Heavy chain and light chain variable regions of anti-pseudorabies virus gB monoclonal antibody and their application

Abstract

The present invention discloses a heavy chain and light chain variable region of an anti-pseudorabies virus gB monoclonal antibody and its application, wherein the gene sequence of the Heavy chain of the gB monoclonal antibody is shown in SEQ ID NO.4, and its amino acid sequence is shown in SEQ ID NO.5; the gene sequence of the Kappa chain of the gB monoclonal antibody is shown in SEQ ID NO.6, and its amino acid sequence is shown in SEQ ID NO.7. The present invention adopts the heavy chain and light chain variable region of the anti-pseudorabies virus gB monoclonal antibody, and the monoclonal antibody has the characteristics of strong specificity and high sensitivity, etc., laying a foundation for the research, development and promotion of ELISA kits and colloidal gold test strips.

Description

Technical Field

[0001] The present invention relates to the technical field of pseudorabies virus, in particular to a heavy chain and light chain variable region of an anti-porcine pseudorabies virus gB monoclonal antibody and an application thereof. Background Art

[0002] Pseudorabies (PR) is a highly contagious disease caused by pseudorabies virus (PRV). PRV can infect a variety of mammals including pigs, sheep, and cattle, among which pigs are the most sensitive and the most serious. The clinical features of the disease are reproductive disorders in breeding pigs, respiratory difficulties in adult pigs, and death of piglets, causing serious economic losses to my country's pig industry.

[0003] The morbidity and mortality of PRV depend on the age of the infected pigs and the immune status of the pig herd. Vaccination is the main measure to prevent and control the disease. How to objectively and effectively evaluate the antibody level of PRV is one of the keys to scientifically and effectively prevent and control the disease.

[0004] gB protein is an essential glycoprotein for PRV proliferation. Detecting gB antibodies using ELISA is one of the important methods to detect PRV antibody levels.

[0005] The existing technologies for detecting PRV at home and abroad mainly include fluorescent PCR and immunological analysis (enzyme-linked immunosorbent assay and colloidal gold immunoassay). Fluorescent PCR instruments are expensive and easily contaminated. Enzyme-linked immunosorbent assay also has the characteristics of strong specificity and high sensitivity. The test results can be obtained within 3 to 4 hours, and a large number of samples can be tested at the same time. It is widely used in the clinical diagnosis of pseudorabies. Summary of the invention

[0006] The purpose of the present invention is to provide a heavy chain and light chain variable region of an anti-pseudorabies virus gB monoclonal antibody and its application. The monoclonal antibody has the characteristics of strong specificity and high sensitivity, and lays a foundation for the research, development and promotion of ELISA kits and colloidal gold test strips.

[0007] To achieve the above objectives, the present invention provides heavy chain and light chain variable regions of an anti-pseudorabies virus gB monoclonal antibody, the gene sequence of the Heavy chain of the gB monoclonal antibody is shown in SEQ ID NO.4, and its amino acid sequence is shown in SEQ ID NO.5; the gene sequence of the Kappa chain of the gB monoclonal antibody is shown in SEQ ID NO.6, and its amino acid sequence is shown in SEQ ID NO.7.

[0008] Preferably, the complementary determining region sequences of the heavy chain variable region of the gB monoclonal antibody are CDR-H1, CDR-H2, and CDR-H3, and their amino acid sequences are shown in SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10, respectively.

[0009] Preferably, the complementary determining region sequences of the light chain variable region of the gB monoclonal antibody are CDR-L1, CDR-L2, and CDR-L3, and their amino acid sequences are shown in SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13, respectively.

[0010] A DNA molecule encodes the heavy chain and light chain variable regions of the anti-pseudorabies virus gB monoclonal antibody.

[0011] An application of the heavy chain and light chain variable regions of the monoclonal antibody against pseudorabies virus gB of swine in the preparation of a detection reagent or a kit with gB as a target.

[0012] A use of the monoclonal antibody against pseudorabies virus gB in the preparation of a genetically engineered antibody or vaccine targeting gB.

