A nano antibody, a polypeptide containing the nano antibody and its application

Abstract

The present invention provides a nanobody, a polypeptide comprising the nanobody and its application. The variable region in the amino acid sequence of the nanobody includes three complementary determining regions CDR and a framework region FR, wherein the complementary determining region CDR includes complementary determining region CDR1, complementary determining region CDR2 and complementary determining region CDR3, wherein the complementary determining region CDR1 includes the following formula (I): Ser-Gly-Xaa 11 ‑Xaa 12 ‑Phe‑Xaa 13 ‑Xaa 14 ‑Asn‑Xaa 15 , (I), the complementarity determining region CDR2 comprises the following formula (II): Xaa 21 ‑Thr‑Xaa 22 ‑Xaa 23 ‑Gly‑Xaa 24 ‑Thr, (II), the complementary determining region CDR3 comprises the following formula (III): His‑Val‑Asp‑Glu‑Leu‑Arg‑Xaa 31 ‑Ser‑Ser‑Trp‑Thr‑Thr‑Ser‑Asn‑Leu, (III). The nanobodies and polypeptides of the present invention have high affinity and activity, can specifically recognize and bind to AAV, and the adsorbent prepared by the nanobodies and polypeptides has a strong adsorption capacity for AAV, can be applied to AAV affinity chromatography, and is conducive to the industrial application of AAV affinity chromatography columns. In addition, it can also be applied to the field of AAV detection, and empty capsids and virus particles can be detected together.

Description

[0001] This application is a divisional application of the invention patent with application number "202310699491.2", application date "2023.06.13", and name "A nanoantibody, a polypeptide comprising the nanoantibody and its application". Technical Field

[0002] The present invention belongs to the field of biotechnology, and specifically relates to a nano antibody, a polypeptide comprising the nano antibody and applications thereof. Background Art

[0003] Adeno-associated virus (AAV) belongs to the genus Dependoviridae of the family Parvoviridae. It has an icosahedral structure and is the simplest type of single-stranded DNA defective virus discovered so far. It requires a helper virus (usually adenovirus) to participate in replication. The diameter of the virus particle is between 20 and 26 nm, and contains a linear single-stranded DNA genome with a size of 4.7 to 6 kb. AAV is not pathogenic to humans. Studies have shown that about 80% of the population test positive for AAV serum.

[0004] Recombinant adeno-associated virus (rAAV) is derived from non-pathogenic wild-type adeno-associated virus. Due to its good safety, wide range of host cells (dividing and non-dividing cells), low immunogenicity, and long-term expression of foreign genes in vivo, it is regarded as one of the most promising gene transfer vectors and has been widely used in gene therapy and vaccine research around the world, including in vivo and in vitro gene function research, construction of disease models, gene knockout, gene therapy and vaccine research.

[0005] Since the upstream production of rAAV is completed in cells, its cleavage products contain impurities such as nucleic acids, residual impurities in the culture medium, and host cell proteins. The residual DNA can be treated with nucleases, but the removal of HCP is a complex process, usually with multiple steps, which may reduce the yield, delay process development, and bring great challenges to the downstream purification process. In particular, AAV has a variety of different serotypes (AAV1-AAV10), which have different capsid protein spatial structures, sequences, and tissue specificity, have different infection efficiencies for different tissues and cells, and recognize and bind to different cell surface receptors. Therefore, a universal affinity chromatography solution is difficult to implement.

[0006] Traditional downstream processes require multiple different processing steps, including cesium chloride or iodixanol gradient centrifugation and multiple chromatography steps. This type of process is not ideal because when multiple steps are required, even a high single-step yield will result in a significant reduction in the final overall yield. And the main disadvantage of this method is that it is not suitable for direct purification of viruses from large volumes of lysate and is only suitable for scientific research level.

[0007] To address this challenge, the latest affinity chromatography methods have reduced the number of steps required to purify AAV, improved yields, and shortened process time. For example, heparin-affinity chromatography columns can be used to purify rAAV3 and rAAV6; mucin-affinity chromatography columns can be used to purify rAAV1, rAAV4, rAAV5, and rVVA6; antibody-affinity columns are used to detect and purify rAAV, such as monoclonal antibodies that recognize and bind to AAVXL32.1 (Patent Document 1), polyclonal antibodies that specifically recognize AAV9 capsid protein (Patent Document 2), etc.

[0008] However, traditional antibody preparation is expensive, and the large size of the antibody leads to a low amount of coupling on the carrier, which limits its industrial application. Camel-derived nanobodies have high specificity and stability. AVB Sepharose based on nanobodies TM (GE Healthcare TM ) Filler and POROS TM CaptureSelect AAVX (Thermo Scientific TM ) fillers (non-patent document 1) perform well in the column chromatography process, making the industrial application of AAV affinity chromatography columns possible. However, the affinity, stability, and binding spectrum of nanobodies with different sequences screened out by different screening methods are very different.

