A strain of animal Bifidobacterium lactis subsp. BL-G75 for promoting intestinal peristalsis and its application

Abstract

The present invention provides a strain of animal bifidobacterium lactis subspecies BL-G75 for promoting intestinal peristalsis and an application thereof. The animal bifidobacterium lactis subspecies BL-G75 (Bifidobacterium animalis subsp.lactis BL-G75) has a preservation number of CCTCC NO: M 20221827, and is used for preparing a microbial preparation for promoting intestinal peristalsis. The animal bifidobacterium lactis subspecies BL-G75 provided by the present invention is separated from the feces of healthy normal people, and the source is safe; it can promote intestinal peristalsis, regulate gastrointestinal function, and have the effect of moisturizing the intestine and relieving constipation, and has good tolerance to acidic environment and bile salts, excellent stability in a low temperature environment, and has a good prospect for development as a probiotic.

Description

Technical Field

[0001] The invention relates to the technical field of probiotic screening and application, and in particular to a strain of Bifidobacterium animalis subsp. lactis BL-G75 (Bifidobacterium animalis subsp. lactis BL-G75) for promoting intestinal peristalsis and application thereof. Background Art

[0002] Intestinal peristalsis is a complex movement with highly coordinated muscles and nerves. It is mainly regulated by the efferent and afferent nerves of the multi-level nervous system, mainly the enteric nervous system (ENS), and is completed through the regular contraction and relaxation of the longitudinal and circular muscles of the gastrointestinal tract. Intestinal peristalsis is responsible for transporting ingested food, helping the body absorb nutrients and water, and excreting waste. This function is essential for life and health. For humans, intestinal peristalsis dysfunction can aggravate infection, lead to malnutrition, and manifest as debilitating symptoms such as diarrhea and constipation, which greatly affects health and quality of life.

[0003] In recent years, with the continuous exploration of the intestinal motility mechanism, it has been found that intestinal flora is inseparable from intestinal motility, and normal intestinal flora contributes to normal intestinal motility. Studies have found that oral probiotics can regulate intestinal flora, promote intestinal flora metabolism to produce short-chain fatty acids (SCFAs), and play a role in lowering intestinal pH and promoting intestinal motility. Therefore, taking probiotics has become a new idea to promote intestinal motility and improve the functioning of the digestive system.

[0004] The word probiotics comes from Greek. In 2001, FAO / WHO jointly defined probiotics as live microorganisms that can benefit the host's health by taking in sufficient quantities. The beneficial bacteria or fungi found in humans and animals are mainly yeast, probiotic spore bacteria, Clostridium butyricum, lactobacillus, bifidobacterium, actinomycetes, etc. Among them, Bifidobacterium is a strictly anaerobic Gram-positive polymorphic rod-shaped bacterium of the Actinomycetes phylum, and its ends are often forked, hence the name Bifidobacterium. Bifidobacterium is an important core flora and beneficial physiological flora in the intestines of humans and animals, and is also the second largest bacterium found in breastfed infants. These characteristics make bifidobacteria a popular strain in the study of probiotic preparations. Chinese patent CN113355253B discloses an animal bifidobacterium and its application in the preparation of intestinal moisturizing and laxative products; Chinese patent CN114717132B discloses a strain of lactic bifidobacterium with the ability to prevent and relieve constipation symptoms and its application.

[0005] However, the mechanism of intestinal motility is complex, and the probiotic properties of probiotics vary at the genus and species level. Different strains of the same species also have different effects on promoting intestinal motility and their mechanisms of action. Therefore, screening for probiotic strains with outstanding intestinal motility-promoting effects and clear mechanisms of action is still a difficult and hot topic in current research. Summary of the invention

[0006] In order to overcome the shortcomings of the prior art, the present invention provides a strain of Bifidobacterium animalis subsp. lactis capable of promoting intestinal peristalsis and an application thereof; the Bifidobacterium animalis subsp. lactis BL-G75 (Bifidobacterium animalis subsp. lactis BL-G75), with a preservation number of CCTCC NO: M 20221827, was deposited in the China Center for Type Culture Collection on November 28, 2022, and the address of the depository unit is: Wuhan University, Wuhan, China.

[0007] The present invention also provides the use of the above-mentioned animal Bifidobacterium lactis subspecies BL-G75 in the preparation of a microbial preparation for promoting intestinal peristalsis.

[0008] The present invention also provides a microbial preparation containing the above Bifidobacterium animalis subsp. lactis BL-G75, which is used for promoting intestinal peristalsis.

[0009] Furthermore, the aforementioned microbial preparation is a medicine.

[0010] Furthermore, the aforementioned microbial medicine is in the form of tablets or powders.

[0011] Furthermore, the aforementioned microbial drugs also contain pharmaceutically acceptable excipients, such as fillers, binders, disintegrants, lubricants, wetting agents, flavoring agents, pH adjusters, and the like.

