Traditional Chinese medicine composition for treating myocardial infarction, preparation method and application thereof

Abstract

The present invention belongs to the field of traditional Chinese medicine, and in particular to a Chinese medicine composition for treating myocardial infarction and its application. The Chinese medicine composition for treating myocardial infarction of the present invention comprises, by weight, 10-20 parts of coptis root, 9-15 parts of pinellia tuber, 15-30 parts of whole trichosanthes root, 5-15 parts of cinnamon twig, 9-30 parts of allium macrostemon, 5-15 parts of immature bitter orange, 5-30 parts of raw astragalus, 6-15 parts of zedoaria, and 15-30 parts of salvia miltiorrhiza. Experiments on acute myocardial infarction mouse model show that the Chinese medicine composition of the present invention can improve the inflammatory microenvironment after myocardial infarction, inhibit ventricular negative remodeling, and improve cardiac function, indicating that the Chinese medicine composition of the present invention has a good therapeutic effect on myocardial infarction.

Description

Technical Field

[0001] The invention belongs to the field of traditional Chinese medicine, and particularly relates to a traditional Chinese medicine composition for treating myocardial infarction, and a preparation method and application thereof. Background Art

[0002] Acute myocardial infarction is a major disease that seriously endangers human health. It is one of the common and critical cardiovascular diseases in clinical practice. It is mainly caused by myocardial necrosis symptoms caused by acute or persistent ischemia and hypoxia of the coronary artery. Patients often show severe and persistent pain behind the sternum, and the pain is difficult to relieve after rest or oral nitrates. Clinical examinations show that the patient's electrocardiogram will show progressive changes, and the activity of serum myocardial enzyme spectrum will continue to increase, which is very likely to induce heart failure and even cardiogenic shock, endangering the patient's life safety. Heart failure (hereinafter referred to as "heart failure") is the terminal stage of various heart diseases, often coexisting with myocardial infarction, which not only increases the difficulty of treatment, but also causes serious damage to the patient's heart function. Myocardial infarction combined with heart failure will further increase the patient's mortality rate and re-hospitalization rate. Therefore, for patients with acute myocardial infarction and heart failure, how to ensure coronary reperfusion, save viable myocardium, improve cardiac function, reduce mortality and re-hospitalization rate, and ensure the effectiveness and safety of patient treatment has become the focus of clinical physicians.

[0003] Traditional Chinese medicine plays an important role in the treatment of acute myocardial infarction due to its multi-target effect and small side effects. Xiaoxianxiong Decoction originated from Treatise on Febrile Diseases. Its composition is 6g of Coptis chinensis, 9g of processed Pinellia ternata, and 15g of whole Trichosanthes kirilowii. The original text says: "For patients with small chest knot disease, which is located under the heart and is painful when pressed, and whose pulse is floating and slippery, Xiaoxianxiong Decoction is the main treatment." This prescription is mainly used to treat phlegm and heat that are mutually bound under the heart. Zhishi Xiebai Guizhi Decoction is composed of 12g of Zhishi, 12g of Magnolia officinalis, 9g of Xiebai, 6g of Guizhi, and 12g of Trichosanthes kirilowii. Article 5 of Synopsis of the Golden Chamber, Chest Pain, Shortness of Breath, Pulse and Symptoms, and Treatment, No. 9, says: "For chest pain, there is fullness in the heart, and qi is trapped in the chest. The chest is full and the hypochondrium is reversed and the heart is seized. Zhishi Xiebai Guizhi Decoction is the main treatment." This prescription is mainly used to treat chest pain caused by phlegm and qi. Clinical application found that the effect of using Xiao Xianxiong Decoction or Zhishi Xiebai Guizhi Decoction alone to treat acute myocardial infarction is not ideal, so it is necessary to develop a Chinese medicine composition that can effectively treat acute myocardial infarction. Summary of the invention

[0004] The first purpose of the present invention is to provide a traditional Chinese medicine composition for treating myocardial infarction. The second purpose of the present invention is to provide a method for preparing the traditional Chinese medicine composition. The third purpose of the present invention is to provide an application of the traditional Chinese medicine composition.

[0005] According to the first aspect of the present invention, a traditional Chinese medicine composition for treating myocardial infarction is provided, wherein the raw materials thereof comprise, by weight, 10-20 parts of coptis chinensis, 9-15 parts of pinellia ternata, 15-30 parts of whole trichosanthes kirilowii, 5-15 parts of cinnamon twig, 9-30 parts of allium macrostemon, 5-15 parts of immature bitter orange, 5-30 parts of raw astragalus, 6-15 parts of curcuma zedoaria, and 15-30 parts of salvia miltiorrhiza.

[0006] The present invention believes that the acute phase of myocardial infarction belongs to the category of "heartache" and "chest obstruction". The acute phase is mainly characterized by solid evidence, phlegm turbidity blocking, blood stasis blocking, the two are glued together, and depression turns into heat. Phlegm, stasis and heat are intertwined, blocking the heart meridian, causing chest fullness and pain, shortness of breath and other symptoms. Therefore, phlegm, heat and stasis are the pathological basis of the acute phase of myocardial infarction. The present invention believes that Xiaoxianxiong Decoction and Zhishi Xiebai Guizhi Decoction focus on phlegm, heat and phlegm blocking qi, and are not strong enough for blood stasis, so the therapeutic effect for acute myocardial infarction is not ideal. Therefore, based on the classic prescription, it is optimized according to clinical experience.

