A GPAAV-CBA-H_TP53 (P53)-WPRE plasmid, engineered bacteria and preparation method

Abstract

The present invention discloses a GPAAV‑CBA‑H_TP53(P53)‑WPRE plasmid, an engineered bacterium and a preparation method, and belongs to the field of genetic engineering technology. The base sequence of the plasmid is shown in SEQ ID NO.1. The genetically engineered bacterium is obtained by transforming the plasmid into competent cells. The preparation method comprises: double enzyme digestion of the expression vector to obtain an expression vector fragment; preparation of a target gene fragment; and connection of the expression vector fragment with the target gene fragment. The present invention has the following advantages: the adeno-associated virus packaged by the plasmid has a significant inhibitory effect on the growth of human tumors when administered via the circulatory system, and the effect is better than the reference substance gemcitabine; the adeno-associated virus packaged by the plasmid has a blood sugar-lowering effect on immunodeficient subjects, and has no effect on non-immunodeficient subjects, and its blood sugar-lowering effect is correlated with the immunodeficiency of the subject.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a GPAAV-CBA-H_TP53 (P53)-WPRE plasmid, an engineering bacterium and a preparation method thereof. Background Art

[0002] The p53 gene is a major member of the tumor suppressor gene family and is the gene with the highest correlation with human tumorigenesis. The wild-type p53 gene plays an important role in maintaining normal cell growth and preventing and inhibiting the occurrence and proliferation of malignant tumor cells. Various factors in the environment, such as ultraviolet rays, radiation, chemicals, and certain metabolites produced by the body itself, can cause cell DNA damage. Under normal physiological conditions, these cell DNA can be repaired or degraded and removed under the action of certain gene products to prevent it from being inherited and maintain the replication of normal DNA, thereby protecting the normal function of the cell. Otherwise, the damaged DNA will continue to replicate and separate with the chromosomes, resulting in a large number of DNA mutations and chromosomal aberrations in the chromosome set. The further accumulation of these mutations will eventually cause normal cells to deteriorate and develop into cancer cells.

[0003] p53 gene mutation is the most common genetic variation in human malignant tumors. According to statistics, about 50% of human tumors are related to p53 gene mutations, 30%-40% of breast cancer, 50% of lung cancer and 70% of colon cancer have p53 gene mutations; almost 100% of small cell lung cancers have p53 gene mutations. In addition, animal experiments have shown that 100% of mice expressing abnormal p53 gene protein develop tumors.

[0004] Existing studies have shown that wild-type p53 protein plays a biological role as a "gene guard" in cells, monitoring the integrity and stability of the cell genome. More importantly, wild-type p53 protein can initiate programmed cell death, induce cell suicide, and prevent cells with malignant tendencies from further dividing and proliferating, thereby preventing the occurrence of cancer.

[0005] Because the p53 gene has such an important biological function and is closely related to the occurrence and malignancy of human tumors, scientists have long begun to use the biological function of exogenous wild-type p53 genes to initiate the programmed apoptosis process of p53 gene-deficient tumor cells and induce tumor cell suicide and death experimental research and clinical tumor gene therapy research. Now many research reports and clinical research results have proved that wild-type p53 gene therapy is safe and effective, and has few toxic and side effects.

[0006] The applicant of the patent application of the present invention has found through searching that the existing technology mainly combines the p53 gene with adenovirus into a recombinant plasmid for application. Although adenovirus as a vector has the advantages of a wide host range, high infection efficiency, large packaging capacity, high expression level and no integration risk, adenovirus as a vector also has the following problems: high immune response of target cells, inability to integrate into the host genome, and only transient expression. Summary of the invention

[0007] The purpose of the present invention is to disclose a GPAAV-CBA-H_TP53 (P53)-WPRE plasmid.

[0008] The second object of the present invention is to disclose a genetically engineered bacterium of the GPAAV-CBA-H_TP53 (P53)-WPRE plasmid.

[0009] The third object of the present invention is to disclose a method for preparing the GPAAV-CBA-H_TP53 (P53)-WPRE plasmid.