[0009] Patent document 1: CN113583112B

[0010] Patent document 2: CN114685651A

[0011] Non-patent document 1: Orjana Terova, et.al, Overcoming Downstream Purification Challenges for Viral Vector Manufacturing: Enabling Advancement of GeneTherapies in the Clinic, Cell Gene Therapy Insights 2018; 4(2), 101-111. Summary of the invention

[0012] The purpose of the present invention is to provide a nanobody with an amino acid sequence of a specific structure, a polypeptide comprising the nanobody and its application, so as to solve the problems of complex antibody preparation process, high cost, and poor antibody affinity, stability and binding spectrum faced in the existing AAV enrichment, purification and detection.

[0013] In order to achieve the above technical objectives, the technical solutions adopted in this application are as follows:

[0014] In a first aspect, the present invention provides a nanobody, wherein the variable region in the amino acid sequence of the nanobody comprises a complementarity determining region CDR and a framework region FR, wherein the complementarity determining region CDR comprises a complementarity determining region CDR1, a complementarity determining region CDR2 and a complementarity determining region CDR3, wherein:

[0015] The complementary determining region CDR1 comprises the following formula (I):

[0016] Ser-Gly-Xaa 11 -Xaa 12 -Phe-Xaa 13 -Xaa 14 -Asn-Xaa 15 , (I);

[0017] The complementary determining region CDR2 comprises the following formula (II):

[0018] XA 21 -Thr-Xaa 22 -Xaa 23 -Gly-Xaa 24 -Thr, (II);

[0019] The complementary determining region CDR3 comprises the following formula (III):

[0020] His-Val-Asp-Glu-Leu-Arg-Xaa 31 -Ser-Ser-Trp-Thr-Thr-Ser-Asn-Leu, (III);

[0021] in,

[0022] XA 11 independently selected from Arg, Ser, Thr; and / or,

[0023] XA 12 independently selected from Ala, Gly, His, Ile, Met, Asn, Arg, Ser, Thr; and / or,

[0024] XA 13is independently selected from Ile, Arg, Ser, Thr, Val; and / or,

[0025] XA 14 are independently selected from Ala, Ile, Leu; and / or,

[0026] XA 15 independently selected from Ala, Ile, Leu, Ser, Thr, Val; and / or,

[0027] XA 21 independently selected from Phe, Ile, Leu, Val; and / or,

[0028] XA 22 independently selected from Pro, Arg, Ser; and / or,

[0029] XA 23 Independently selected from Ala, Asp, Gly; and / or,

[0030] XA 24 independently selected from Asp, Gly, Asn, Ser, Thr, Val; and / or,

[0031] XA 31 Independently selected from Asp, Glu, Gln.

[0032] Preferably, in the complementary determining region CDR1, the Xaa 11 Arg, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Arg, Xaa 12 His, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Arg, Xaa 12 Ala, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Ser; or, said Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Ser; or, said Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Leu; or, said Xaa 11 Ser, Xaa 12 Thr, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Gly, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Ala, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Asn, Xaa 13 Arg, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Asn, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Ser, Xaa13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Arg, Xaa 12 Gly, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 His, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Arg, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Met, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Ser, Xaa 13 For Val, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ile, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 His, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Thr, Xaa 13 Ser, Xaa14 Leu, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Ala; or, said Xaa 11 Arg, Xaa 12 Arg, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Arg, Xaa 12 Asn, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or, said Xaa 11 Arg, Xaa 12 Ala, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 is Ser; or, said Xaa 11 Ser, Xaa 12 Met, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or, said Xaa 11 Thr, Xaa 12 Met, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Thr; or, said Xaa 11 Thr, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa15 is Thr; or, said Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ile, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Ile, Xaa 13 For Val, Xaa 14 Ile, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Ser, Xaa 13 Ser, Xaa 14 Ala, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Ala, Xaa 15 is Thr; or, said Xaa 11 Ser, Xaa 12 Arg, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 is Ile; or, said Xaa 11 Ser, Xaa 12 His, Xaa 13 Thr, Xaa 14 Ile, Xaa 15 is Ser; or, said Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Ala; or, said Xaa 11 Ser, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Leu, Xaa 15 is Ser; or, said Xaa 11 Thr, Xaa 12 Ile, Xaa 13 Ser, Xaa 14 Leu, Xaa 15is Val; or, said Xaa 11 Thr, Xaa 12 Asn, Xaa 13 Ser, Xaa 14 Ile, Xaa 15 Preferably, in the complementary determining region CDR2,