[0007] The present invention uses whole Trichosanthes and Allium macrostemon as the main medicines. Whole Trichosanthes is sweet and cold, clears away heat and removes phlegm, relieves chest congestion, Allium macrostemon is pungent and warm, promotes yang and dissipates congestion, resolves phlegm and dissipates cold, and promotes the smooth flow of chest yang. The two are one cold and one warm, one descends and one proclaims, which are the main medicines for resolving phlegm and opening the chest to treat chest pain, and are all main medicines. The minister uses Coptis chinensis to relieve heat and remove lumps to help the power of Trichosanthes, and Pinellia ternata is pungent and warm to resolve phlegm and dissipate congestion to help the power of Allium macrostemon. At the same time, Curcuma zedoaria and Salvia miltiorrhiza are used to promote blood circulation and remove blood stasis, and Fructus Aurantii Immaturus is used to promote qi and dissipate qi to promote qi circulation and help eliminate blood stasis and resolve phlegm. It is assisted by Cinnamon Twig to promote yang and dissipate cold, and promote the smooth flow of heart yang. Considering that the acute phase of this disease is mainly due to the fact that the evil is strong, the patient himself is mostly due to the deficiency of the body and the fact that the evil is strong, so it is assisted by Astragalus membranaceus to invigorate qi and strengthen the body. The compatibility of all medicines can make phlegm turbidity descend, blood stasis disperse, heat clear, qi mechanism smooth, and chest yang vibrate, so that all the symptoms of chest pain can be eliminated.

[0008] In the present invention, Curcuma zedoaria and Salvia miltiorrhiza not only promote blood circulation and remove blood stasis to help blood circulation, but also have the effect of improving cardiac remodeling, thereby improving the cardiac function of patients with acute myocardial infarction.

[0009] The raw material sources of the present invention are as follows:

[0010] Trichosanthes kirilowii Maxim.: The dried mature fruit of the plant Trichosanthes kirilowii Maxim. of the Cucurbitaceae family. It tastes sweet and is cold in nature. It enters the lung, stomach, and large intestine meridians.

[0011] Xiebai: The bulb of Allium macrostemon Bunge., a plant of the Liliaceae family. Pungent, bitter, warm in nature. Enters the heart, lung, stomach, and large intestine meridians.

[0012] Coptis chinensis: The dried rhizome of Coptis chinensis Franch., a plant of the Ranunculaceae family. Bitter and cold. Enters the heart, spleen, stomach, liver, gallbladder, and large intestine meridians.

[0013] Pinellia: Dried tuber of Pinellia ternata (Thunb.) Breit. of the Araceae family. Pungent, warm, toxic, enters the spleen, stomach, and lung meridians.

[0014] Curcuma zedoaria: The dried rhizome of Curcuma phaeocaulis Valeton., a plant of the ginger family. Pungent, bitter, warm. Enters the liver and spleen meridians.

[0015] Danshen: Dried root and rhizome of Salvia miltiorrhiza Bge., a plant of the Labiatae family. Bitter, slightly cold. Enters the heart and liver meridians.

[0016] Citrus aurantium: Dried young fruit of Citrus aurantium L. and its cultivars or Citrussinensis Osbeck. of the Rutaceae family. Bitter, pungent, sour, slightly cold. Enters the spleen and stomach meridians.

[0017] Cinnamon twig: Dried young twig of Cinnamomum cassia Presl., a plant of Lauraceae. Pungent, sweet, warm. Enters the heart, lung, and bladder meridians.

[0018] Astragalus: The dried root of Astragalus membranaceus (Fisch.) Bunge. It is sweet and slightly warm. It enters the spleen and lung meridians.

[0019] In some embodiments, the raw material composition includes, by mass: 15 parts of Coptis chinensis, 15 parts of Pinellia ternata, 30 parts of Trichosanthes kirilowii, 15 parts of Cinnamon twig, 15 parts of Allium macrostemon, 15 parts of Citrus aurantium, 30 parts of Raw Astragalus, 15 parts of Curcuma zedoaria, and 15 parts of Salvia miltiorrhiza.

[0020] In some embodiments, pharmaceutically acceptable adjuvants are also included. Specifically, the adjuvants used are carriers or excipients commonly used in the art, including but not limited to starch, lactose, glucose, sodium carboxymethyl cellulose, ethyl cellulose and methyl cellulose, malt, gelatin, polyols (such as propylene glycol, glycerol, mannitol), compressed tablets, etc., to help improve the stability or activity of the drug, or produce an acceptable taste or smell in the case of oral administration.

[0021] In some embodiments, the dosage form of the Chinese medicine composition for treating myocardial infarction is decoction, granules, powder, tablet, pill or capsule, so as to facilitate clinical administration.