[0012] Specifically, the filler can be selected from one or more of starch, powdered sugar, dextrin, lactose, compressible starch, microcrystalline cellulose, yogurt powder, oligofructose, and skimmed milk powder; the binder can be selected from one or more of starch slurry, cellulose derivatives, povidone, gelatin, polyethylene glycol, polyvinyl alcohol, sucrose, liquid glucose, and maltitol; the disintegrant can be selected from one or more of sodium carboxymethyl starch, low-substituted hydroxypropyl cellulose, cross-linked sodium carboxymethyl cellulose, cross-linked polyvinyl pyrrolidone, agar, and microcrystalline cellulose; the lubricant can be selected from one or more of One or more of sodium (magnesium) stearate, micro-powdered silica gel, talc, hydrogenated vegetable oil, polyethylene glycols, sodium lauryl sulfate (magnesium); the wetting agent can be selected from water and / or ethanol; the flavoring agent can be selected from syrup, stevioside, glycerin, sorbitol, mannitol, saccharin sodium, aspartame, sucralose, xylitol, natural essential oils, artificial flavors, sodium alginate, and gum arabic; the pH adjuster can be selected from one or more of malic acid, fumaric acid, acetic acid, sodium acetate, citric acid (sodium, potassium salt), and tartaric acid.

[0013] Furthermore, in the aforementioned microbial drug, the content of animal Bifidobacterium lactis subspecies BL-G75 is 2×10 11 ~6×10 11 CFU / g.

[0014] In another embodiment, the aforementioned microbial preparation is a microbial-containing food.

[0015] Furthermore, the aforementioned microorganism-containing food is a compressed candy or a powder.

[0016] Furthermore, the aforementioned microorganism-containing food also includes acceptable ingredients in food, such as milk powder, yogurt powder, skimmed milk powder, powdered sugar, lactose, sorbitol, dextrin, syrup, natural essential oils, artificial flavors, sodium stearate (magnesium), water, ethanol, malic acid, citric acid (sodium, potassium salt), etc.

[0017] Furthermore, in the aforementioned microorganism-containing food, the content of animal Bifidobacterium lactis subspecies BL-G75 is 2×10 11 ~6×10 11 CFU / g.

[0018] In another embodiment, the aforementioned microbial preparation is a health product.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The animal Bifidobacterium lactis subspecies BL-G75 with a preservation number of CCTCC NO: M 20221827 provided by the present invention is isolated from feces of healthy normal people and has a safe source; it can promote intestinal peristalsis, regulate gastrointestinal function, and have the effect of moisturizing the intestine and relieving constipation, and has good tolerance to acidic environment and bile salts, excellent stability in low temperature environment, and has good prospects for development as a probiotic. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a colony morphology characteristic diagram of animal Bifidobacterium lactis subspecies BL-G75 inoculated in MRS medium obtained in Example 1;

[0022] Figure 2 This is a morphological picture of animal Bifidobacterium lactis subspecies BL-G75 obtained in Example 1 after Gram staining under a microscope;

[0023] Figure 3 This is a trend diagram of the change in the number of live bacteria of animal Bifidobacterium lactis subspecies BL-G75 with acid treatment time in Example 4;

[0024] Figure 4 This is a graph showing the trend of the number of live bacteria of animal Bifidobacterium lactis subspecies BL-G75 as a function of bile salt treatment time in Example 5;

[0025] Figure 5 These are the temperature stability curves of freeze-dried bacterial powder of animal Bifidobacterium lactis subspecies BL-G75 in Example 6. DETAILED DESCRIPTION

[0026] The following examples are further given to illustrate the present invention in detail. It should also be understood that the following examples are only used to further illustrate the present invention and cannot be understood as limiting the scope of protection of the present invention. Some non-essential improvements and adjustments made by those skilled in the art based on the above content of the present invention belong to the scope of protection of the present invention.

[0027] Example 1 Screening of Bifidobacterium animalis subsp. lactis BL-G75

[0028] The feces from healthy people are used as samples, the samples are mixed, 0.5 mL of the sample is drawn and added to 4.5 mL of 0.85% physiological saline for gradient dilution, and a suitable gradient dilution is selected and coated on an MRS solid culture medium, and cultured in an anaerobic environment at 37°C for 48 hours, and a single colony is picked, streaked on an MRS plate, and cultured in an anaerobic environment at 37°C for 48 hours. A single colony is picked and inoculated on an MRS liquid culture medium for culture to obtain a bacterial solution of animal Bifidobacterium lactis subspecies BL-G75; the obtained bacterial solution is centrifuged at a speed of 6000 rpm for 30 minutes, the supernatant is removed, and the precipitate is collected to obtain a bacterial mud of animal Bifidobacterium lactis subspecies BL-G75.

[0029] Example 2 Colony characteristics and microscopic morphology of Bifidobacterium animalis subsp. lactis BL-G75

[0030] The animal Bifidobacterium lactis subspecies BL-G75 obtained in Example 1 was streaked and inoculated on an MRS medium plate and cultured anaerobically for 48 h. The morphological characteristics, size, club shape and distribution of the colonies were observed. Figure 1 As shown, after culturing in the above medium for 48 h, animal Bifidobacterium lactis subspecies BL-G75 showed round protrusions with smooth edges and surfaces, white, opaque, and uniform-sized colonies;

[0031] The cultured animal Bifidobacterium lactis subspecies BL-G75 was then subjected to Gram staining and observed under a microscope. Figure 2 As shown, Bifidobacterium animalis subspecies lactis BL-G75 is a Gram-positive bacterium, showing a typical morphology of bifidobacteria, single, irregular, club-shaped or bifurcated.