[0033] Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Ser; or,

[0034] Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Gly; or

[0035] Xaa 21 Ile, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Asn; or

[0036] Xaa 21 Ile, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Ser; or,

[0037] Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 Asn; or, Xaa 21 Ile, Xaa 22 For Pro, Xaa 23 Gly, Xaa 24 is Asn; or

[0038] Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Val; or,

[0039] Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Asp, Xaa24 is Ser; or,

[0040] Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Thr; or

[0041] Xaa 21 Phe, Xaa 22 Arg, Xaa 23 Ala, Xaa 24 Asn; or, Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 Asp; or, Xaa 21 Leu, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Ser; or,

[0042] Xaa 21 For Val, Xaa 22 For Pro, Xaa 23 Ala, Xaa 24 is Ser; or,

[0043] Xaa 21 For Val, Xaa 22 Ser, Xaa 23 Ala, Xaa 24 is Ser; or,

[0044] Xaa 21 For Val, Xaa 22 Ser, Xaa 23 Gly, Xaa 24 is Gly; or

[0045] Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Asp, Xaa 24 is Gly; or

[0046] Xaa 21 Ile, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Gly; or

[0047] Xaa 21 For Val, Xaa 22 Arg, Xaa 23 Ala, Xaa 24 is Ser; or,

[0048] Xaa 21 For Val, Xaa 22 For Pro, Xaa 23 Gly, Xaa 24 is Ser; or,

[0049] Xaa 21 Phe, Xaa 22 Arg, Xaa 23 Gly, Xaa 24 is Asn; or

[0050] Xaa 21 Ile, Xaa 22 Ser, Xaa 23 Gly, Xaa 24 For Ser.

[0051] Preferably, in the complementarity determining region CDR3,

[0052] Xaa 31 is Asp; or,

[0053] XA 31 is Gln; or,

[0054] XA 31 Glu.

[0055] Preferably, the framework region FR includes: framework region FR1, framework region FR2, framework region FR3 and framework region FR4, and the framework region FR1, framework region FR2, framework region FR3 and framework region FR4 are amino acid sequences with a homology of more than 50%, preferably an amino acid sequence with a homology of more than 70%, and more preferably an amino acid sequence with a homology of more than 95%;

[0056] More preferably, the framework region FR1 is of the following formula (IV):

[0057] ValGlnLeuGlnGluSerGlyGlyGlyXaa 41 XA 42 XA 43 XA 44 GlyGlySerLeuXaa 45 LeuSerCysXa a46 Ala formula (IV);

[0058] The framework region FR2 is the following formula (V):

[0059] XA 51 GlyTrpTyrArgXaa 52 XA 53 XA 54 XA 55 LysXaa 56 ArgGluXaa 57 ValaXaa 58 Formula (V);

[0060] The framework region FR3 is the following formula (VI):

[0061] XA 61 Tyr 62 XA 63 XA 64 ValLysGlyArgPheThrIleSerArgAspAsnXaa 65 LysXaa 66 XoA 67 TyrLeuGlnMAsnXaa 68 LqCy 69 ProGluAspThrAlaValTyrTyrCys formula (VI);

[0062] The framework region FR4 is the following formula (VII):

[0063] TrpGlyGlnGlyThrGlnValThrValSerSer formula (VII) (SEQ ID No: 102); wherein,

[0064] XA 41 independently selected from Leu, Ala; and / or,

[0065] XA 42 independently selected from Val, Ala; and / or,

[0066] XA 43 Independently selected from Gln, His; and / or,

[0067] XA 44 independently selected from Pro, Ala, Ser, Thr; and / or,

[0068] XA 45 independently selected from Arg, Lys; and / or,

[0069] XA 46 Independently selected from Ala, Val, Leu, Ile, Phe; and / or,

[0070] XA 51 independently selected from Met, Val; and / or,

[0071] XA 52 Independently selected from Gln, Arg; and / or,

[0072] XA 53 Independently selected from Ala, Arg; and / or,

[0073] XA 54 independently selected from Pro, Ala; and / or,

[0074] XA 55 Independently selected from Gly, Pro, Ala, Arg; and / or,

[0075] XA 56 Independently selected from Gln, Trp; and / or,

[0076] XA 57 independently selected from Leu, Phe, Lys, Ile, Met; and / or,

[0077] XA 58 independently selected from Thr, Ala, Ser, Pro, Asn; and / or,

[0078] XA 61 independently selected from Asn, Ser, Lys, Thr, Trp; and / or,

[0079] XA 62 Independently selected from Ala, Gly; and / or,

[0080] XA 63 Independently selected from Gly, Asp, Glu, Asn; and / or,

[0081] XA 64 Independently selected from Ser, Phe; and / or,

[0082] XA 65 Independently selected from Ala, Pro, Thr, Gly, Asp; and / or,

[0083] XA 66 independently selected from Asn, Asp, Ser, Thr; and / or,

[0084] XA 67are independently selected from Val, Ile, Ala; and / or,

[0085] XA 68 independently selected from Ser, Thr, Asn; and / or,

[0086] XA 69 Independently selected from Arg, Gln;

[0087] Preferably, the framework regions FR and the complementarity determining regions CDR are arranged alternately in a chronological order.