[0022] According to a second aspect of the present invention, there is provided a method for preparing the above-mentioned Chinese medicine composition for treating myocardial infarction, comprising the following steps:

[0023] Add water according to the water-drug ratio of (8-10):1, until the liquid surface immerses the drug surface 2-5cm, soak for 30-40min, first boil over high heat for 30-40min, then switch to low heat and boil for 1-1.5h. Stir the drug materials 2-3 times during the boiling process to prevent the drug liquid from overflowing, boiling dry, or burning. When 400ml of the drug liquid remains, filter out the first decoction, add 1000ml of water to the drug residue again, boil it and boil it over low heat for 1-1.5h. When 400ml of the drug liquid remains, filter out the decoction, combine the two filtrates, and you have it.

[0024] According to a third aspect of the present invention, there is provided use of the above-mentioned Chinese medicine composition for treating myocardial infarction in the preparation of a medicament for treating myocardial infarction and / or heart failure.

[0025] In some embodiments, the myocardial infarction is acute myocardial infarction.

[0026] According to the fourth aspect of the present invention, there is provided the use of the above-mentioned Chinese medicine composition for treating myocardial infarction in the preparation of a drug for improving the inflammatory microenvironment after myocardial infarction and / or improving myocardial contractile function and / or promoting myocardial cell repair and / or reducing myocardial tissue fibrosis and / or inhibiting ventricular negative remodeling.

[0027] According to a fifth aspect of the present invention, there is provided use of the above-mentioned Chinese medicine composition for treating myocardial infarction in the preparation of a drug for inhibiting the release of macrophage inflammatory factors.

[0028] In some embodiments, macrophage inflammatory factors include iNOS, TLR4, NO, and IL-1β.

[0029] When the Chinese medicine composition for treating myocardial infarction is a decoction, one dose is given to the patient with myocardial infarction per day. For an adult weighing 60 kg, each dose is 150-250 mL, and the effective dose of the raw medicine is 165 g, which is taken orally in 2 to 3 times, once every 6 to 8 hours.

[0030] When the traditional Chinese medicine composition for treating myocardial infarction is in the form of granules, powders, tablets, pills or capsules, for example, to produce 1000 grams of granules, 10-20 grams of Coptis chinensis, 9-15 grams of Pinellia ternata, 15-30 grams of Trichosanthes kirilowii, 5-15 grams of cinnamon twig, 9-30 grams of Allium macrostemon, 5-15 grams of Citrus aurantium, 5-30 grams of raw Astragalus, 6-15 grams of Curcuma zedoaria, 15-30 grams of Salvia miltiorrhiza can be used, and the rest are auxiliary materials. The dosage is converted into the dosage of the decoction piece and given for oral administration.

[0031] The beneficial effects of the present invention include:

[0032] (1) The Chinese medicine composition of the present invention can reduce the expression of IL-1β in myocardial tissue, inhibit the release of macrophage inflammatory factors, improve the inflammatory microenvironment after myocardial infarction, improve myocardial contractile function, promote myocardial cell repair, reduce myocardial cell apoptosis and myocardial tissue fibrosis, inhibit ventricular negative remodeling, improve cardiac function, and thus prevent and treat ischemic heart failure.

[0033] (2) The Chinese medicine composition of the present invention can inhibit the release of lipopolysaccharide-induced macrophage inflammatory factors (iNOS, TLR4, NO, IL-1β). BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the result of the influence of the Chinese medicine composition in the animal experiment of the present invention on the cardiac function of mice with myocardial ischemia.

[0035] Figure 2 This is the result of the influence of the Chinese medicinal composition in the animal experiment of the present invention on the pathological changes of myocardial tissue in mice with myocardial ischemia.

[0036] Figure 3 This is the result of the influence of the Chinese medicinal composition in the animal experiment of the present invention on the apoptosis of myocardial cells in mice with myocardial ischemia.

[0037] Figure 4 This is the result of the influence of the Chinese medicine composition in the animal experiment of the present invention on myocardial fibrosis in myocardial ischemic mice.

[0038] Figure 5 This is the result of the influence of the Chinese medicine composition in the animal experiment of the present invention on the expression of IL-1β in the myocardial tissue of mice with myocardial ischemia.

[0039] Figure 6 This is the result of the influence of the Chinese medicine composition in the animal experiment of the present invention on the kidney tissue of mice with myocardial ischemia.

[0040] Figure 7 This is the result of the influence of the Chinese medicine composition in the animal experiment of the present invention on the liver tissue of mice with myocardial ischemia.

[0041] Figure 8 This is the result of the influence of the Chinese medicine composition in the cell experiment of the present invention on the expression of inflammatory factors in macrophages. DETAILED DESCRIPTION

[0042] The present invention is further described in detail below in conjunction with specific examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the raw materials and reagents used in the present invention are all purchased from the market.

[0043] Example 1

[0044] The Chinese medicine composition for treating myocardial infarction of this embodiment is prepared from the following components: 300g of Coptis chinensis, 300g of Pinellia ternata, 600g of Trichosanthes kirilowii, 300g of Cinnamomum cassia twig, 300g of Allium macrostemon, 300g of Citrus aurantium, 600g of Raw Astragalus, 300g of Curcuma zedoaria, and 300g of Salvia miltiorrhiza.