[0032] Example 3 Identification of Bifidobacterium animalis subsp. lactis BL-G75

[0033] The animal Bifidobacterium lactis subspecies BL-G75 obtained in Example 1 was stored in a slant test tube and sent to a third-party institution (Institute of Microbiology, Chinese Academy of Sciences) for identification of its physiological and biochemical characteristics, 16S rRNA, and tuf gene sequences. The results are as follows:

[0034] Table 1 Physiological and biochemical characteristics of Bifidobacterium animalis subsp. lactis BL-G75

[0035]

[0036]

[0037] The 16S rRNA gene sequence is shown in SEQ ID NO: 1:

[0038]

[0039] The sequencing of the Tuf gene is as shown in SEQ ID NO:2:

[0040] CAGCAGCGTGGTATCACCATCAACATTGCCCACATCGAGTACCAGACGGCCAAGCGTCACTACGCCCACGTCGACTGCCCGGGCCACGCCGACTTCGTGAAGAACATGATCACCGGCGCTGCCCAGATGGATGGCGCCATCCTCGTTGTGGCCGCCACCGACGGCCCGATGGCCCAGACCCGCGAGCACGTGCTGCTCGCCCGTCAGGTCGGCGTCCCGAAGATCCTCGTCGCTCTGAACAAGTGCGATATGGTCGATGACGAAGAGCTCATCGAGCTCGTCGAAGAAGAGGTCCGCGACCTCCTCGACGAGAACGGCTTCGACCGCGACTGCCCGGTCGTGCACACCTCCGCTTACGGCGCTCTGCATGACGACGCTCCGGATCACGACAAGTGGGTTGCCACCATCAAGGAGCTCATGGACGACGTCGACGAGTACATCCCGACCCCGGTCCACGACCTCGACAAGCCGTTCCTGATGCCGATCGAGGACGTCTTCACCATCTCCGGCCGTGGCACCGTCGTCACCGGTCGTGTCGAGCGCGGCAAGCTGCCGATCAACACGAACGTCGAGATCGTCGGCATCCGCCCGACCCAGACCACCACCGTCACCTCCATCGAGACCTTCCACAAGCAGATGGATGAGTGCGAGGCCGGCGACAACACCGGTCTGCTGCTCCGCGGCATCAACCGCACCGACGTCGAGCGTGGCCAGGTCGTGGCTGCTCCGGGTTCGGTCACCCCGCACACCAAGTTCGAAGGCGAAGTCTACGTCCTTACCAAGGATGAGGGCGGCCGTCACTCGCCGTTCTTCTCGAACTACCGTCCGCAGTTCTACTTCCGCACCACCGACGTCACCGGCGTCATCACGCTGCCGGAAGGCGTCGAGATGGTTCAGCCT

[0041] The above identification results were compared with the relevant research papers in Bergey's Manual of Systematic and Evolutionary Microbiology and the International Journal of Systematic and Evolutionary Microbiology, and BL-G75 was identified as Bifidobacterium animalis subsp. lactis, i.e. Bifidobacterium lactis.

[0042] Example 4 Acid resistance of Bifidobacterium animalis subsp. lactis BL-G75

[0043] 1. Preparation of freeze-dried powder of animal Bifidobacterium lactis subspecies BL-G75:

[0044] The animal Bifidobacterium lactis subspecies BL-G75 bacterial sludge prepared in Example 1 was mixed with the sterilized freeze-drying protective agent, pre-frozen at -50°C for 3 h, and then vacuum-freezed for 20 h, and crushed to obtain animal Bifidobacterium lactis subspecies BL-G75 freeze-dried bacterial powder with a live bacterial content of 4×10 11 CFU / g;

[0045] The composition of the freeze-drying protective agent and its ratio to the bacterial mud: by mass, in the freeze-drying protective agent, skim milk powder: trehalose: glycerol: glycine: sodium ascorbate = 3:4:1:3:1, bacterial mud: freeze-drying protective agent = 1:2;

[0046] 2. Prepare acid-resistant experimental materials:

[0047] (1) Prepare 0.85% (w / w) physiological saline, adjust the pH value to 2 or 3 with 10% hydrochloric acid, dispense into 15*150 mm glass test tubes, 4.5 mL each, sterilize at 121°C for 15 minutes and set aside;

[0048] (2) Dispense 36 mL of normal saline into a 100 mL reagent bottle, add several glass beads with a particle size of 5-6 mm, and dispense into 15*150 mm glass test tubes, 4.5 mL each, sterilize at 121°C for 15 minutes and set aside;

[0049] 3. Experimental steps:

