nucleic acid aptamer specifically binds to the OX40 protein, and the modification is selected from at least one of phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium, and isotopization.
3. A conjugate of a nucleic acid aptamer, characterized in that: The aptamer is obtained by connecting other substances used for labeling, detection, diagnosis or treatment to the nucleotide sequence of the aptamer according to claim 1 or 2, and the aptamer conjugate specifically binds to the OX40 protein.
4. The conjugate of nucleic acid aptamer according to claim 3, characterized in that: The other substances used for labeling, detection, diagnosis or treatment are fluorescent markers.
5. The conjugate of nucleic acid aptamer according to claim 4, characterized in that: The fluorescent marker is at least one of FAM, radioactive substances, therapeutic substances, biotin, digoxin, nanoluminescent materials, small peptides, siRNA and enzyme labels.
6. A derivative of a nucleic acid aptamer, characterized in that: It is obtained by transforming the backbone of the nucleotide sequence of the nucleic acid aptamer described in claim 1 or 2 or the conjugate of the nucleic acid aptamer described in any one of claims 3-5 into a thiophosphate backbone, or by transforming the nucleic acid aptamer described in claim 1 or 2 or the conjugate of the nucleic acid aptamer described in any one of claims 3-5 into a peptide nucleic acid, and the derivative of the nucleic acid aptamer specifically binds to the OX40 protein.
7. Use of the nucleic acid aptamer according to claim 1 or 2, the conjugate of the nucleic acid aptamer according to any one of claims 3 to 5, or the derivative of the nucleic acid aptamer according to claim 6 in the preparation of a drug for targeting tumors.
8. A kit, characterized in that: A nucleic acid aptamer comprising the nucleic acid aptamer according to claim 1 or 2, or a conjugate of the nucleic acid aptamer according to any one of claims 3 to 5, or a derivative of the nucleic acid aptamer according to claim 6.
9. Use of the nucleic acid aptamer according to claim 1 or 2, or the conjugate of the nucleic acid aptamer according to any one of claims 3 to 5, or the derivative of the nucleic acid aptamer according to claim 6 in preparing a kit, wherein the kit is used for any one selected from the group consisting of: (1) Purify OX40 protein or detect OX40 protein; (2) Localization imaging of cells, tissues or living organisms expressing OX40; (3) Capture of cells or exosomes expressing OX40.