[0045] The preparation method thereof comprises the following steps:

[0046] (1) Add 1200 ml of water according to a water-drug ratio of 8:1, until the liquid surface is about 3 cm above the drug surface, soak for 30 min, first boil over high heat for 30 min, then switch to low heat for boiling for 1 h. Stir the drug materials about 3 times during the boiling process to prevent the drug liquid from overflowing, boiling dry, or burning. When 400 ml of the drug liquid remains, filter the first decoction into a 5-L conical flask, add 1000 ml of water to the drug residue again, boil it and boil it over low heat for 1 h. When 400 ml of the drug liquid remains, filter the second decoction and combine it into a 5-L conical flask to obtain the decoction drug liquid.

[0047] (2) Using a medium-sized rotary evaporator, set the water bath temperature to 54.4°C, the pressure to -0.1 MPa, the condenser temperature to -15°C, and the rotation speed to 44 rpm, the decoction liquid was subjected to reduced pressure distillation. When the boiling bubbles were stable, the temperature was gradually raised to 72.5°C to concentrate the liquid to a small volume, which was then placed in a 1L beaker and then divided into 6 small bowls and stored at -30°C. The liquid was freeze-dried in a vacuum freeze dryer (Labconco, Freezone) at a freeze-drying temperature of -80°C for 5 consecutive days to obtain 952 g of freeze-dried extract powder, with an extraction rate of 952 g / 3300 g×100%=28.85%.

[0048] Next, in order to verify the improvement of the Chinese medicinal composition for treating myocardial infarction of the present invention on post-myocardial infarction fibrosis and ventricular negative remodeling, the following animal experiments were conducted.

[0049] 1. Experimental Animals

[0050] C57BL / 6 mice (male, 6–8 weeks old, weighing 20–22 g) were purchased from Guangdong Medical Experimental Animal Center (Guangzhou, China, approval number: SCXK(YUE)2018-0002) and housed in an SPF environment (temperature 22 ± 2 °C, humidity 50 ± 10%) with food and water provided.

[0051] 2. Experimental Reagents

[0052] The nitric oxide kit was purchased from Sigma (Sigma Aldrich, St. Louis, USA), fetal bovine serum (FBS), Dulbecco's modified Eagle's medium (DMEM) and penicillin / streptomycin solution were purchased from HyClone (Logan, UT, USA), Tunnel and staining kits were purchased from Beyotime (Shanghai, China), and TLR4, iNOS, and IL-1β antibodies were purchased from BD Systems (BD Biosciences, USA).

[0053] 3. Experimental instruments and consumables

[0054] Disposable syringe for injection (1 mL) (Kangli Medical, China), laser confocal microscopy dish (NEST, China), blood glucose meter (Roche, Switzerland), blood glucose test strips (Roche, Switzerland), electronic analytical balance (Mettler-Toledo, Switzerland), inverted microscope (Olympus, USA), microplate reader (BioTek, USA), pipette (Eppendorf, Germany), refrigerated high-speed centrifuge (Eppendorf, Germany), tissue embedding machine (Thermo, USA), paraffin sectioner (Leica, Germany), and fully automatic staining and sealing integrated workstation (Leica, Germany).

[0055] 4. Construction of an animal model of acute myocardial infarction

[0056] C57BL / 6 mice were modeled as follows: intraperitoneal injection of 1% sodium pentobarbital (40 mg / kg) was used for anesthesia, and the chest and armpit hair of the mice were shaved with a shaver and depilatory cream. The surgical area was disinfected with iodine and 75% ethanol. The endotracheal tube was inserted into the trachea along the glottis and connected to the ventilator. The ventilator frequency was consistent with the chest rise and fall, and the intubation was successful. The mouse was placed in a supine position, and the skin on the left chest was cut with eye scissors to separate the muscles. The chest cavity was opened between the third and fourth ribs to expose the heart. The pericardium was clamped with a microscope curved forceps, and a small part of the pericardium was torn under the left atrial appendage to expose the area where the left coronary artery to the anterior descending branch (LAD) was located. Then the LAD or its presumed position was determined under a stereomicroscope, and an 8-0 suture was inserted at a depth of about 0.5 mm and a width of about 1 mm 2 mm below the left atrial appendage; the suture was ligated under the LAD to completely block the blood flow of the LAD.

[0057] The mice underwent cardiac ultrasound examination on day 3 to confirm the successful modeling. The mice were then anesthetized by inhalation of 2% isoflurane / oxygen and fixed on a flat plate at a constant temperature of 37°C. The ultrasound coupling agent was evenly applied to the chest and detected using the Mindray DP-50 ultrasound system (probe frequency 30MHz, detection depth 10-15mm). The probe was placed on the left chest of the mouse, and the two-dimensional (2D) mode displayed the short-axis view of the left ventricle. Then, the movement of the left ventricle was recorded at the level of the papillary muscle using m-mode ultrasound. The left ventricular end-diastolic diameter (LVEDD), left ventricular end-systolic diameter (LVESD), left ventricular end-diastolic volume (LVEDV) and left ventricular end-systolic volume (LVESV) were measured. Each mouse was measured for 10 consecutive cardiac cycles, and the left ventricular ejection fraction (LVEF) and left ventricular short-axis shortening fraction (LVFS) were calculated: LVEF = [(LVEDV-lvesv) / LVEDV] × 100%, LVFS = [(LVEDD-lvesd) / LVEDD] × 100%.