[0013] Therefore, the present invention adopts the heavy chain and light chain variable regions of the above-mentioned anti-pseudorabies virus gB monoclonal antibody and its application. The monoclonal antibody has the characteristics of strong specificity and high sensitivity, laying a foundation for the research, development and promotion of ELISA kits and colloidal gold test strips.

[0014] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is the result of the sequence alignment of the monoclonal antibody heavy chain variable region gene;

[0016] Figure 2 It is the result of amino acid sequence alignment of the heavy chain variable region of monoclonal antibodies;

[0017] Figure 3 It is the result of sequence alignment of the monoclonal antibody light chain variable region gene;

[0018] Figure 4 It is the result of amino acid sequence alignment of monoclonal antibody light chain variable region. DETAILED DESCRIPTION

[0019] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0020] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described below and that the invention can be implemented in other specific forms without departing from the subject matter or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in every sense, and the scope of the invention is defined by the appended claims rather than the following description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the present invention, and any reference numerals in the claims should not be considered as limiting the claims to which they relate.

[0021] In addition, it should be understood that although this specification is described according to the implementation modes, not every implementation mode includes only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation modes that can be understood by those skilled in the art. These other implementation modes are also covered within the protection scope of the present invention.

[0022] It should also be understood that the specific embodiments described above are only used to explain the present invention, and the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solutions and inventive concepts of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

[0023] For those skilled in the art, the specific meanings of the above terms in the present invention can be understood according to specific circumstances. The term "about" used in the present invention has a meaning well known to those skilled in the art, preferably referring to the value modified by the term within the range of ±50%, ±40%, ±30%, ±20%, ±10%, ±5% or ±1%.

[0024] All terms (including technical terms or scientific terms) used in the present invention have the same meanings as those understood by ordinary technicians in the field to which the present invention belongs, unless otherwise specifically defined. It should also be understood that terms defined in general dictionaries should be understood to have meanings consistent with their meanings in the context of the relevant technology, and should not be interpreted in an idealized or extremely formal sense, unless explicitly defined in this document.

[0025] Technologies, methods, and equipment known to ordinary technicians in the relevant field may not be discussed in detail, but where appropriate, the technologies, methods, and equipment should be considered as part of the specification.

[0026] The disclosed contents of the prior art documents cited in the present specification are incorporated into the present invention by reference in their entirety and are therefore part of the disclosure of the present invention.

[0027] Embodiment 1

[0028] Preparation of porcine pseudorabies virus antigen

[0029] 1. Cell Recovery

[0030] Take the frozen Vero cells, place them in a 37℃ water bath and shake them gently to thaw them quickly, and centrifuge them at 1000r / min for 5min; discard the supernatant, add 1mL DMEM (10% HS) to resuspend the cells, inoculate them into T75 culture flasks, add DMEM (10% HS) to 13mL / flask, and culture them statically in a 37℃ cell constant temperature incubator.

[0031] 2. Virus Culture

[0032] After the cells have grown into a monolayer, discard the supernatant, dilute the TPRV strain with DMEM and inoculate it into a cell culture flask, place it in a 37°C cell constant temperature incubator and incubate it for 1 hour, discard the supernatant, add DMEM (10% HS) to 15 mL and continue culturing.

[0033] 3. Viral protein purification

[0034] After the virus was inoculated, the cells with a CPE of 80% were placed in a -70°C refrigerator together with the supernatant, and the cells were frozen and thawed three times. The supernatant was collected and centrifuged at 10,000 r / min for 30 min. The supernatant was collected into a sterile glass bottle. The inactivator β-propiolactone was added at a ratio of 1:1000 and placed in a 4°C refrigerator for inactivation for 48 h. The inactivated virus supernatant was ultracentrifuged at 26,000 r / min for 3 h using a Beckman Type 45Ti rotor, and the virus precipitate was resuspended in 6 mL of sterile PBS. The protein concentration in the ultracentrifuged virus was determined to be 1.5 mg / mL by the BCA method. After aliquoting, it was stored in a -70°C refrigerator.