[0010] The objective of the present invention is achieved through the following technical solutions:

[0011] A GPAAV-CBA-H_TP53(P53)-WPRE plasmid, wherein: the base sequence of the GPAAV-CBA-H_TP53(P53)-WPRE plasmid is shown in SEQ ID NO.1.

[0012] The genetically engineered bacteria obtained by transformation of the GPAAV-CBA-H_TP53(P53)-WPRE plasmid described in the above technical scheme.

[0013] The genetically engineered bacteria described in the above technical scheme, wherein: the genetically engineered bacteria are obtained by transforming the GPAAV-CBA-H_TP53 (P53) -WPRE plasmid into competent cells Escherichia coli DH5α or Escherichia coli JM109.

[0014] The preparation method of the GPAAV-CBA-H_TP53 (P53)-WPRE plasmid described in the above technical scheme comprises the following steps:

[0015] (1) Double-digest the expression vector GPAAV-CBA-MCS-WPRE to obtain the expression vector fragment;

[0016] (2) Preparation of target gene fragments;

[0017] (3) After the expression vector fragment and the target gene fragment are connected, the GPAAV-CBA-H_TP53(P53)-WPRE plasmid shown in SEQ ID NO.1 is obtained.

[0018] The preparation method described in the above technical solution, wherein the specific steps of step (1) are:

[0019] (1.1) Culture the bacterial solution containing the expression vector GPAAV-CBA-MCS-WPRE plasmid overnight, and extract the plasmid using 3-5 ml of fresh bacterial solution. For specific methods, refer to the instructions for QIAGEN plasmid extraction.

[0020] (1.2) Take 1 μg of fresh plasmid and digest it at 37℃ for about 3 hours in the following enzyme digestion system:

[0021]

[0022] The preparation method described in the above technical solution, wherein the specific steps of step (2) are:

[0023] (2.1) Determine that the vector is the expression vector GPAAV-CBA-MCS-WPRE, design PCR amplification fragment primers Primer-F and Primer-R according to Gene ID: 7157, and introduce the homologous sequence of the end of the linearized clone expression vector at the 5' end of the primer, so that the 5' and 3' end sequences of the amplified product are completely consistent with the two end sequences of the linearized clone expression vector;

[0024] (2.2) Primer overlapping PCR to prepare the template required for amplification of the target gene fragment:

[0025] (2.2.1), p53-I, p53-II and p53-III were prepared respectively, wherein the primers for preparing p53-I were P1-P10, the primers for preparing p53-II were P11-P20, and the primers for preparing p53-III were P21-P30; the prepared reaction systems were: 12 μL primers, 25 μL Phanta Max Buffer (2×), 1 μL dNTP Mix (10 mM), 1 μL DNA Polymerase and 11 μL H2O; the PCR reaction procedures were: 98°C pre-denaturation for 3 min, 98°C denaturation for 15 s, 60°C annealing for 15 s, 72°C

[0026] Extension for 30 s, 20 cycles, 72°C for 5 min;

[0027] (2.2.2), using p53-I, p53-II and p53-III prepared in step (2.2.1) as the total template, using P1 and P30 as primers to prepare p53, wherein the reaction system is: 2 μL primer, 3 μL amplification template, 25 μL Phanta Max Buffer (2×), 1 μL dNTP Mix (10 mM), 1 μL DNA Polymerase and 18 μL H2O; the reaction procedure is: 98°C pre-denaturation for 3 min, 98°C denaturation for 15 s, 60°C annealing for 15 s, 72°C extension for 2 min, 20 cycles, 72°C extension for 5 min; the template required for amplification of the target gene fragment is obtained;

[0028] (2.3) Dilute the primers Primer-F and Primer-R synthesized in step (2.1) into a stock solution with a final concentration of 10 μmol / L;

[0029] (2.4) Using the product of step (2.2) as a template, PCR amplification was performed using diluted primers and template. The PCR reaction system was: 1-2 μg of template, 2 μL of Primer-F, 2 μL of Primer-R, 25 μL of PCR mix, and ddH2O was used to make up to 50 μL. PCR amplification was performed at a denaturation temperature of 95°C, an annealing temperature of 72°C, and an extension temperature of 56°C to obtain the target gene fragment.