[0058] 5. Experimental Grouping and Drug Administration

[0059] Animal grouping and treatment: The mice were divided into 3 groups, with 10 mice in each group, namely sham operation group (ie, Sham group), model group, and modified Xianxiong Decoction group (ie, Chinese medicine combination group).

[0060] The mice in the model group and the modified Xianxiong decoction group were modeled according to the above method, and the mice in the sham operation group were treated with sham operation according to the following method: the mice were placed in a supine position, and the skin of the left chest was cut with eye scissors to separate the muscles. The chest cavity was opened between the third and fourth ribs to expose the heart. The pericardium was clamped with a microscope curved forceps, and a small part of the pericardium was torn under the left atrial appendage to expose the area where the left coronary artery to the anterior descending branch (LAD) was located. Then, the LAD or its presumed position was determined under a stereomicroscope, and an 8-0 suture was inserted at a depth of about 0.5 mm and a width of about 1 mm 2 mm below the left atrial appendage, and then it was withdrawn.

[0061] Each group of mice was administrated according to the following administration methods 7 days after modeling or sham operation:

[0062] The mice in the Jiawei Xianxiong Decoction group were given the freeze-dried extract powder prepared in Example 1. The freeze-dried extract powder was dissolved in physiological saline to form a suspension, which was then administered to the mice by gavage at a dosage of 7 g / kg / day.

[0063] The mice in the sham group and the model group were intragastrically administered with an equal amount of normal saline every day.

[0064] The drug administration period for each group of mice was 4 weeks.

[0065] 6. Statistical Methods

[0066] SPSS 22.0 statistical software was used. The measurement data were expressed as mean ± SD. One-way analysis of variance was used for comparison among multiple groups, and LSD test was used for pairwise comparison. The test level was α = 0.05.

[0067] VII. Determination of Myocardial Infarction Phenotype

[0068] The EF and FS values ​​of mice were observed by ultrasound. The heart, liver and kidney tissues of mice were collected, stored at -80℃ or embedded, and observed by HE staining, immunofluorescence staining, fluorescent tunnel staining and Masson staining.

[0069] 1. HE staining: HE staining was used to detect the pathological conditions of mouse myocardial tissue, liver tissue and kidney tissue. The specific experimental steps are as follows:

[0070] Take the myocardial tissue, liver tissue and kidney tissue of mice, dewax the paraffin sections to water: put the sections into xylene I for 10min-xylene II for 10min-anhydrous ethanol I for 5min-anhydrous ethanol II for 5min-95% alcohol for 5min-90% alcohol for 5min-80% alcohol for 5min-70% alcohol for 5min-wash with distilled water. Hematoxylin staining of nuclei: Slices are stained with Harris hematoxylin for about 5min, washed with tap water, differentiated with 1% hydrochloric acid alcohol for a few seconds, rinsed with tap water, blued with 0.6% ammonia water, and rinsed with running water. Eosin staining of cytoplasm: Slices are stained in eosin staining solution for 1-3min. Dehydration and sealing: Slices are placed in 95% alcohol I for 5min-95% alcohol II for 5min-anhydrous ethanol I for 5min-anhydrous ethanol II for 5min-xylene I for 5min-xylene II for 5min to dehydrate and become transparent, take the slices out of xylene and dry them slightly, and seal them with neutral gum. Microscope examination, image acquisition and analysis.

[0071] 2. Immunofluorescence staining: Immunofluorescence staining was used to detect the expression of IL-1β protein in mouse myocardial tissue. The specific experimental steps are as follows:

[0072] Mouse myocardial tissue was obtained, fixed with 10% formaldehyde for 24 hours, and embedded in paraffin. The specimen was cut into 5 mm slices and baked at 60°C for 2 hours. Antigen extraction was performed in citrate buffer, then washed with PBS buffer, treated with 3% H2O2 and 5% bovine serum albumin. Subsequently, the slices were incubated with anti-IL-1β primary antibody at 4°C overnight. Subsequently, the secondary antibody was incubated for 30 minutes. Finally, the images were taken under a microscope.

[0073] The composition of the PBS buffer (pH=7.2-7.4) used is: NaCl 137mmol / L, KCl 2.7mmol / L, Na2HPO4 4.3mmol / L, KH2PO4 1.4mmol / L.

[0074] The composition of the 0.01 mol / L citrate buffer (CB, pH 6.0, 1000 ml) used is: 3 g of trisodium citrate and 0.4 g of citric acid.

