A method for detecting ASFV

Abstract

The present application provides a method for detecting ASFV, comprising the following steps: using a DNA release kit to release the ASFV genome for standby use; using an RAA kit to amplify the ASFV target DNA; using a restriction endonuclease to cut the restriction site of the amplified product; the cutting product releases a directional DNA with phosphorylation modification, which binds to PfAgo at 95°C and cuts the probe, resulting in the separation of the fluorescent group and the quenching group, thereby releasing the fluorescent signal, and observing under ultraviolet light to complete the detection of ASFV. This detection method combines RAA amplification, restriction endonuclease reaction and PfAgo reaction, does not require the introduction of additional gDNA, has high sensitivity and specificity, and at the same time, after the REPD reaction, fluorescence can be observed under ultraviolet radiation, and a test strip can also be used to determine the positive rate of the sample. The entire detection process can be completed within 80 minutes, with low detection equipment requirements, low cost, and easy operation and control.

Description

Technical Field

[0001] The present invention relates to a virus detection method, and in particular to an ASFV detection method. Background Art

[0002] The diagnostic methods for ASFV (African swine fever virus) mainly include virus isolation, serological detection, PCR and qPCR detection. However, these methods all have certain limitations. For example, the isolation of the virus requires a professional laboratory and takes a long time. Serological detection is not used for early diagnosis because it takes a long time for antibodies to be produced after viral infection and has limited sensitivity. PCR and qPCR are commonly used molecular diagnostic methods, but they require well-trained professional operators and precise instruments. In addition, these methods cannot be used in resource-poor areas. At present, CRISPR-based detection methods are widely used to detect various pathogens, and these methods have high specificity and sensitivity. For example, Cas12a and Cas13a are being widely used. Both methods require the guidance of crRNA to cut the target nucleic acid. Because crRNA is easily affected by the environment, its high cost and harsh storage conditions limit its application.

[0003] Pyrocococcus furiosus Argonaute (PfAgo) is a prokaryotic Argonaut from Pyroccoccus furiosus. It is a nucleic acid-guided endonuclease that cleaves DNA substrates guided by short 5′-phosphorylated single-stranded DNA in the absence of a protospacer adjacent motif (PAM). Argonaute has recently emerged in the field of nucleic acid detection and is gradually gaining widespread attention. Argonaute-based detection systems mainly include two-step and one-step cleavage. Unlike the two-step pyrolysis method that relies on a primary cleavage reaction, the one-step pyrolysis method can directly cleave the probe without the need for additional gDNA to cleave the target DNA to release new gDNA and then cleave the probe, thereby improving the utilization of PfAgo. Although one-step cleavage has been reported to be used for detection, both methods are highly dependent on the specificity of the primers and are therefore often prone to false-positive results. In addition, both methods rely on PCR machines, which contradicts minimizing instrument dependence.

[0004] Therefore, it is of great significance to develop a detection method for ASFV that has low detection equipment requirements, low cost, high sensitivity and specificity. Summary of the invention

[0005] The purpose of the present invention is to provide a method for detecting ASFV in view of the problems that the detection method of ASFV in the prior art has high requirements for detection equipment, strict detection conditions, high cost or low accuracy of detection results. The detection method combines RAA amplification, restriction endonuclease reaction and PfAgo reaction, does not require the introduction of additional gDNA, has high sensitivity and specificity, and at the same time, after REPD reaction, fluorescence can be observed under ultraviolet radiation to determine the positive rate of the sample. The entire detection process can be completed within 80 minutes, the detection equipment requirements are low, the cost is low, and it is easy to operate and control.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] A method for detecting ASFV comprises the following steps:

[0008] Step 1: Use a DNA release kit to release the ASFV genome for later use;

[0009] Step 2: Amplify ASFV target DNA using the RAA kit;

[0010] Step 3, using restriction endonucleases to cleave restriction sites of the amplified product;

[0011] Step 4: Mix the PfAgo endonuclease, the enzyme cleavage reaction product obtained in step 3, the MnCl2 solution, and the probes modified with FAM and BHQ1, and then use a real-time fluorescence quantitative PCR instrument to perform the RAA-PfAgo reaction at 92-98°C for at least 30 minutes and observe under ultraviolet light to complete the detection of ASFV.