[0035] Embodiment 2

[0036] Preparation of monoclonal antibodies

[0037] 1. Mouse Immunization

[0038] Take three female Balb / c mice aged 6-8 weeks, and immunize each with 50μg of TPRV virus. For the first immunization, emulsify the TPRV virus with Freund's complete adjuvant in equal volumes, and inject the immunized mice subcutaneously at multiple points. A total of three immunizations were performed, once every two weeks. The second and third immunizations were both emulsified with Freund's incomplete adjuvant for antigen emulsification, and the immunization dose and method remained unchanged. One week after the third immunization, the tail vein of the mice was blood drawn, and the serum was taken and its titer was measured. The results are shown in Table 1. Take 100μg of TPRV virus and dilute it to 200μL with 1×PBS. The mice were intraperitoneally injected for shock immunization, and cell fusion can be performed three days later.

[0039] Table 1 Mouse serum titer verification

[0040]

[0041] 2. Cultivation of SP2 / 0 Myeloma Cells

[0042] Take out a piece of SP2 / 0 myeloma cells frozen in liquid nitrogen and immediately transfer it to a 37°C constant temperature water bath. Gently shake the cryotube from time to time and take it out when the cells melt to a semi-ice crystal state. Operate in a sterile environment, transfer the SP2 / 0 cells in the cryotube into a 50mL sterile centrifuge tube, take 10mL of preheated 1640 complete medium and slowly drop it into the centrifuge tube, centrifuge at 1000r / min for 5min, and discard the supernatant. Gently break up the cell clusters, take 5mL of medium to resuspend the cells and transfer them to a T75 cell culture flask. Add another 5mL of culture medium, shake the cell bottle in the "cross" direction, put it in a CO2 cell culture incubator, and culture it at 37°C. Observe the cell state under a microscope, and subculture the SP2 / 0 cells when the density is about 80%.

[0043] 3. Cell Fusion

[0044] (1) Blood was collected from the eye sockets of the experimental mice after the shock and collected in EP tubes. After standing at 37°C for 2 hours, the blood was centrifuged at 4000 rpm for 10 minutes. The serum was collected for subsequent screening of monoclonal antibodies as a positive control. The mice were killed by dislocating the neck and then immersed in 75% alcohol for disinfection.

[0045] (2) Preparation of spleen cells: Use sterilized scissors and tweezers to cut open the mouse skin in a biosafety cabinet, replace a new set of sterilized scissors and tweezers to cut open the mouse abdominal cavity, and then use a new set of sterilized scissors and tweezers to carefully remove the spleen and trim off excess fat. Prepare a sterile 15mL centrifuge tube, add 10mL of DMEM culture medium, place the spleen in the centrifuge tube, and carefully discard the excess culture medium after the spleen is moistened. Pipette another 10 mL of DMEM medium into a sterile dish, grind the spleen with a frosted glass slide to make a single-cell suspension and filter it through a 200-mesh nylon mesh into a sterile centrifuge tube, add 30 mL of DMEM into a 50 mL sterile centrifuge tube, rinse the nylon mesh with a pipette, centrifuge the centrifuge tube containing the spleen cell suspension at 1500 rpm for 5 min, discard the supernatant, gently break up the cell clumps by hand, add 30 mL of DMEM medium to resuspend, and centrifuge again, then discard the supernatant, gently break up the cell clumps by hand, and add 10 mL of DMEM medium to resuspend.

[0046] (3) Cell fusion: 1000rpm, 5min centrifugation to collect well-growing SP2 / 0 cells in a 50mL centrifuge tube, gently break up the SP2 / 0 cell clusters, add 30mL DMEM medium to resuspend, centrifuge once more, add 10mL DMEM medium to resuspend, then mix the spleen cell suspension with the SP2 / 0 cell suspension, centrifuge at 1000rpm for 5min, discard the supernatant, and gently break up the cell clusters. Place in a 37℃ water bath environment, draw 1mL of PEG fusion agent and drop it into the centrifuge tube, add 1mL within 1min, at this time the cell state is red homogenous quicksand, and the tube wall feels like frosted glass when rotating.