[0075] 3. Fluorescent Tunnel staining: TUNEL Bright Green Apoptosis Detection Kit (Novozyme Tunel Kit, Catalog No.: A112) was used to detect mouse cardiomyocyte apoptosis. The specific experimental steps are as follows:

[0076] (1) Paraffin sections were dewaxed to water, environmentally friendly transparent agent (three cylinders of 10 min, 10 min, 10 min), gradient alcohol (anhydrous ethanol, 95% ethanol, 75% ethanol) for 5 min each cylinder, rinsed with tap water, rinsed once with distilled water, and then circled with a histogram pen and immersed in TBS.

[0077] (2) Use the group brush to draw circles around the tissue.

[0078] (3) Dilute 2 mg / ml Proteinase K solution (Biyuntian) with 1×TBS (Hubei Bioas Biotechnology Co., Ltd.) at a ratio of 1:100 to a final concentration of 20 μg / ml. Add 50 μl of the diluted Proteinase K solution to each sample to cover the entire sample area and incubate at room temperature for 10 min.

[0079] (4) Rinse the sample with 1× TBS 2-3 times, 3-5 min each time.

[0080] (5) Dilute 5× Equilibration Buffer with deionized water at a ratio of 1:5 to make 1× Equilibration Buffer.

[0081] (6) Add 50 μl of 1× Equilibration Buffer to each sample to completely cover the sample area to be tested and incubate at room temperature for 30 minutes.

[0082] (7) Prepare enough TdT incubation buffer for all experimental and optional positive control reactions according to Table 1 (keep away from light during this step). The volume of a standard reaction is 50 μl. Multiply 50 μl by the number of experimental and positive control reactions to determine the total volume of TdT incubation buffer required. For samples with larger surface areas, the reagent volume can be increased proportionally.

[0083] Table 1. Preparation of TdT incubation buffer for experimental and optional positive control reactions

[0084] Components Volume (μl / 50μl system) <![CDATA[ddH2O]]> 34 5×Equilibration Buffer 10 BrightGreen Labeling Mix 5 Recombinant TdT Enzyme 1

[0085] Negative control system: Prepare a control incubation buffer without TdT enzyme and replace TdT enzyme with ddH2O.

[0086] (8) Shake off most of the 1× Equilibration Buffer on the slices, then add 50 μl of TdT incubation buffer to the tissue. Do not let the tissue dry. After this operation, keep the slides away from light.

[0087] (9) Place the slides in a humidified chamber and incubate at 37°C for 60 min. Wrap the chamber with aluminum foil to protect it from light.

[0088] (10) After incubation, wash with TBS three times, 5 min each time.

[0089] (11) Prepare DAPI working solution (Roche 216276) at a ratio of 1:500, stain the nuclei, and incubate at room temperature in the dark for 5 min.

[0090] (12) After completion, wash with TBS three times, 5 min each time. Seal the slides with anti-fluorescence attenuation mounting medium (solarbio s2100) and store at 4°C in the dark until inspection and photography.

[0091] 4. Masson staining: Masson staining was used to detect the degree of myocardial fibrosis in mice. The specific experimental steps are as follows:

[0092] Dewax the paraffin sections to water. Chrome treatment or deprecipitation of mercuric salts. Wash with tap water and distilled water in turn. Use Regaud hematoxylin or Weigert hematoxylin to stain the nucleus for 5-10 minutes. Wash thoroughly with water. If over-stained, differentiate with hydrochloric acid alcohol. Wash with distilled water. Use Masson Ponceau acid red solution for 5-10 minutes. Soak in 2% glacial acetic acid aqueous solution for a while. Differentiate in 1% phosphomolybdic acid aqueous solution for 3-5 minutes. Without washing, directly stain with aniline blue or light green solution for 5 minutes. Soak in 0.2% glacial acetic acid aqueous solution for a while. 95% alcohol, anhydrous alcohol, xylene transparent, neutral gum sealing.

[0093] 8. Experimental Results

[0094] 1. Effect of Chinese herbal medicine combination on cardiac function in mice with myocardial ischemia

[0095] The results of the effect of the Chinese medicine combination on the cardiac function of mice with myocardial ischemia are as follows Figure 1 As shown, from Figure 1It can be seen that the mouse ultrasound results showed that the LVEF and LVFS of the model group mice were significantly decreased, indicating that the myocardial ischemia mouse model was successfully established. After 28 days of intervention with the Chinese medicine composition, the LVEF and LVFS of the Chinese medicine composition group mice increased by 25% ± 6% and 9% ± 5%, respectively, indicating that the Chinese medicine composition of the present invention improved the myocardial contractile function of mice.

[0096] 2. Effect of Chinese herbal medicine combination on pathological changes of myocardial tissue in mice with myocardial ischemia

[0097] The results of the effect of the Chinese medicine combination on the pathological changes of myocardial tissue in mice with myocardial ischemia are as follows Figure 2 As shown, HE staining results showed that the myocardial cells of the model group mice were hypertrophic and necrotic, myocardial fibrosis was accompanied by inflammation, and the red nuclei were significantly increased, while the myocardial cells of the Chinese medicine composition group mice were bright, the red nuclei were reduced, and the myocardial cell apoptosis was reduced. This shows that the Chinese medicine composition of the present invention can promote the repair of cardiac myocardial cells.