[0050] (1) Weigh 4 g of freeze-dried bacterial powder of Bifidobacterium animalis subsp. lactis BL-G75 and dissolve it in 36 mL of normal saline, mix thoroughly to obtain a bacterial suspension, and set aside;

[0051] (2) Pipette 0.5 mL of the bacterial suspension obtained in step (1) into a 4.5 mL saline test tube and mix thoroughly to prepare 10 -2 Dilution of bacterial suspension was prepared in this way.-3 ~10 -10 Dilute the bacterial suspension and count the colonies using the plate pouring method;

[0052] (3) Pipette 0.5 mL of the bacterial suspension obtained in step (1) into a 4.5 mL test tube of acidic physiological saline and mix thoroughly to prepare 10 -2 The diluted bacterial suspension was placed in a 37°C water bath; it was taken out at 1h, 2h, 3h and 4h, respectively, diluted with physiological saline, and the colony count was performed by the plate pouring method.

[0053] 4. Experimental Results

[0054] The count results of the bacterial suspension diluted with saline in step (2) were used as the 0h control, and the count results of the bacterial suspension after being treated with acidic saline for 1h, 2h, 3h and 4h were counted. A curve was drawn with the treatment time as the abscissa and the count results as the ordinate. The results are shown in FIG. Figure 3 After Bifidobacterium animalis subspecies lactis BL-G75 was treated in pH 2.0 acidic saline for 1 hour, the number of viable bacteria increased from 3.6×10 11 CFU / g decreased to 2.3×10 10 CFU / g, with a survival rate of 6.39%. When the treatment time was increased to 4 hours, the number of viable bacteria decreased to 5.0×10 9 CFU / g. After being treated in pH 3.0 acidic saline for 1 hour, the number of viable bacteria increased from 3.6×10 11 CFU / g decreased to 9.0×10 10 CFU / g, survival rate 25.00%. When the treatment time was increased to 4 hours, the number of viable bacteria decreased to 2.0×10 10 CFU / g. The experimental results showed that the bacteria had good acid resistance.

[0055] Example 5 Bile salt tolerance of Bifidobacterium animalis subsp. lactis BL-G75

[0056] 1. Prepare materials for bile salt tolerance experiment:

[0057] (1) Prepare 0.85% (w / v) normal saline, add porcine bile salt to form bile salt solutions with concentrations of 0.2% and 0.3%, respectively, dispense into 15*150 mm glass test tubes, 4.5 mL per tube, sterilize at 121°C for 15 minutes and set aside;

[0058] (2) Prepare 36 mL of 0.85% (w / v) physiological saline, dispense into a 100 mL reagent bottle, add several glass beads with a particle size of 5-6 mm, and dispense into 15*150 mm glass test tubes, 4.5 mL per tube, sterilize at 121°C for 15 minutes and set aside;

[0059] (3) The freeze-dried powder of Bifidobacterium lactis subspecies BL-G75 prepared in Example 4.

[0060] 2. Experimental Procedure

[0061] (1) Weigh 4 g of the bacterial powder to be tested and dissolve it in 36 mL of normal saline and mix thoroughly;

[0062] (2) Pipette 0.5 mL of the bacterial suspension obtained in step (1) into a normal saline test tube and mix thoroughly to prepare 10 -2 Dilution of bacterial suspension was prepared in this way. -3 ~10 -10 Dilute the bacterial suspension and count the colonies using the plate pouring method;

[0063] (3) Pipette 0.5 mL to 4.5 mL of the bacterial suspension obtained in step (1) into a test tube containing 0.2% and 0.3% pig bile salt, mix thoroughly, place in a 37°C water bath, take out after 1 h, 2 h, 3 h and 4 h, dilute with physiological saline, and count the colonies by the plate pouring method.

[0064] 3. Experimental results

[0065] The bacterial suspension count results diluted with saline in step 2 were used as the 0h control, and the bacterial suspension count results after bile salt treatment for 1h, 2h, 3h and 4h were counted. The curve was drawn with the treatment time as the abscissa and the count results as the ordinate. The results are shown in Figure 4 After Bifidobacterium animalis subsp. lactis BL-G75 was treated with 0.2% bile salt for 1 hour, the number of viable bacteria increased from 3.6×10 11 CFU / g decreased to 1.4×10 11 CFU / g, the survival rate reached 38.9%, and the number of viable bacteria was 1.2×10 10 CFU / g, with a survival rate of 3.3%. After being treated in 0.3% bile salt for 1 hour, the number of viable bacteria was 8.0×10 10 CFU / g, survival rate 22.2%, treatment time increased by 4 hours, the number of viable bacteria was 3.4×10 9 CFU / g. The experimental results showed that the bacteria had good bile salt tolerance.

[0066] Example 6 Stability of freeze-dried powder of Bifidobacterium animalis subsp. lactis BL-G75

[0067] The animal Bifidobacterium lactis subsp. BL-G75 bacterial sludge prepared in Example 1 was adjusted to a water activity Aw0.125 and a moisture content of 4.5% under an environment of RH≤50±2% and temperature≤25±1°C, and packaged in an aluminum foil bag as a sample bacterial powder to be tested; the sample was stored at -18°C±2°C, 4±2°C, and 25±2°C, and samples were taken at regular intervals to track changes in the bacterial count; the animal Bifidobacterium lactis subsp. was counted using the method of "GB4789.34 National Food Safety Standard Food Microbiology Test Bifidobacterium Identification".