[0012] The present application provides a method for detecting ASFV, comprising the following steps: using a DNA release kit to release the ASFV genome for standby use; using an RAA kit to amplify the ASFV target DNA; using a restriction endonuclease to cut the restriction site of the amplified product; the cutting product releases a directional DNA with phosphorylation modification, which binds to PfAgo at 95°C and cuts the probe, resulting in the separation of the fluorescent group and the quenching group, thereby releasing the fluorescent signal, and observing under ultraviolet light to complete the detection of ASFV. This detection method combines RAA amplification, restriction endonuclease reaction and PfAgo reaction, does not require the introduction of additional gDNA, has high sensitivity and specificity, and at the same time, after the REPD reaction, fluorescence can be observed under ultraviolet radiation, and a test strip can also be used to determine the positive rate of the sample. The entire detection process can be completed within 80 minutes, with low detection equipment requirements, low cost, and easy operation and control.

[0013] Furthermore, recombinase-assisted amplification (RAA) is an isothermal amplification technique that achieves DNA amplification in vitro.

[0014] Furthermore, the present application combines PfAgo, recombinase-assisted amplification and restriction endonuclease (AluI restriction endonuclease can recognize AGCT site and cut double-stranded DNA in 37°C buffer) to establish a technology that can detect pathogens within 80 minutes.

[0015] Furthermore, the "triple guarantee" of RAA primer specificity, specific restriction endonuclease recognition site, PfAgo and gDNA specific recognition probe greatly improves the specificity and accuracy of this method in detecting ASFV.

[0016] Compared with traditional PfAgo detection, gDNA produced by restriction endonuclease cleavage can directly bind to PfAgo to cleave the probe, increasing the utilization rate of PfAgo-protein and thus significantly improving the effectiveness of the detection.

[0017] Furthermore, in step 1, the deoxyribonucleic acid of ASFV is extracted using a DNA kit and stored at -75 to -85°C for future use.

[0018] Furthermore, in step 2, the temperature of the amplification treatment is 36-38°C.

[0019] Furthermore, in step 3, the specific operation steps are: mixing the enzyme buffer, the amplification product obtained in step 2, the restriction endonuclease and ultrapure water, and then treating the mixture in a water bath at 36-38°C.

[0020] Furthermore, the volume addition ratio of the enzyme buffer, the amplification product, the restriction endonuclease and the ultrapure water is 1.5-2.5:8-12:0.4-0.6:7-8.

[0021] Furthermore, the water bath treatment time is 4 to 6 minutes.

[0022] Furthermore, the volume addition ratio of PfAgo endonuclease and enzyme cleavage reactants is 1.2-1.6:8-12.

[0023] Furthermore, the RAA-PfAgo reaction time is 30 to 45 min.

[0024] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0025] The present application provides a method for detecting ASFV, comprising the following steps: using a DNA release kit to release the ASFV genome for standby use; using a RAA kit to amplify the ASFV target DNA; using a restriction endonuclease to cut the restriction site of the amplified product; the cutting product releases a directional DNA with phosphorylation modification, which binds to PfAgo at 95°C and cuts the probe, resulting in the separation of the fluorescent group and the quenching group, thereby releasing the fluorescent signal, and observing under ultraviolet light to complete the detection of ASFV. This detection method combines RAA amplification, restriction endonuclease reaction and PfAgo reaction, does not require the introduction of additional gDNA, has high sensitivity and specificity, and at the same time, after the REPD reaction, the positive rate of the fluorescent sample can be observed under ultraviolet radiation. The entire detection process can be completed within 80 minutes, with low detection equipment requirements, low cost, and easy operation and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of PfAgo-mediated genome detection.

[0027] Figure 2 This is the Coomassie blue staining image of PfAgo protein.

[0028] Figure 3 Figure 2 is a diagram of the establishment process of REPD fluorescence assay.

[0029] Figure 4 Figure 2 shows the sensitivity and specificity test results of the REPD detection system.

[0030] Figure 5 This figure shows the clinical practical performance results of the REPD portable platform. DETAILED DESCRIPTION

[0031] The present invention will be described in detail below in conjunction with the accompanying drawings.

[0032] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0033] Example

[0034] Materials and methods

[0035] Preparation of viral nucleic acid

[0036] The RNA or DNA of African swine fever virus (ASFV), classical swine fever virus, porcine reproductive and respiratory syndrome virus, pseudorabies virus, porcine circovirus type 2 (PCV2), and porcine circovirus type 3 (PCV3) were extracted using the Tiangen Virus DNA / RNA Kit (Beijing, China). Next, cDNA was synthesized using PrimeScript RT Master Mix (Takara, Beijing, China) and then stored at -80°C (-75 to -85°C is sufficient) until use.