[0098] 3. Effects of Chinese herbal medicine combination on myocardial cell apoptosis and fibrosis in mice with myocardial ischemia

[0099] The results of the effect of the Chinese medicine combination on myocardial cell apoptosis in mice with myocardial ischemia are as follows Figure 3 As shown, from Figure 3 It can be seen that the TUNNEL staining results showed that the fluorescence expression of cardiomyocytes in the model group mice was enhanced and the degree of apoptosis was significantly increased. Compared with the model group, the apoptosis of cardiomyocytes in the mice in the Chinese medicine combination group was significantly reduced.

[0100] The results of the effect of the Chinese medicine combination on myocardial fibrosis in mice with myocardial ischemia are as follows Figure 4 As shown, from Figure 4 It can be seen that the results of Masson staining showed that the myocardial tissue fibrosis of the mice in the model group was severe, while the degree of myocardial tissue fibrosis of the mice in the Chinese medicine composition group was significantly reduced, indicating that the Chinese medicine composition of the present invention reduced the fibrosis of myocardial tissue.

[0101] 4. Effect of Chinese herbal medicine combination on IL-1β expression in myocardial tissue of mice with myocardial ischemia

[0102] The results of the effect of the Chinese medicine combination on the expression of IL-1β in myocardial tissue of mice with myocardial ischemia are as follows Figure 5 As shown, from Figure 5 It can be seen that the results of immunofluorescence staining showed that the expression of IL-1β in the myocardial tissue of the mice in the model group increased; after the intervention of the Chinese medicine composition, the secretion of the cellular proinflammatory factor IL-1β was significantly reduced, suggesting that the Chinese medicine composition of the present invention improves the cardiac function of the myocardial ischemia model mice, which may be related to its inhibition of the secretion of inflammatory factors in myocardial tissue.

[0103] 5. Effect of Chinese herbal medicine combination on renal tissue of mice with myocardial ischemia

[0104] The results of the effect of the Chinese medicine composition on the renal tissue of mice with myocardial ischemia are as follows Figure 6 As shown, from Figure 6 It can be seen that the HE staining results showed that the pathological conditions of the sham group, model group and Chinese medicine composition group were similar, the renal tissues were neatly arranged and the cell morphology was normal, indicating that the Chinese medicine composition of the present invention had no damage to the renal tissues of mice with myocardial ischemia.

[0105] 6. Effect of Chinese herbal medicine combination on liver tissue of mice with myocardial ischemia

[0106] The results of the effect of the Chinese medicine composition on the liver tissue of mice with myocardial ischemia are as follows Figure 7 As shown, from Figure 7 It can be seen that the HE staining results showed that the pathological conditions of the sham group, model group and Chinese medicine composition group were similar, the liver tissues were neatly arranged and the cell morphology was normal, indicating that the Chinese medicine composition of the present invention had no damage to the liver tissues of mice with myocardial ischemia.

[0107] Then, in order to verify the improvement of the Chinese medicinal composition for treating myocardial infarction of the present invention on macrophage inflammatory factors, the following cell experiment was also performed.

[0108] 1. Experimental Methods

[0109] 1. Expression of macrophage inflammatory-related proteins iNOS and TLR4

[0110] The expression of macrophage inflammatory-related proteins iNOS and TLR4 was detected by Western blot. The detection steps are as follows:

[0111] RAW 264.7 cells were inoculated in 12-well plates and cultured for 24 h. 100 ng / mL LPS was used for 3 h to establish a cardiomyocyte injury model. Then, different concentrations of freeze-dried extract powder prepared in Example 1 (raw drug concentrations were 0 mg / mL, 3.2 mg / mL, 16 mg / mL, and 80 mg / mL) were used for intervention for 24 h. 1×RIPA buffer (CST, Beverly, USA) and complete protease inhibitor (Roche, Switzerland) were added and incubated at room temperature for 5 minutes, and the cells were collected. The protein concentration was measured using the Pierce BCA protein assay kit (Thermo Fisher Scientific). Equal amounts of whole cell lysate protein were dissolved in 3× loading buffer (CST, USA), separated by 10% SDS-PAGE (Sigma, USA), and then transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Burlington, MA, USA). The PVDF membrane was incubated with anti-iNOS, TLR4, and ACTB antibodies at 4°C overnight. Subsequently, the membrane was washed and incubated with the secondary antibody for 1 hour at room temperature. The membrane was washed again and transferred to freshly prepared enhanced chemiluminescence solution (Millipore, MA, USA), and then placed on a chemiluminescence instrument and exposed to light.

[0112] 2. Expression of NO

[0113] The expression of NO was detected by Griess reaction. The detection steps are as follows:

[0114] RAW 264.7 cells were inoculated in a 12-well plate and cultured for 24 h, 100 ng / mL LPS was used for 3 h, and then different concentrations of freeze-dried extract powder prepared in Example 1 (raw drug concentrations were 0 mg / mL, 1.6 mg / mL, 8 mg / mL, and 40 mg / mL) were used for 24 h. After the treatment, fresh DMEM full medium was used and cultured for another 48 h to evaluate the concentration of NO in the medium. The accumulation of nitrite in the culture supernatant was determined using the Griess reaction.