[0030] The preparation method described in the above technical solution, wherein the specific steps of step (3) are: connecting the expression vector fragment prepared in step (1) and the target gene fragment prepared in step (2) in the following connection system at 50° C. for 20 minutes to obtain GPAAV-CBA-H_TP53(P53)-WPRE plasmid; the connection system is:

[0031]

[0032]

[0033] The present invention has the following beneficial effects:

[0034] 1. When the adeno-associated virus packaged with GPAAV-CBA-H_TP53(P53)-WPRE plasmid is administered directly through the tumor, it has an inhibitory effect on the growth of human tumors; when it is administered through the circulatory system, it has a significant inhibitory effect on the growth of human tumors, and the effect is better than the reference substance gemcitabine.

[0035] 2. The adeno-associated virus packaged with the GPAAV-CBA-H_TP53(P53)-WPRE plasmid has the effect of lowering blood sugar in immunodeficient subjects, but has no effect on non-immunodeficient subjects. The blood sugar lowering effect of the adeno-associated virus packaged with this plasmid is correlated with the immunodeficiency of the subject. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] 1. Figure 1 This is a map of the expression vector GPAAV-CBA-MCS-WPRE.

[0037] 2. Figure 2 This is the map of GPAAV-CBA-H_TP53(P53)-WPRE plasmid. DETAILED DESCRIPTION

[0038] To facilitate the understanding of the technical solution of the present invention, the present invention is further described below in conjunction with specific embodiments.

[0039] Embodiment 1: Preparation of GpAAV-CBA-H_TP53(P53)-WPRE plasmid:

[0040] 1. Experimental Materials and Methods

[0041] 1. Materials:

[0042] 1. Vector information: The expression vector GPAAV-CBA-MCS-WPRE was purchased from "Jiman Biotechnology (Shanghai) Co., Ltd.". The map is as follows Figure 1 As shown;

[0043] 2. Reagents: The reagents used in this example are shown in Table 1:

[0044] Table 1 Reagents and sources

[0045]

[0046]

[0047] 3. Instruments: The instruments used in this embodiment are shown in Table 2:

[0048] Table 2 Instruments and sources

[0049] Instrument Name Instrument source Stabilized voltage electrophoresis instrument Bio-Rad Gel Imager Haimen Qilin Bell Instrument Manufacturing Co., Ltd. Bacteria Shaker Shanghai Yiheng Scientific Instrument Co., Ltd. Bacterial incubator Shanghai Yiheng Scientific Instrument Co., Ltd. PCR instrument Eppendorf High-speed centrifuge Thermo Disposable flat dishes Shanghai Qianchen Biological 1L flask Shu Beef 50ml polypropylene tube Corning Pipette Gilson

[0050] (II) Methods:

[0051] 1. Double enzyme digestion of vector:

[0052] (1) Cultivate the bacterial solution containing the expression vector GPAAV-CBA-MCS-WPRE plasmid overnight, and extract the plasmid using 3-5 ml of fresh bacterial solution. For specific methods, refer to the QIAGEN plasmid extract instructions.

[0053] (2) Take 1 μg of fresh plasmid and perform double digestion with corresponding restriction endonucleases at 37°C for about 3 h. The enzyme digestion system is shown in Table 3:

[0054] Table 3 Enzyme digestion system

[0055] Carrier 1 μg green Buffer 3μL MqI 1.5μL B H 1.5μL <![CDATA[ddH2O]]> Make up to 30 μL

[0056] (3) Perform agarose gel electrophoresis on the digested product. After the electrophoresis, perform gel recovery as follows: Under ultraviolet light, cut the gel strip containing the target fragment. Use a balance to weigh the total weight and subtract the weight of the empty tube to calculate the weight of the gel. Calculate the volume of the gel according to 100 mg = 100 μL, and add 1 times the volume of the gel to the Binging Solution and place it in a 65°C water bath to completely melt the gel. Shake the EP tube appropriately during this period to accelerate the dissolution of the gel.