[0068] The stability test results are shown in Table 2, and the data graphical analysis is shown in Figure 5 .

[0069] Table 2 Effect of storage temperature on the viable count of Bifidobacterium lactis subsp. BL-G75

[0070]

[0071]

[0072] From Table 2 and Figure 5 It can be seen that under the storage condition of 25℃, the number of live bacteria in the sample will decrease with the storage time. After 24 months of storage, the number of live bacteria in the sample remains at 4.6×10 11 cfu / g, survival rate 68%. Under 4℃ and -18℃ storage conditions, the number of live bacteria in the sample remained basically unchanged with the storage time, indicating that animal Bifidobacterium lactis subspecies BL-G75 has excellent storage stability, and low-temperature storage is conducive to improving the stability of animal Bifidobacterium lactis subspecies BL-G75 powder.

[0073] Example 7 Effect of promoting intestinal peristalsis of freeze-dried powder of Bifidobacterium animalis subsp. lactis BL-G75

[0074] The animal Bifidobacterium lactis subspecies BL-G75 freeze-dried bacterial powder prepared in Example 4 was packaged in an aluminum foil bag and sent to a third-party agency (Guangdong HUAWEI Testing Co., Ltd.) to test its intestinal motility-promoting effect by measuring the defecation time, the number of feces particles and the weight of feces in the mouse small intestinal motility test. Positive (effective) standard: if any of the results of feces weight and the number of feces particles within 6 hours are positive, and any of the results of the small intestinal motility test and the defecation time are positive, the test result can be judged to be positive.

[0075] (1) Small Intestine Motility Experiment

[0076] 1. Materials and Animals

[0077] (1) Test sample: The freeze-dried powder of Bifidobacterium animalis subsp. lactis BL-G75 prepared in Example 4.

[0078] (2) Experimental animals: 50 SPF-grade ICR mice, male, with a starting body weight of 18 - 22 g, provided by Guangdong Vital River Laboratory Animal Technology Co., Ltd., license number: SCXK(Yue)2022 - 0063; animal quality certificate number: 44829700008220. After the animals were purchased, they were housed in cages of 5 in the barrier environment animal house of our company and used after passing the quarantine.

[0079] (3) Breeding environment: Experimental animal use license number: SYXK(Yue)2023 - 0249. Animal house temperature: 20°C - 25°C, relative humidity: 40% - 70%, no abnormal phenomena in temperature and humidity changes. The light control has a light-dark ratio of 12 hours:12 hours.

[0080] (4) Feed source: Henan Huanyu HeKang Biotechnology Co., Ltd.; production license number: SCXK(Yu)2020 - 0004; production date: January 20, 2023; quality certificate number: 4109782300011834

[0081] 2. Methods

[0082] (1) Sample preparation: Prepare sample solutions at 3 concentrations

[0083] High concentration dose: Weigh 0.0042 g of the test sample and add pure water to make a 10 mL solution;

[0084] Medium concentration dose: Weigh 0.0014 g of the test sample and add pure water to make a 10 mL solution;

[0085] Low concentration dose: Weigh 0.0004 g of the test sample and add pure water to make a 10 mL solution.

[0086] (2) Dose grouping and administration time of the test sample

[0087] Based on the recommended human dose of 0.025 g / 60 kg / day of the freeze-dried powder of Bifidobacterium animalis subsp. lactis BL-G57, 1-fold, 3.3-fold, and 10-fold are used as 3 dose groups; thus, the designed doses are: low dose group 0.0004 g / kg / day, medium dose group 0.0014 g / kg / day, and high dose group 0.0042 g / kg / day. The negative control group and the model control group are given pure water by the same route at 0.0042 g / kg / day. Oral administration is continued for 7 days.

[0088] (3) Establishment of animal model

[0089] After 7 days of administration of the test samples, the mice in each group were fasted but not watered for 16 hours.

[0090] The model control group and the three dose groups were given loperamide (4 mg / kg BW) by gavage, and the negative control group was given pure water.

[0091] (4) Methods for determining indicators

[0092] 0.5 hours after the administration of loperamide, each dosage group was given ink containing the corresponding test sample (containing 5% activated carbon powder and 10% gum arabic), and the negative and model control groups were given ink by gavage.

[0093] After 25 minutes, the animals were immediately killed by dislocating the cervical vertebrae, the abdominal cavity was opened and the mesentery was separated, the intestinal tube from the pylorus at the upper end to the ileocecal part at the lower end was cut, and placed on a tray. The small intestine was gently pulled into a straight line, and the length of the intestinal tube was measured as the "total length of the small intestine", and the length from the pylorus to the front of the ink was the "ink advancement length".