[0115] 3. IL-1β, TNF-α and IL-6 gene expression

[0116] RAW 264.7 cells were inoculated in a 6-well plate and cultured for 24 h, 100 ng / mL LPS was intervened for 3 h, and then the freeze-dried extract powder prepared in Example 1 (raw drug concentration of 8 mg / mL) was intervened for 24 h. Trizol was added, the cells were collected, and centrifuged at 3000 rpm for 10 min. RNA was extracted and PCR amplification was performed to detect the expression levels of IL-1β, TNF-α and IL-6 mRNA, wherein the primer sequences used for amplification are shown in Table 2.

[0117] Table 2 Primer sequences used for amplification

[0118] Primer name Primer sequences Mus IL-6-Forword TACTCGGCAAACCTAGTGCG Mus IL-6-Reverse GTGTCCCAACATTCATATTGTCAGT Mus TNF-α-Forword GGGGATTATGGCTCAGGGTC Mus TNF-α-Reverse CGAGGCTCCAGTGAATTCGG Mus IL-1β-Forword CCATGGAATCCGTGTCTTCCT Mus IL-1β-Reverse GTCTTGGCCGAGGACTAAGG

[0119] 2. Experimental Results

[0120] The results of the effect of Chinese medicine combination on the expression of inflammatory factors in macrophages are as follows Figure 8 As shown, from Figure 8 It can be seen that compared with the blank control group, the expression of iNOS and TLR4 in the model group was significantly increased, while after the intervention of the Chinese medicine composition, the expression of iNOS and TLR4 was significantly decreased.

[0121] from Figure 8 It can be seen that the NO secretion in the model group increased significantly, while after the intervention of the Chinese medicine composition, the NO secretion decreased significantly.

[0122] Real-time PCR results showed that the expression of IL-1β gene in the model group was significantly increased, while compared with the model group, the expression of IL-1β gene in the Chinese medicine composition group was significantly decreased, indicating that the Chinese medicine composition of the present invention can significantly inhibit the expression of IL-1β gene.

[0123] In summary, the Chinese medicine composition of the present invention can reduce the expression of IL-1β in myocardial tissue, inhibit the release of macrophage inflammatory factors, improve the inflammatory microenvironment after myocardial infarction, improve myocardial contractile function, promote myocardial cell repair, reduce myocardial cell apoptosis and myocardial tissue fibrosis, inhibit ventricular negative remodeling, improve cardiac function, and thus prevent and treat ischemic heart failure.

[0124] The above are only some embodiments of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the creative concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A Chinese medicine composition for treating myocardial infarction, characterized in that: The invention is prepared from the following raw materials by weight: 10-20 parts of coptis root, 9-15 parts of pinellia tuber, 15-30 parts of whole trichosanthes root, 5-15 parts of cinnamon twig, 9-30 parts of allium macrostemon, 5-15 parts of immature bitter orange, 5-30 parts of raw astragalus, 6-15 parts of curcuma and 15-30 parts of salvia miltiorrhiza.

2. The Chinese medicine composition for treating myocardial infarction according to claim 1, characterized in that: The medicine is prepared from the following raw materials by weight: 15 parts of coptis root, 15 parts of pinellia tuber, 30 parts of whole trichosanthes root, 15 parts of cinnamon twig, 15 parts of allium macrostemon, 15 parts of immature bitter orange, 30 parts of raw astragalus, 15 parts of curcuma and 15 parts of salvia miltiorrhiza.

3. The Chinese medicine composition for treating myocardial infarction according to claim 1 or 2, characterized in that: Pharmaceutically acceptable excipients are also included.

4. The Chinese medicine composition for treating myocardial infarction according to claim 1 or 2, characterized in that: The dosage form of the Chinese medicine composition for treating myocardial infarction is decoction, granules, powder, tablets, pills or capsules.

5. The method for preparing the Chinese medicine composition for treating myocardial infarction according to any one of claims 1 to 4, characterized in that: The following steps are involved: Add water according to the water-drug ratio of (8-10):1, soak for 30-40 min, boil over high heat for 30-40 min, then switch to low heat and boil for 1-1.5 h. Stir the medicinal materials 2-3 times during the boiling process, filter out the first decoction, add 8-10 times the weight of water to the residue again, boil it and boil it over low heat for 1-1.5 h, filter out the decoction, combine the two filtrates, and you have it.

6. Use of the Chinese medicine composition for treating myocardial infarction according to any one of claims 1 to 4 in the preparation of a medicine for treating myocardial infarction.

7. The use according to claim 6, characterized in that: The myocardial infarction is acute myocardial infarction.

8. The use according to claim 7, characterized in that: The Chinese medicine composition has one or more effects of improving the inflammatory microenvironment after myocardial infarction, improving myocardial contractile function, promoting myocardial cell repair, and reducing myocardial tissue fibrosis.

Images