[0057] (4) Transfer all the above liquids to the filter column and centrifuge at 13,000 rpm for 30 seconds (can be repeated once). Then discard the liquid in the tube, add 500μL of WASolution to the column, and centrifuge at 13,000 rpm for 30 seconds. Discard the liquid in the tube, add 500μL of Wash Solution to the column, and centrifuge at 13,000 rpm for 30 seconds (can be repeated once). Then leave it empty for 3 minutes. Place the filter column in a new 1.5mL EP tube and dry it at room temperature. Finally, add 35μL of ddH2O to the column, let it stand for 5 minutes, and centrifuge at 13,000 rpm for 1.5 minutes. In order to improve the recovery rate, the dissolved DNA can be added to the column again and centrifuged for one minute. Discard the column to obtain the recovered expression vector fragment, and measure the concentration.

[0058] 2. Preparation of target gene fragments:

[0059] 2.1. Design and synthesize primers:

[0060] (1) Determine that the vector used is the expression vector GPAAV-CBA-MCS-WPRE;

[0061] (2) Design PCR amplification primers based on Gene ID: 7157, and introduce homologous sequences at the ends of the linearized expression vector (the fragment of the expression vector after double enzyme digestion) at the 5' end of the primer, so that the 5' and 3' end sequences of the amplified product are completely consistent with the two end sequences of the linearized expression vector.

[0062] (3) Send the designed primer sequences (as shown in Table 4) to the Bioengineering Institute for synthesis.

[0063] Table 4 Primer sequences

[0064] Primer name Primer sequence 5' to 3' Primer-F CCGCAGCCAGCCATGGCCACCATGGAGGAGCCGC Primer-R GTAATCCAGAGGTTGATTTCAGTCTGAGTCAGGCCCTTCTGTCTTG

[0065] 2.2. Preparation of templates required for amplification of target gene fragments:

[0066] The primer sequences used in primer overlap PCR are shown in Table 5:

[0067] Table 5 Primer sequences (5'-3')

[0068]

[0069]

[0070] (1) Primer overlapping PCR steps:

[0071] (1.1) Step 1 PCR:

[0072] Primers with complementary ends were used to form overlapping chains in the PCR products, so that template-free amplification was performed by extending the overlapping chains in the subsequent amplification reaction; the reaction system for the PCR reaction corresponding to the preparation of p53-I, p53-II and p53-III is shown in Table 6, and the PCR reaction program for the preparation of p53-I, p53-II and p53-III is shown in Table 7:

[0073] Table 6 PCR reaction system

[0074]

[0075] Table 7 PCR reaction program

[0076]

[0077] (1.2), Step 2 PCR:

[0078] The reaction system was prepared with the products of Step 1 PCR reaction (p53-I, p53-II and p53-III) as the total template, and PCR was performed after sufficient mixing and instant centrifugation to obtain the template (p53) required for amplification of the target gene fragment; the reaction system is shown in Table 8 and the reaction procedure is shown in Table 9:

[0079] Table 8 PCR reaction system

[0080]

[0081] Table 9 PCR reaction program

[0082]

[0083] (2) After the primer overlapping PCR machine is off, the synthetic fragment of 1179 bp is obtained, which is the template required for amplification of the target gene fragment.

[0084] 2.3. Amplification of target gene fragments:

[0085] (1) Dilute the primers synthesized in step 2.1 to a stock solution with a final concentration of 10 μmol / L.

[0086] (2) Using the product of the primer overlap PCR in step 2.2 as a template, PCR amplification is performed using the diluted primers and template. The PCR amplification system is shown in Table 10:

[0087] Table 10 PCR amplification system

[0088] template 1-2 μg Primer-F 2μL Primer-R 2μL PCR mix 25μL ddH2O Make up to 50 μL

[0089] Add the above materials into a thin-walled tube, mix well, and place it into a PCR instrument after tapping. Set the denaturation temperature to 95°C, the annealing temperature to 72°C, and the extension temperature to 56°C to start PCR amplification.

[0090] (3) After PCR, perform agarose gel electrophoresis and recover the target gene fragment using the same method as above.