[0047] (4) Termination of fusion: 9 mL of preheated DMEM medium was aspirated to terminate fusion, which was divided into three stages. The first stage was to add 1 mL within 1 minute, the second stage was to add 1 mL within 1 minute, and the third stage was to add the remaining 7 mL of medium within 3 minutes. Then, the cells were placed in a 37°C water bath for 5 minutes and centrifuged at 800 rpm for 5 minutes.

[0048] (5) Plating: Discard the supernatant, gently break up the cell clumps, add HAT medium (for example, if you want to plate 5 96-well plates, add 200 μL / well, excluding the 100 μL / well feeder layer cells that have been plated in advance, then add 50 mL of HAT medium). After mixing the cells, evenly plate the fused cell suspension in the 96-well cell plate that has been added with the feeder layer cells, at 100 μL / well, and culture in a CO2 cell culture incubator at 37°C.

[0049] 4. Screening of positive hybridoma cells

[0050] 7 days after cell fusion, when the cell clusters were observed to be relatively large, the cell supernatant was detected by indirect ELISA. 100ng / well TPRV virus was used as the antigen for detection, the positive control was the serum of fused mice, and the negative control was PBS immune mouse serum. The wells with the strongest color reaction were selected to detect whether there was blocking of gB antibody. 100ng / well TPRV virus was used as the antigen for detection, the primary antibody was the cell supernatant, the secondary antibody was the gB antibody, and the hybridoma cell wells with blocking were determined as positive wells. The screened positive hybridoma cells were subcloned by limiting dilution method. The hybridoma cell lines that can stably secrete monoclonal antibodies identified after subcloning were expanded and transferred to T75 cell bottles.

[0051] 5. Ascites Preparation

[0052] The hybridoma cell line that can stably secrete monoclonal antibodies identified after subcloning is expanded and cultured, transferred to a T75 cell flask, and cultured to about 80% of the cell number, and can be collected to prepare for ascites. Add 10mL of sterile 1×PBS to the cell flask, blow off the cell layer, resuspend it and transfer it to a 15mL centrifuge tube, and centrifuge it at 1000r / min for 10min. Discard the supernatant, take another 1mL of sterile 1×PBS to resuspend the precipitate and mix it, and absorb it with a 1mL syringe. Each mouse is injected with about 500μL of cell suspension, pay attention to the growth status of the mouse, and collect ascites when the mouse abdomen swells after one week. Collect the mouse ascites in a centrifuge tube, centrifuge it at 8000r / min for 20min, and absorb the middle ascites layer.

[0053] VI. Purification of Monoclonal Antibodies

[0054] The collected ascites was first crudely purified by the caprylic acid-ammonium sulfate method, and then the crudely purified monoclonal antibody was secondary purified using a Protein G pre-packed column.

[0055] Embodiment 3

[0056] Sensitivity and subtype identification of monoclonal antibodies against pseudorabies virus gB

[0057] 1. Sensitivity of anti-pseudorabies virus gB monoclonal antibody

[0058] The sensitivity of the purified gB monoclonal antibody was detected by indirect ELISA. TPRV virus was coated at 100 ng / well, and 1 mg / mL gB monoclonal antibody was graded diluted to verify the sensitivity of the gB monoclonal antibody. The results are shown in Table 2. The sensitivity of the gB monoclonal antibody was 1:100000.

[0059] Table 2 Monoclonal antibody sensitivity verification

[0060] Monoclonal antibody serial dilution <![CDATA[OD 450nm ]]> 1∶500 2.627 1∶1000 2.606 1∶2000 2.36 1∶4000 2.082 1∶6000 1.872 1∶8000 1.614 1∶10000 1.437 1∶50000 0.534 1∶100000 0.247 NC 0.097

[0061] 2. Subclass identification of monoclonal antibodies against pseudorabies virus gB

[0062] The subclass of anti-pseudorabies virus gB monoclonal antibody was detected using an IgG subclass detection kit (Sigma, USA), and the results are shown in Table 3. The subclass of gB monoclonal antibody was identified as IgG2a / Kappa type.