[0037] Synthesis of ASFV plasmid, design of RAA primers and probe

[0038] ASFV positive plasmid PUC-P72 was synthesized by Sangon Biotech Co., Ltd. RAA primers and probes were designed with reference to the conserved region of ASFV P72 gene. Primers (RAA-F: CGACGCATGTTCATCTATCTGATATT, RAA-R: TATCGCATTGCTCGTAGTGGAAGGTA) and fluorescent ssDNA reporter (5′6-FAM-GAAGTATGTAAGC-BHQ1-3′) were synthesized by Sangon Biotech (Shanghai, China).

[0039] Expression and purification of PfAgo

[0040] The pET28a-His-PfAgo expression plasmid was synthesized by Sangon Biotech (Shanghai, China), and the PfAgo protein was expressed and purified according to previous literature. The purified protein was concentrated by 50KD ultrafiltration (Millipore, Darmstadt, Germany) and then stored at -80°C for subsequent experiments.

[0041] Recombinase-assisted amplification

[0042] The RAA reaction is as follows: To dissolve the lyophilized powder, add ultrapure water (13.5 μL), buffer A (25 μL), and 2 μL of a mixture of 10 μM forward and reverse primers to the reaction tube containing the powder. After mixing, aspirate 8.5 μL of the mixture and transfer it to a new EP tube. Then, add 1 μL of template and 0.5 μL of buffer B, and place the test tube in a water bath at 37°C (36-38°C) for 30 minutes.

[0043] Enzyme digestion reaction

[0044] For the enzyme cleavage reaction (Takara, Beijing, China), a 20 μL reaction system was prepared by mixing 2 μL enzyme buffer, 10 μL RAA amplification product, 0.5 μL restriction endonuclease (Alu I) and 7.5 μL ultrapure water. Subsequently, for enzyme cleavage, the reaction tube was placed in a water bath at 37°C (36-38°C) for 5 minutes (4-6 minutes). The volume ratio of enzyme buffer, amplification product, restriction endonuclease and ultrapure water was 1.5-2.5: 8-12: 0.4-0.6: 7-8.

[0045] PfAgo reaction

[0046] To detect ASFV, the REPD assay was performed as follows: PfAgo (1.5 μM) was mixed with the enzyme-digested RAA product (10 μL), MnCl2 (0.5 mM), and a 1 μM probe modified with FAM and BHQ1. A real-time fluorescence quantitative PCR instrument (CFX96TM, Bio-Rad, Hercules, CA, USA) was used to perform the RAA-PfAgo reaction at 95°C for 30 minutes (30 to 45 minutes), and the results were observed under ultraviolet light. Preferably, the volume ratio of PfAgo endonuclease and enzyme digestion reaction is 1.2 to 1.6:8 to 12.

[0047] Sensitivity and specificity of recombinase-assisted amplification combined with restriction endonuclease-assisted PfAgo detection (REPD)

[0048] To investigate the limit of detection (LOD) of REPD, plasmid pUC57 ASFV was quantified using Nanodrop 8000 (ThermoFisher Scientific, USA) and then serially diluted with ddH2O to obtain 1 × 10 3 Up to 1×10 0 The specificity of the REPD assay was evaluated by testing its reactivity with DNA of PRV, ASFV, PCV2, PCV3 or cDNA of PRRSV and classical swine fever virus CSFV.

[0049] On-site sample testing

[0050] Sixteen samples were collected from Sichuan, China from October 2022 to April 2023. Phosphate-buffered saline (PBS) was then added to these samples and frozen and thawed three times. For DNA isolation, the RoomTemp sample lysis kit (Vazyme, Nanjing, Jiangsu, China) was used and detected by REPD. The test results were compared with the ASFV commercial kit (ZC Bio-Sci&Tech Co. Ltd, Hangzhou, Zhejiang, China). For REPD, the reaction temperature (37°C and 95°C) was controlled by a water bath to reduce reliance on complex and expensive instruments.