[0091] 3. Connection between expression vector fragment and target gene fragment (seamless cloning):

[0092] (1) Determine the concentration of the recovered expression vector fragment and target gene fragment;

[0093] (2) The optimal amount of cloning vector used in the Hieff CloneTM recombination reaction system is 0.03 pmol; the optimal molar ratio of cloning vector to insert fragment is 1:2, that is, the optimal amount of insert fragment used is 0.06 pmol. The DNA mass corresponding to these molar numbers can be calculated by the following formula:

[0094] Optimal amount of cloning vector used = [0.02 × number of base pairs of cloning vector] ng (0.03 pmol)

[0095] Optimal amount of insert fragment = [0.04 × number of base pairs of insert fragment] ng (0.06 pmol)

[0096] (3) The expression vector fragment (linearized cloning vector) and the target gene fragment (insert fragment amplification product) were connected at 50° C. for 20 min in the connection system shown in Table 11;

[0097] Table 11 Connection system

[0098]

[0099] 4. Conversion:

[0100] (1) Place competent E. coli DH5α or E. coli JM109 cells on ice (4°C) and wait for them to thaw naturally. Then, take 10 μl of the ligation product from step 3 and add it to competent E. coli DH5α or E. coli JM109 cells and place on ice (4°C) for 30 min.

[0101] (2) Heat shock in a 42°C water bath for 90 seconds and then quickly place on ice (4°C) for 2-3 minutes.

[0102] (3) Add 500 μL of SOC culture medium without antibiotics and culture at 37°C with shaking at 225 rpm for 45 min.

[0103] (4) Centrifuge at 3000 rpm for 2 min, discard 900 μL of the supernatant, blow off the bacterial solution at the bottom of the tube, add it to the culture plate containing the corresponding resistance (ampicillin or kanamycin, etc.) on the carrier, spread it evenly with a sterile spreader (the temperature of the spreader should not be too high to avoid scalding the bacteria), and invert it in a 37°C constant temperature incubator for overnight culture.

[0104] 5. Send for testing:

[0105] Two clones were selected from each group and sent to a sequencing company for sequencing identification.

[0106] 2. Experimental results:

[0107] The sequencing result of the constructed GPAAV-CBA-H_TP53(P53)-WPRE plasmid is shown in SEQ ID NO.1, and its map is shown in Figure 2 shown.

[0108] Embodiment 2: AAV-P53 was obtained by production and packaging of adeno-associated virus:

[0109] (I) Extraction of recombinant plasmid GPAAV-CBA-H_TP53(P53)-WPRE:

[0110] The plasmid DNA used for virus packaging needs to be of high quality and purity. The plasmid was extracted from the clone obtained in step 4 of Example 1 using Qiagen's plasmid extraction kit, and the plasmid DNA was finally dissolved in TE buffer at pH 7.5.

[0111] (II) 293T cell culture:

[0112] 1. Recovery of frozen 293T cells:

[0113] (1) Add 10 ml of DMEM growth medium into a 15 ml conical bottom tube;

[0114] (2) Place the cell cryopreservation tube stored at -80℃ in a 37℃ water bath and gently shake for 1-2 minutes to thaw it. Take out the cryopreservation tube from the water bath and disinfect it by wiping the surface of the tube with 75% ethanol (room temperature). Note that only the tube body should be placed in the water bath, and the tube cap should not be immersed together, otherwise the water in the water bath will be sucked into the cryopreservation tube;

[0115] (3) Transfer the thawed cell suspension to the conical tube prepared in the first step;

[0116] (4) Centrifuge at 200g for 3 minutes at room temperature to pellet the cells. Discard the supernatant.

[0117] (5) Add 5 ml of fresh growth medium to the conical tube and gently pipette up and down to suspend the cells. At this time, the cells have just recovered and are relatively fragile, so it is better to suspend the cells when pipetting and avoid excessive pipetting;

[0118] (6) Move 5 ml of cell suspension to 75 cm 2 Place the cells in a 37°C, 5% CO2 incubator.

[0119] (7) Monitor cell density every day. When the cells reach 50% confluence, subculture them. Then subculture 293T cells.