[0094] Calculate the ink advancement rate as follows:

[0095]

[0096] (5) Data processing and result determination

[0097] The ink advancement rate needs to be converted. Where p is the ink advancement rate, expressed as a decimal. When performing variance analysis, it is necessary to first perform a variance homogeneity test according to the variance analysis procedure. If the variance is homogeneous, calculate the F value. If the F value is less than F 0.05 Conclusion: There is no significant difference in the mean values ​​of each group; F value ≥ F 0.05 , P≤0.05, and the pairwise comparison method between the means of multiple experimental groups and a control group was used for statistics; for non-normal data or data with uneven variance, appropriate variable transformation was performed, and after the normality or variance equality requirements were met, the transformed data were used for statistics; if the normality or variance equality was still not achieved after the variable transformation, the rank sum test was used for statistics.

[0098] On the premise that the model is established, when the ink propagation rate of the test sample group mice is significantly higher than that of the model control group, the experimental result can be determined to be positive.

[0099] 3. Experimental results

[0100] The experimental results are shown in Table 3 below.

[0101] Table 3 Ink propulsion rate in mouse intestine

[0102] Group Ink advancement rate (%) Negative control group 82.46±6.63 Model control group 51.12±5.47 Low dose group 65.59±6.01 Medium dose group 71.28±6.84 High dose group 76.74±7.10

[0103] Data analysis shows that:

[0104] In the test of homogeneity of variance, P = 0.697 > 0.05, and the variances were considered to be homogeneous.

[0105] Calculated F value = 14.299, P value = 0.000 < 0.05, then F value ≥ F 0.05 , P ≤ 0.05, and the statistical data were analyzed by pairwise comparison of the means between multiple experimental groups and one control group.

[0106] The results of pairwise comparisons showed that in the LSD method, there were significant differences between the model control group and the negative control group, the model control group and the low-dose group, the model control group and the medium-dose group, and the model control group and the high-dose group.

[0107] The mouse small intestinal motility inhibition model was established, and the ink propulsion rates of mice in each dose group of the test sample were significantly higher than those in the model control group, indicating that the experimental results were positive.

[0108] (II) Determination of defecation time, number of stool particles and stool weight

[0109] Materials, animals, sample preparation, model establishment, and data are the same as in (I) Small intestinal motility experiment.

[0110] Specific method of index determination: 0.5 hours after loperamide administration, the dose groups were given ink containing the corresponding test samples (containing 5% activated carbon powder and 10% gum arabic), and the negative and model control groups were given ink by gavage. All animals were housed in single cages and fed with normal water and food.

[0111] Starting from the time of ink injection, the time of the first black stool excretion, the number and weight of black stool excreted within 6 hours were recorded for each animal.

[0112] The feces of mice before the first black stool should be removed.

[0113] Data processing:

[0114] The data were analyzed by variance analysis. The variance homogeneity test was performed according to the variance analysis procedure. If the variance was homogeneous, the F value was calculated. <F 0.05 Conclusion: There is no significant difference in the mean values ​​of each group; F value ≥ F 0.05 , P≤0.05, and the pairwise comparison method between the means of multiple experimental groups and a control group was used for statistics; for non-normal data or data with uneven variance, appropriate variable transformation was performed, and after the normality or variance equality requirements were met, the transformed data were used for statistics; if the normality or variance equality was still not achieved after the variable transformation, the rank sum test was used for statistics.

[0115] On the premise that the small intestinal constipation model is established, the time for the first black stool to be excreted by the mice in the test sample group is significantly shorter than that in the model control group, which can determine that the result of this indicator is positive.

[0116] The experimental results are shown in Table 4 below.

[0117] Table 4 Defecation time, feces number and feces weight of mice

[0118]

[0119] (1) Results of the experiment on the time of first black stool discharge

[0120] In the test of homogeneity of variance, P = 0.105> 0.05, and the variances were considered to be homogeneous.

[0121] Calculated F value = 28.960, P value = 0.000 < 0.05, then F value ≥ F 0.05 , P ≤ 0.05, and the statistical data were analyzed by pairwise comparison of the means between multiple experimental groups and one control group.

[0122] The results of pairwise comparisons showed that in the LSD method, there were significant differences in the time to first black stool between the model control group and the negative control group, the model control group and the low-dose group, the model control group and the medium-dose group, and the model control group and the high-dose group.

[0123] (2) Results of the black stool count test

[0124] In the test of homogeneity of variance, P = 0.062>0.05, and the variances were considered to be homogeneous.

[0125] Calculated F value = 35.938, P value = 0.000 < 0.05, then F value ≥ F 0.05 , P ≤ 0.05, and the statistical data were analyzed by pairwise comparison of the means between multiple experimental groups and one control group.

[0126] The results of pairwise comparison showed that in the LSD method, there were significant differences in the number of black stool particles within 6 hours between the model control group and the negative control group, the model control group and the low-dose group, the model control group and the medium-dose group, and the model control group and the high-dose group.

[0127] (3) Results of the black stool weight test

[0128] In the variance homogeneity test, P = 0.011 < 0.05, which means the variance is not homogeneous. The data are appropriately transformed: X = P^(1 / 2), where P is the weight of black stool within 6 hours, expressed as a decimal. After meeting the normality or variance homogeneity requirements, the transformed data are used for statistics.