[0051] Results and discussion

[0052] Principle of PfAgo detection method

[0053] like Figure 1 As shown in Figure 2, the traditional PfAgo detection method requires three gDNAs to guide PfAgo-mediated double-stranded DNA cleavage, release new gDNA and bind to empty PfAgo to cleave the target probe ( Figure 1 The A in the figure represents the traditional PfAgo-mediated genome detection, Figure 1A). This study assumes that the double-stranded DNA is cut by a restriction endonuclease (Alu I) to release new gDNA, and then the gDNA and PfAgo bind to cut the probe ( Figure 1 B in the figure is detection mediated by restriction endonuclease and PfAgo).

[0054] Expression and purification of PfAgo protein

[0055] like Figure 2 As shown, M in the figure: protein marker; 1: PfAgo protein; the purified His-PfAgo protein was analyzed by 10% SDS-PAGE, and the purified PfAgo protein was about 87KDa.

[0056] Establishment of recombinase-assisted amplification combined with restriction endonuclease-assisted PfAgo detection (REPD)

[0057] In order to improve the specificity and sensitivity of the detection and develop a new efficient, convenient and sensitive detection method, Figure 3 As shown, RAA was combined with restriction endonucleases and PfAgo reactions ( Figure 3A in the figure). The REPD method mainly includes the following four steps: (Ⅰ) Use a DNA release kit to release the ASFV genome (takes 5 minutes) and then use it for subsequent experiments. (Ⅱ) Use the RAA kit to amplify the ASFV target DNA at 37°C for 30 minutes; (Ⅲ) Then use a restriction endonuclease to cut the restriction site of the amplified product at 37°C for 5 minutes. (Ⅳ) The cleavage product releases the directional DNA with phosphorylation modification, which binds to PfAgo at 95°C (takes 30 minutes) and cuts the probe, resulting in the separation of the fluorescent group and the quenching group, thereby releasing the fluorescent signal. The entire reaction process was completed within 80 minutes. In order to verify whether the restriction endonuclease can cut the amplification product of RAA, an enzyme digestion reaction was performed, which showed that the restriction endonuclease can cut the RAA product and release the gDNA with phosphorylation modification ( Figure 3 In B, analysis of RAA product activity after restriction endonuclease (Alu I) cleavage. M: marker, 1: RAA product cleaved by enzyme. 2: RAA product. 3: negative control), which is the basis for the subsequent PfAgo reaction. When target DNA and restriction endonuclease are present at the same time, the restriction endonuclease cleaves the DNA and releases gDNA. gDNA and PfAgo bind to cleave the target probe and release a fluorescent signal. In the absence of target nucleic acid or restriction endonuclease, there is no gDNA to guide PfAgo to cleave the probe, and therefore, no fluorescent signal is generated. The experimental data confirms this hypothesis ( Figure 3 C in the figure is the fluorescence measurement result of ASFV detection using REPD. Figure 3 D is a visualization analysis of REPD detection of ASFV under UV light, n = 3 replicates; error bars represent SD. *: p < 0.05, **: p < 0.01, ***: p < 0.001, ***: p < 0.0001 (two-sample t test), these results confirm the potential of REPD as a new detection method.

[0058] Sensitivity and specificity of REPD

[0059] To test the sensitivity of the REPD method, the ASFV-positive plasmid was serially diluted 10-fold. Figure 4 As shown, we collected 1×10 3 Up to 1×10 0 copies / μL of ASFV, which indicates that the REPD assay can detect 1 copy of ASFV viral nucleic acid ( Figure 4 The results of real-time fluorescence quantitative PCR in A; Figure 4B UV light in the sample was used to evaluate the sensitivity of the REPD system for detecting ASFV), indicating a high sensitivity of a single copy per reaction. This sensitivity is higher than that of currently available ASFV molecular detection assays, including only nucleic acid amplification assays such as nested PCR, qPCR, LAMP, and RPA, as well as assays combined with CRISPR-Cas nucleases. To verify the specificity of the method, positive nucleic acids of ASFV, CSFV, PRRSV, PCV2, PCV3, and PRV were used to test the specificity of the REPD method. The results showed that the method can only detect ASFV nucleic acid and cannot cross-react with other common swine fever viruses ( Figure 4 C real-time fluorescence quantitative PCR and Figure 4 These data indicate that REPD has high sensitivity and specificity, among which Figure 4 Middle, NC, negative control; (n=3 replicates; error bars represent SD. *: p<0.05, **: p<0.01, ***: p<0.001, ***: p<0.0001 two-sample t test).