[0120] 2. Passaging of 293T cells:

[0121] (1) Preheat DMEM complete medium and trypsin-EDTA solution in a 37°C water bath;

[0122] (2) Remove the growth medium and wash the cells once with 10 ml of PBS (phosphate-buffered saline);

[0123] (3) Digest the cells with 5 ml of trypsin-EDTA solution for 1-3 minutes; (Note: The digestion time with trypsin-EDTA solution should be the shortest time required to make the adherent cells fall off the culture flask. This process can be observed using an inverted microscope. Over-digestion will damage or kill the cells.)

[0124] (4) Dilute the cells with 5 ml of culture medium to inactivate trypsin, and transfer the cell suspension to a 15 ml conical-bottom tube;

[0125] (5) Centrifuge at 200 g for 3 minutes at room temperature to precipitate the cells and discard the supernatant;

[0126] (6) Resuspend the cell pellet in 10 ml of culture medium and transfer 2 ml of the cell suspension to each 75 cm 2 5 cell culture bottles in total. Each bottle contains 28 ml of growth medium. Place the cells in a 37°C, 5% CO2 incubator. Check the cell density every day and keep the cell confluence below 50%.

[0127] (III) Adeno-associated virus production and packaging:

[0128] 1. Preparation of 293T cells:

[0129] Add 10 ml of DMEM growth medium to a 10 cm culture dish and add 3 × 10 6 293T cells, shake well, and culture for 48 hours before transfection. (Note: In order to obtain higher titers, the health of 293T cells and the density of subculture are very important factors. Subculture is required when the cell confluence reaches 50%. And freeze in large quantities when the cells are at a low generation and growing healthily. Avoid cell clumping when subculturing and plating for transfection. Cells may grow to a higher confluence before transfection with plasmids.)

[0130] 2. Transfection of 293T cells:

[0131] (1) Before transfection, check the host cells passaged two days ago. They should reach 70-80% confluence.

[0132] (2) Take out the required plasmids and reagents from the refrigerator and cool them to room temperature;

[0133] (3) Calculate the required transfection system and plasmid dosage according to the number of packaging plates, dilute the plasmid according to the kit requirements, add the transfection reagent, mix gently, and let stand for 20 minutes;

[0134] (4) Aspirate and discard the culture medium of the cells to be transfected, replace it with DMEM containing 5% FBS, add the DNA-transfection reagent mixed solution to the cells, and gently shake the cell culture plate;

[0135] (5) Return the cell culture dish to the 37°C incubator for 12 hours;

[0136] (6) After 12 hours, replace with fresh 5% FBS DMEM and culture for another 60 hours.

[0137] 3. Collection of AAVs:

[0138] The transfected cell supernatant (i.e., virus solution) was collected and centrifuged, and then filtered through a 0.45 μm filter to remove cell debris.

[0139] 4. Purification and packaging of adeno-associated virus:

[0140] (1) The filtered virus solution was precipitated with PEG6000 solution at 4°C for more than 3 h.

[0141] (2) After the virus precipitation is completed, the virus solution is centrifuged at 4000 rpm, 4°C, for 20 min, and the precipitate is resuspended in Opti-MEM.

[0142] (3) Ultracentrifuge the virus resuspension at 27,000 rpm, 4°C, for 90 min.

[0143] (4) After ultracentrifugation, the virus was resuspended and placed in an ultrafiltration tube for ultrafiltration at 4000 rpm, 4°C, for 20 min.

[0144] (5) Sterilize and filter the virus, divide it into smaller pieces, and store it at -80°C.

[0145] The following specific experimental examples are used to illustrate the beneficial effects of the GPAAV-CBA-H_TP53 (P53)-WPRE plasmid of the present invention in inhibiting tumors:

[0146] The AAV-P53 used in the following experimental examples was prepared in Example 1 and Example 2.