[0129] In the test of homogeneity of variance, P = 0.888 > 0.05, and the variances were considered to be homogeneous.

[0130] Calculated F value = 49.542, P value = 0.000 < 0.05, then F value ≥ F 0.05 , P ≤ 0.05, and the statistical data were analyzed by pairwise comparison of means between multiple experimental groups and one control group.

[0131] The results of pairwise comparisons showed that in the LSD method, there were significant differences in the weight of black stool within 6 hours between the model control group and the negative control group, the model control group and the low-dose group, the model control group and the medium-dose group, and the model control group and the high-dose group.

[0132] The mouse small intestinal constipation model was established. The time of the first black stool in the test sample group was significantly shorter than that in the model control group, and the result of this indicator was determined to be positive. The number of black stools discharged within 6 hours was significantly higher than that in the model control group, and the result of this indicator was determined to be positive; the weight of black stools discharged within 6 hours was significantly higher than that in the model control group, and the result of this indicator was determined to be positive.

[0133] Based on the results of the mouse small intestinal motility experiment and the determination of defecation time, fecal particle number and fecal weight, it can be seen that the freeze-dried bacterial powder of animal Bifidobacterium lactis subsp. BL-G75 can significantly promote intestinal motility in mice and improve experimental constipation in mice, and this effect is dose-dependent.

[0134] Example 8 Effect of promoting intestinal peristalsis of Bifidobacterium animalis subsp. lactis BL-G75 tablet candy

[0135] The animal Bifidobacterium lactis subspecies BL-G75 bacterial mud prepared in Example 1 was made into tablet candies, packaged in aluminum foil bags, and sent to a third-party agency (Guangdong HUAWEI Testing Co., Ltd.), and its intestinal motility-promoting effect was tested by the small intestinal motility test of mice, the defecation time, the number of feces particles and the weight of feces. Positive (effective) standard: if any of the results of feces weight and the number of feces particles within 6 hours are positive, and any of the results of the small intestinal motility test and the defecation time are positive, the test result can be judged to be positive.

[0136] (I) Preparation of animal Bifidobacterium lactis subspecies BL-G75 tablet candy:

[0137] The animal Bifidobacterium lactis subspecies BL-G75 bacterial slurry prepared in Example 1 is mixed with sorbitol, porous dextrin and magnesium stearate to obtain a premix 1;

[0138] Separately prepare lactose, yogurt powder, oligofructose, maltitol, and skim milk powder and mix them evenly to obtain premix 2;

[0139] Premix 2 is moistened with 90% ethanol and made into granules with a moisture content of 2.5-3.5% and a mesh size of 14 at 60-65°C;

[0140] The premix 1 is mixed with the premix 2 particles according to a certain proportion, and the mixture is pressed into tablets to obtain animal Bifidobacterium lactis subspecies BL-G75 tablet candies.

[0141] The formula of animal Bifidobacterium lactis subspecies BL-G75 compressed candy is as follows, in parts by mass: 12 parts of maltitol, 8 parts of yogurt powder, 1.5 parts of skimmed milk powder, 13.5 parts of sorbitol, 4.5 parts of dextrin, 5 parts of animal Bifidobacterium lactis subspecies BL-G75, and 0.5 parts of magnesium stearate.

[0142] (II) Small Intestinal Motility Test

[0143] The experimental animals, experimental methods, model establishment, index determination methods, data processing and result determination are the same as those in Example 7 (I) Small Intestinal Motility Experiment. The number of experimental animals is 30.

[0144] Test samples: (i) prepared Bifidobacterium animalis subsp. lactis BL-G75 compressed candy.

[0145] Dosage grouping: According to the recommended human dose of 0.45g / 60kg / day, 10 times as a single dose group. The finished product single dose group is 0.075g / kg / day, and the test sample is administered for 7 days.

[0146] The experimental results are shown in Table 5 below.

[0147] Table 5 Ink propulsion rate in mouse intestine

[0148] Group Ink advancement rate (%) Negative control group 84.50±6.21 Model control group 48.96±5.05 Finished single dose group 69.77±6.30

[0149] The results in the above table are shown after data analysis:

[0150] In the test of homogeneity of variance, P = 0.948 > 0.05, and the variances were considered to be homogeneous.

[0151] Calculated F value = 30.652, P value = 0.000 < 0.05, then F value ≥ F 0.05 , P ≤ 0.05, and the statistical data were analyzed by pairwise comparison of the means between multiple experimental groups and one control group.

[0152] The results of pairwise comparisons showed that in the LSD method, there were significant differences between the model control group and the negative control group, and between the model control group and the finished product single-dose group.

[0153] The mouse small intestinal motility inhibition model was established, and the ink propulsion rate of the test sample group mice was significantly higher than that of the model control group, indicating that the experimental result was positive.

[0154] (III) Determination of defecation time, number of stool particles and stool weight

[0155] The experimental animals, experimental methods, model establishment, index determination methods, data processing and result determination are the same as those in Example 7 (II) Determination of defecation time, number of feces particles and feces weight. The number of experimental animals is 30.