[0063] Table 3 Identification of monoclonal antibody subtypes

[0064]

[0065] Embodiment 4

[0066] Monoclonal antibody heavy and light chain variable region gene cloning

[0067] (1) Hybridoma cell culture and total RNA extraction

[0068] Hybridoma cells were cultured in RPMI 1640 complete medium at 37°C and 5% carbon dioxide until the cell number reached 1×10 7 Total RNA was extracted from cells using a total RNA extraction kit (purchased from Tiangen).

[0069] (2) Synthesis of the first strand of cDNA

[0070] A reverse transcription kit (purchased from TAKARA) was used to synthesize the first-strand cDNA using the extracted total RNA as an amplification template.

[0071] (3) Gene amplification

[0072] Design downstream primers for Kappa chain and Heavy chain and upstream universal primers.

[0073] Primer: F:AAGCAGTGGTATCAACGCAGA (SEQ ID NO.1)

[0074] Rκ:AACATTGATGTCTTTGGGGTAGAA (SEQ ID NO.2)

[0075] RH:AGGGATCCAGAGTTCCAGGT (SEQ ID NO.3)

[0076] PCR amplification was performed using the first strand of cDNA as a template, and the reaction system was 50 μL, including 3 μL of template, 2.5 μL of upstream primer (10 μM), 2.5 μL of downstream primer (10 μM), 25 μL of 2× Taq enzyme, and 17 μL of sterile water.

[0077] The touchdown PCR reaction conditions were as follows: 98°C for 30 s; 98°C for 15 s, 64°C-58°C for 30 s, decreasing by 0.5°C each time until 58°C, for 10 cycles; 72°C for 30 s; 98°C for 15 s, 56°C for 30 s, 72°C for 30 s, for 15 cycles; the program was terminated at 72°C for 7 min.

[0078] (4) Cloning and screening of PCR amplification products

[0079] The PCR products were subjected to 1.5% agarose gel electrophoresis, and the Kappa chain and Heavy chain amplified fragments were recovered using a PCR product recovery kit (purchased from Tiangen). The recovered and purified target fragments were inserted into the pLB vector using a pLB zero background rapid cloning kit (purchased from Tiangen), and transformed into DH5α competent cells (ampicillin resistance), and the recombinant positive clones were screened and sequenced.

[0080] The PCR products were subjected to 1.5% agarose gel electrophoresis.

[0081] The sequencing results of the Heavy chain and Kappa chain are as follows: the Heavy chain gene is the sequence shown in SEQ ID NO.4, and its amino acid is the sequence shown in SEQ ID NO.5; the Kappa chain gene is the sequence shown in SEQ ID NO.6, and its amino acid is the sequence shown in SEQ ID NO.7.

[0082] (5) Variable region amino acid sequence and homology analysis

[0083] The heavy chain and light chain gene sequences and amino acid sequences were compared and analyzed in the NCBI database. The analysis results showed that the monoclonal antibody heavy chain variable region gene sequence had the highest homology with the mouse immunoglobulin heavy chain variable region (Sequence ID: BC092061.1), with a homology of 392 / 441 and a homology percentage of 89%. Figure 1 .

[0084] The amino acid sequence of the variable region of the heavy chain of the monoclonal antibody has the highest homology with the amino acid sequence of the variable region of the heavy chain of the mouse immunoglobulin (Sequence ID: 4PB9_H), with a homology of 122 / 145 and a homology percentage of 84%. The results are shown in Figure 2 .

[0085] The monoclonal antibody light chain variable region gene sequence has the highest homology with the mouse immunoglobulin Kappa chain variable region (SequenceID: EU159573.1), with a homology of 326 / 438 and a homology percentage of 74%. The results are shown in Figure 3 .

[0086] The amino acid sequence of the variable region of the light chain of the monoclonal antibody has the highest homology with the amino acid sequence of the variable region of the mouse immunoglobulin Kappa chain (Sequence ID: 6X78_A), with a homology of 140 / 146 and a homology percentage of 96%. The results are shown in Figure 4 .