[0147] Experimental Example 1: Tumor suppression assay:

[0148] Human hepatocellular carcinoma SMMC7721 cells frozen in liquid nitrogen were quickly thawed in a 37°C water bath and the cell density was adjusted to 1×10 7 / mL, subcutaneously inoculate 2 BALB / c nude mice, 0.2mL each. When nude mice have tumors, the minimum diameter of the tumor is not less than 1.0cm. Aseptically remove the tumor and divide it into clumps with a maximum diameter of no more than 3mm, and subcutaneously inoculate 24 nude mice

[0149] The first group, 5 mice, did not receive any treatment

[0150] The second group, 7 mice, received intratumoral administration with multiple injections of AAV-P53, 0.1 mL

[0151] Group 3, 7 mice, circulatory system administration, tail vein injection of AAV-P53, 1.0 mL

[0152] Group 4, 5 mice, gemcitabine control, 120 mg / kg body weight

[0153] Starting from the 3rd day, the tumor growth was observed every day, the tumor size was recorded, and the tumor volume was calculated according to the following formula: V = ab2 / 2 (V-volume, a-tumor long diameter, b-tumor short diameter). The changes in tumor volume in each group are shown in Table 12 (mean ± standard deviation):

[0154] Table 12 Changes in tumor volume in each group

[0155]

[0156] From the results in Table 12, it can be seen that the tumor administration group, the circulatory system administration group and the control group all have inhibitory effects on the growth of human tumors; the second group of AAV-P53 was directly administered via the tumor, which had an inhibitory effect on the growth of human tumors, but the effect was not as good as that of administration via the circulatory system; the third group of AAV-P53 was administered via the circulatory system, which had a significant inhibitory effect on the growth of human tumors, and the effect was better than the reference product gemcitabine. The excellent therapeutic effect of administration via the circulatory system means that this drug can reach different parts of the body, especially lesions in deep organs.

[0157] Experimental Example 2: Sugar control experiment:

[0158] Experiments on the different blood sugar control effects of AAV-P53 in nude mice and GK mice:

[0159] 20 nude mice, with a body weight range of 20-25 g / mouse, were grouped as shown in Table 13:

[0160] Table 13 Grouping of 20 nude mice

[0161] Nu1 group 5 No processing Nu2 Group 5 1.0 mL via tail vein Nu3 group 5 0.1 mL was administered into the tail vein Nu4 group 5 0.3 mL was administered into the tail vein

[0162] There were 16 GK rats, with a body weight range of 240-260 g / rat, and the groups were shown in Table 14:

[0163] Table 14 Grouping of 16 GK rats

[0164]

[0165]

[0166] Blood sugar was recorded before administration, and tail vein blood sugar of the test animals was tested starting from the 7th day after administration. In the Nu2 group, 1.0 mL was administered, and the blood sugar dropped too sharply after 7 days, reaching the limit of mouse hypoglycemia, and the animals withdrew from the experiment.

[0167] The blood glucose records of animals are shown in Table 15 (mean ± standard deviation). Compared with the control group, the blood glucose levels of the 0.1 mL group and the 0.3 mL and 1.0 mL groups decreased significantly, and showed a dose-effect relationship, indicating that AAV-P53 has the effect of lowering blood glucose in nude mice; in GK mice, no difference in blood glucose was observed, suggesting that AAV-P53 has no effect on the blood glucose of GK mice.

[0168] Table 15 Changes in blood glucose in Nu mice and GK mice after AAV-P53 injection

[0169]

[0170] In GK mice, rapid-acting insulin was injected via the tail vein, and the blood sugar changes were shown in Table 16. From the data in Table 10, it can be observed that the blood sugar of GK mice decreased, indicating that the hyperglycemia of GK rats can be controlled by insulin, but is not affected by AAV-P53.

[0171] Table 16 Changes of blood glucose in GK mice injected with insulin via tail vein

[0172]

[0173] Nude mice are thymus-deficient mice, and GK mice are inbred spontaneous diabetes model mice among Wistar rats. It can be seen that the hypoglycemic effect of AAV-P53 is related to the immune deficiency of the target, and its hypoglycemic effect is selective.

[0174] The above description is only a preferred embodiment of the present invention and does not impose any formal or substantial limitation on the present invention. Any technician familiar with the profession can make use of the technical contents disclosed above without departing from the scope of the technical solution of the present invention, and any slight changes, modifications and evolutions made by equivalent changes are all equivalent embodiments of the present invention; at the same time, any changes, modifications and evolutions of any equivalent changes made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A GPAAV-CBA-H_TP53 (P53)-WPRE plasmid, characterized in that: The base sequence of the GPAAV-CBA-H_TP53(P53)-WPRE plasmid is shown in SEQ ID NO.