[0156] Test samples: (i) prepared Bifidobacterium animalis subsp. lactis BL-G75 compressed candy.

[0157] Dosage grouping: Weigh 0.0750 g of the test sample and add pure water to prepare 10 mL of solution.

[0158] The experimental results are shown in Table 6 below.

[0159] Table 6 Defecation time, feces number and feces weight of mice

[0160]

[0161] (1) Results of the first black stool time test

[0162] In the test of homogeneity of variance, P = 0.052>0.05, and the variances were considered to be homogeneous.

[0163] Calculated F value = 69.611, P value = 0.000 < 0.05, then F value ≥ F 0.05 , P ≤ 0.05, and the statistical data were analyzed by pairwise comparison of the means between multiple experimental groups and one control group.

[0164] The results of pairwise comparison showed that in the LSD method, there were significant differences in the time to first black stool between the model control group and the negative control group, and between the model control group and the finished product single-dose group.

[0165] (2) Results of the black stool count test

[0166] In the test of homogeneity of variance, P = 0.914 > 0.05, and the variances were considered to be homogeneous.

[0167] Calculated F value = 61.127, P value = 0.000 < 0.05, then F value ≥ F 0.05 , P ≤ 0.05, and the statistical data were analyzed by pairwise comparison of the means between multiple experimental groups and one control group.

[0168] The results of pairwise comparison showed that in the LSD method, there were significant differences in the number of black stool particles within 6 hours between the model control group and the negative control group, and between the model control group and the finished product single-dose group.

[0169] (3) Results of the black stool weight test

[0170] In the variance homogeneity test, P = 0.006 < 0.05, which means the variance is not homogeneous. The data are appropriately transformed: X = P^(1 / 2), where P is the weight of black stool within 6 hours, expressed as a decimal. After meeting the normality or variance homogeneity requirements, the transformed data are used for statistics.

[0171] In the test of homogeneity of variance, P = 0.848 > 0.05, and the variances were considered to be homogeneous.

[0172] Calculated F value = 107.476, P value = 0.000 < 0.05, then F value ≥ F 0.05 , P ≤ 0.05, and the statistical data were analyzed by pairwise comparison of means between multiple experimental groups and one control group.

[0173] The results of pairwise comparison showed that in the LSD method, there were significant differences in the weight of black stool within 6 hours between the model control group and the negative control group, and between the model control group and the finished product single-dose group.

[0174] The mouse small intestinal constipation model was established. The time of the first black stool in the test sample group was significantly shorter than that in the model control group, and the result of this indicator was determined to be positive. The number of black stools discharged within 6 hours was significantly higher than that in the model control group, and the result of this indicator was determined to be positive; the weight of black stools discharged within 6 hours was significantly higher than that in the model control group, and the result of this indicator was determined to be positive.

[0175] Based on the results of the mouse small intestinal motility experiment and the determination of defecation time, fecal particle number and fecal weight, it can be seen that the animal Bifidobacterium lactis subsp. BL-G75 compressed candy can significantly promote intestinal motility in mice and improve experimental constipation in mice.

[0176] It should be understood that the application of the present invention is not limited to the above examples. For ordinary technicians in this field, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. A strain of Bifidobacterium animalis subsp. lactis BL-G75 ( Bifidobacteriumanimalis subsp. lactis BL-G75), deposit number CCTCCNO: M 20221827.

2. The animal Bifidobacterium lactis subspecies BL-G75 ( Bifidobacterium animalis subsp. lactis Application of BL-G75) in the preparation of microbial preparations for promoting intestinal motility.

3. A method comprising the animal Bifidobacterium lactis subspecies BL-G75 ( Bifidobacteriumanimalis subsp. lactis BL-G75), characterized in that The microbial preparation is used for promoting intestinal motility.

4. The microbial preparation according to claim 3, characterized in that The microbial preparation is a medicine.

5. The microbial preparation according to claim 4, characterized in that The microbial preparation is in the form of tablets or powders.

6. The microbial preparation according to claim 4, characterized in that The microbial preparation further contains pharmaceutically acceptable excipients.

7. The microbial preparation according to claim 4, characterized in that In the microbial preparation, the animal Bifidobacterium lactis subspecies BL-G75 ( Bifidobacteriumanimalis subsp. lactis BL-G75) has a content of 2×10 11 ~6×10 11 CFU / g.

8. The microbial preparation according to claim 3, characterized in that The microbial preparation is food.

9. The microbial preparation according to claim 8, characterized in that The microbial preparation is in the form of compressed candy or powder.

10. The microbial preparation according to claim 8, characterized in that It also contains ingredients acceptable in food.

11. The microbial preparation according to claim 8, characterized in that In the microbial preparation, the animal Bifidobacterium lactis subspecies BL-G75 ( Bifidobacteriumanimalis subsp. lactis BL-G75) has a content of 2×10 11 ~6×10 11 CFU / g.

12. The microbial preparation according to claim 3, characterized in that: The microbial preparation is a health product.

Images