[0087] The results of homology analysis of the gene sequence and amino acid sequence encoding the heavy chain and light chain variable regions of the monoclonal antibody showed that no sequence identical to the present invention was found. This result is consistent with the identification of the monoclonal antibody as IgG2a / Kappa using an IgG subclass detection kit (Sigma, USA).

[0088] (6) CDR region analysis

[0089] The heavy chain variable region and light chain variable region sequences were analyzed at https: / / www.novopro.cn / tools / cdr.html to obtain their CDR regions.

[0090] Antibody heavy chain CDR region:

[0091] CDR-H1: DYNIH (SEQ ID NO.8)

[0092] CDR-H2: YIYPYNGDTAYNQKFKN (SEQ ID NO.9)

[0093] CDR-H3: GNYDYVVDYTMDY (SEQ ID NO.10)

[0094] Antibody light chain CDR region:

[0095] CDR-L1: YLN (SEQ ID NO.11)

[0096] CDR-L2: LVSKLDS (SEQ ID NO.12)

[0097] CDR-L3: WQGTHFPT (SEQ ID NO.13)

[0098] Embodiment 5

[0099] A porcine pseudorabies virus gB blocking ELISA antibody detection kit was prepared and tested for 24 porcine serum samples. The kit was compared with a porcine pseudorabies virus gB blocking ELISA antibody detection kit purchased from a certain company. The detailed results are shown in Table 4. The overall positive and negative sample compliance rate was 96%.

[0100] Table 4 Comparison of sample compliance rates

[0101]

[0102] Note: Nabbit test kit judgment standard: negative control (N) OD 450nm Mean - positive control OD 450nm Mean ≥ 0.3; S / N = sample OD 450nm Mean / negative control OD 450nm Mean; Judgment standard: S / N>0.7, judged as negative, explanation; 0.60

[0103] The judgment standard of the ELISA antibody detection kit for the pseudorabies virus gB blocking of a company is: negative control (N) OD 450nm Mean - positive control OD 450nm Mean ≥ 0.3; S / N = sample OD​450nm Mean / negative control OD 450nm Mean; Judgment standard S / N>0.7, judged as negative, explanation; 0.60

[0104] Sensitivity quality control serum samples were selected for minimum detection study. The results showed that the trial-produced porcine pseudorabies virus gB blocking ELISA antibody detection kit can detect 16-fold diluted sensitivity samples; the porcine pseudorabies virus gB blocking ELISA antibody detection kit purchased from a certain company can also detect 16-fold diluted sensitivity samples. Detailed results are shown in Table 5. This result shows that the trial-produced porcine pseudorabies virus gB blocking ELISA antibody detection kit has good sensitivity.

[0105] Table 5 Test results of sensitivity quality control products

[0106]

[0107] Five negative samples were tested with the trial-made porcine pseudorabies virus gB blocking ELISA antibody detection kit and the purchased porcine pseudorabies virus gB blocking ELISA antibody detection kit from a certain company, and the results were all negative, as shown in Table 6. This shows that the trial-made porcine pseudorabies virus gB blocking ELISA antibody detection kit has good specificity.

[0108] Table 6 Specific quality control test results

[0109]

[0110] Therefore, the present invention adopts the heavy chain and light chain variable regions of the above-mentioned anti-pseudorabies virus gB monoclonal antibody and its application. The monoclonal antibody has the characteristics of strong specificity and high sensitivity, laying a foundation for the research, development and promotion of ELISA kits and colloidal gold test strips.

[0111] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.​

Claims

1. An anti-pseudorabies virus gB monoclonal antibody, characterized in that: The gB monoclonal antibody comprises heavy chain and light chain variable regions, the gene sequence of the heavy chain of the gB monoclonal antibody is shown in SEQ ID NO.4, and its amino acid sequence is shown in SEQ ID NO.5; the gene sequence of the light chain of the gB monoclonal antibody is shown in SEQ ID NO.6, and its amino acid sequence is shown in SEQ ID NO.

7.

2. A DNA molecule encoding the anti-pseudorabies virus gB monoclonal antibody according to claim 1.

3. Use of the anti-pseudorabies virus gB monoclonal antibody according to claim 1 in the preparation of a detection reagent or a kit targeting gB.

Images