1.

2. A genetically engineered bacterium transformed by the GPAAV-CBA-H_TP53(P53)-WPRE plasmid described in claim 1.

3. The genetically engineered bacteria according to claim 2, characterized in that: The genetically engineered bacteria are obtained by transforming the GPAAV-CBA-H_TP53 (P53)-WPRE plasmid into competent cells Escherichia coli DH5α or Escherichia coli JM109.

4. The method for preparing the GPAAV-CBA-H_TP53 (P53)-WPRE plasmid according to claim 1, comprising the following steps: (1) Double-digest the expression vector GPAAV-CBA-MCS-WPRE to obtain the expression vector fragment; (2) Preparation of target gene fragments; (3) After the expression vector fragment and the target gene fragment are connected, the GPAAV-CBA-H_TP53(P53)-WPRE plasmid shown in SEQ ID NO.1 is obtained.

5. The preparation method according to claim 1, characterized in that: The specific steps of step (1) are: (1.1) Cultivate the bacterial solution containing the expression vector GPAAV-CBA-MCS-WPRE plasmid overnight, and extract the plasmid using 3-5 ml of fresh bacterial solution. For specific methods, refer to the instructions for QIAGEN plasmid extraction. (1.2) Take 1 μg of fresh plasmid and digest it at 37℃ for 3h in the following enzyme digestion system:

6. The preparation method according to claim 1, characterized in that: The specific steps of step (2) are: (2.1) Determine that the vector is the expression vector GPAAV-CBA-MCS-WPRE, design PCR amplification fragment primers Primer-F and Primer-R according to Gene ID: 7157, and introduce the homologous sequence of the end of the linearized clone expression vector at the 5' end of the primer, so that the 5' and 3' end sequences of the amplified product are completely consistent with the two end sequences of the linearized clone expression vector; (2.2) Primer overlapping PCR to prepare the template required for amplification of the target gene fragment: (2.2.1), prepare p53-I, p53-II and p53-III respectively, wherein the primers for preparing p53-I are P1-P10, the primers for preparing p53-II are P11-P20, and the primers for preparing p53-III are P21-P30; the prepared reaction systems are: 12 μL primers, 25 μL PhantaMax Buffer (2×), 1 μL dNTP Mix (10 mM), 1 μL DNA Polymerase and 11 μL H2O; the PCR reaction procedures are: 98°C pre-denaturation for 3 min, 98°C denaturation for 15 s, 60°C annealing for 15 s, 72°C extension for 30 s, 20 cycles, 72°C extension for 5 min; (2.2.2), using p53-I, p53-II and p53-III prepared in step (2.2.1) as total templates, using P1 and P30 as primers to prepare p53, wherein the reaction system is: 2 μL primers, 3 μL amplification template, 25 μL PhantaMax Buffer (2×), 1 μL dNTP Mix (10 mM), 1 μL DNA Polymerase and 18 μL H2O; the reaction procedure is: 98°C pre-denaturation for 3 min, 98°C denaturation for 15 s, 60°C annealing for 15 s, 72°C extension for 2 min, 20 cycles, 72°C extension for 5 min; The template required for amplification of the target gene fragment is obtained; (2.3) Dilute the primers Primer-F and Primer-R synthesized in step (2.1) into a stock solution with a final concentration of 10 μmol / L; (2.4) Using the product of step (2.2) as a template, PCR amplification was performed using diluted primers and template. The PCR reaction system was: 1-2 μg of template, 2 μL of Primer-F, 2 μL of Primer-R, 25 μL of PCR mix, and ddH2O was used to make up to 50 μL. PCR amplification was performed at a denaturation temperature of 95°C, an annealing temperature of 72°C, and an extension temperature of 56°C to obtain the target gene fragment.

7. The preparation method according to claim 1, characterized in that: The specific steps of step (3) are: connecting the expression vector fragment prepared in step (1) and the target gene fragment prepared in step (2) in the following connection system at 50° C. for 20 minutes to obtain GPAAV-CBA-H_TP53(P53)-WPRE plasmid; the connection system is:

Images