[0060] REPD for testing clinical samples

[0061] To verify the reliability of REPD in ASFV clinical samples, 16 nucleic acid samples were analyzed by qPCR and REPD. Figure 5 As shown, the results of REPD and qPCR were the same as those of clinical samples, indicating that the consistency of the two methods can reach 100%. This method detected 9 ASFV positive and 7 negative samples, which was consistent with the qPCR results. These data show that REPD / REPD-LFD has accurate detection characteristics and can therefore be used for clinical detection of ASFV, among which, Figure 5 A in the figure shows 16 ASFV-infected and uninfected samples detected by qPCR; Figure 5 B in Figure 1 shows REPD detection of ASFV clinical samples. 1-9: ASFV positive samples, 10-16: negative samples, 17: negative control.

[0062] in conclusion

[0063] The present invention combines RAA amplification, restriction endonuclease reaction and PfAgo reaction to establish a new detection method called REPD. This method is characterized by its high sensitivity and specificity, and does not require the introduction of additional gDNA. After the REPD reaction, fluorescence can be observed under ultraviolet radiation. The entire detection process can be completed within 80 minutes, including 5 minutes of sample treatment, 30 minutes of RAA amplification, 5 minutes of restriction endonuclease reaction, 30 minutes of PfAgo reaction and 10 minutes of observation. In this study, we chose Alu I for enzymatic digestion because it only specifically recognizes four base sequences (AGCT), and shorter nucleic acid sequences undoubtedly help to find the target. However, this method is limited by the high specificity of restriction endonucleases, which limits its ability to select targets. However, considering that microorganisms usually have large genomes and multiple restriction endonuclease recognition sites, finding suitable targets is not a challenging task. In addition, since RAA and restriction endonucleases react at 37°C and PfAgo reacts at 95°C, in theory, simple instruments such as water baths, portable centrifuges, pipettes, and ultraviolet lamps are required to carry out the entire REPD reaction. Therefore, this makes the method suitable for laboratories and regions with limited resources. In conclusion, this method not only provides new technical support for the detection of ASFV, but also provides new insights for the detection of other pathogens, thereby expanding the application of PfAgo in nucleic acid detection.

[0064] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for detecting ASFV for non-disease diagnosis or treatment purposes, characterized in that: The following steps are involved: Step 1: Use a DNA release kit to release the ASFV genome for later use; Step 2: Amplify ASFV target DNA using the RAA kit; Step 3, using restriction endonucleases to cleave the restriction enzyme sites of the amplified product; Step 4: PfAgo endonuclease, the enzyme digestion reaction obtained in step 3, MnCl2 solution, and probes modified with FAM and BHQ1 are mixed, and then a real-time fluorescence quantitative PCR instrument is used to perform RAA-PfAgo reaction at 95°C for at least 30 minutes, and observation is performed under ultraviolet light to complete the detection of ASFV; wherein the restriction endonuclease is Alu I; The sequences of the RAA primers were RAA-F: CGACGCATGTTCATCTATCTGATATT; RAA-R: TATCGCATTGCTCGTAGTGGAAGGTA; The sequence of the probe is 5′6-FAM-GAAGTATGTAAGC-BHQ1-3′.

2. The method for detecting ASFV for non-disease diagnosis or treatment purposes according to claim 1, characterized in that In the step 1, the RNA or DNA of ASFV is extracted by a DNA release kit and stored at -75 to -85°C for future use.

3. The method for detecting ASFV for non-disease diagnosis or treatment purposes according to claim 1, characterized in that In step 2, the temperature of the amplification treatment is 36-38°C.

4. The method for detecting ASFV for non-disease diagnosis or treatment purposes according to claim 1, characterized in that In step 3, the specific operation steps are: mixing the enzyme buffer, the amplification product obtained in step 2, the restriction endonuclease and ultrapure water, and then treating the mixture in a water bath at 36-38°C.

5. The method for detecting ASFV for non-disease diagnosis or treatment purposes according to claim 4, characterized in that The volume addition ratio of enzyme buffer, amplification product, restriction endonuclease and ultrapure water is 1.5-2.5:8-12:0.4-0.6:7-8.

6. The method for detecting ASFV for non-disease diagnosis or treatment purposes according to claim 5, characterized in that: The water bath treatment time is 4 to 6 minutes.

7. The method for detecting ASFV for non-disease diagnosis or treatment purposes according to claim 1, characterized in that: The reaction time of RAA-PfAgo is 30 to 45 minutes.

Images