[0088] Preferably, the amino acid sequence of the nanobody comprises: SEQ ID No:1, SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6, SEQ ID No:7, SEQ ID No:8, SEQ ID No:9, SEQ ID No:10, SEQ ID No:11, SEQ ID No:12, SEQ ID No:13, SEQ ID No:14, SEQ ID No:15, SEQ ID No:16, SEQ ID No:17, SEQ ID No:18, SEQ ID No:19, SEQ ID No:20, SEQ ID No:21, SEQ ID No:22, SEQ ID No:23, SEQ ID No:24, SEQ ID No:25, SEQ ID No:26, SEQ ID No:27, SEQ ID No:28, SEQ ID No:29, SEQ ID No:30, SEQ ID No:31, SEQ ID No:32, SEQ ID No:33, SEQ ID No:34, SEQ ID No:35, SEQ ID No:36, SEQ ID No:37, SEQ ID No:38, SEQ ID No:39, SEQ ID No:40, SEQ ID No:41, SEQ ID No:42, SEQ ID No:43, SEQ ID No:44, SEQ ID No:45, SEQ ID No:46, SEQ ID No:47, SEQ ID No:48, SEQ ID No:49, SEQ ID No:50, SEQ ID No:51, SEQ ID No:52, SEQ ID No:53, SEQ ID No:54, SEQ ID No:55, SEQ ID No:56, SEQ ID No:57, SEQ ID No:58, SEQ ID No:59, SEQ ID No:60, SEQ ID No:61, SEQ ID No:62, SEQ ID No:63, SEQ ID No:64, SEQ ID No:65, SEQ ID No:66, SEQ ID No:67, SEQ ID No:68, SEQ ID No:69, SEQ ID No:70, SEQ ID No:71, SEQ ID No:72, SEQ ID No:73, SEQ ID No:74, SEQ ID No:75, SEQ ID No:76, SEQ ID No:77, SEQID No: 78, SEQ ID No: 79, SEQ ID No: 80, SEQ ID No: 81, SEQ ID No: 82, SEQ ID No: 83, SEQ ID No: 84, SEQ ID No: 85, SEQ ID No: 86, SEQ ID No: 87, SEQ ID No: 88, SEQ ID No: 89, SEQ ID No: 90, SEQ ID No: 91, SEQ ID No:92, SEQ ID No:93, SEQ ID No:94, SEQ ID No:95, SEQ ID No:96, SEQ ID No:97, SEQ ID No:98, SEQ ID No:99, SEQ ID No:100, SEQ ID No:101, SEQ ID No:102, SEQ ID No:103, SEQ ID No:104, SEQ ID No:105, SEQ ID No:106, SEQ ID No:107, SEQ ID No:108, SEQ ID No:109, SEQ ID No:110, SEQ ID No:111, SEQ ID No:112, SEQ ID No:113, SEQ ID No:114.

[0089] Preferably, the nanobody is a humanized nanobody, preferably, the humanized nanobody comprises SEQ ID No: 115, SEQ ID No: 116, SEQ ID No: 117, SEQ ID No: 118, SEQ ID No: 119, SEQ ID No: 120.

[0090] In a second aspect, the present invention provides a polypeptide obtained by modifying the N-terminus and / or C-terminus of the above-mentioned Nanobody.

[0091] Preferably, the method of modifying the amino acids at the N-terminus and / or C-terminus of the Nanobody comprises:

[0092] Method 1: adding a tag to the N-terminal and / or C-terminal amino acid of the Nanobody;

[0093] Method 2, adding a hinge to the N-terminal and / or C-terminal amino acid of the Nanobody;

[0094] Mode three, after the N-terminal and / or C-terminal amino acids of the Nanobody are tagged, the tags are further linked to protective amino acids;

[0095] Preferably, the tag includes at least one of His-tag, GST-tag, Myc-tag, SUMO-tag, Strep-tag, and Flag-tag, the hinge includes at least one of GS hinge, IgG hinge, IgA hinge, and PEG, and the protected amino acid includes Ala, Gln, Glu, Met or a combination of any two or more of the foregoing amino acids.

[0096] Preferably, the amino acid sequence of the polypeptide includes: SEQ ID No:147, SEQ ID No:148, SEQ ID No:149, SEQ ID No:150, SEQ ID No:151.

[0097] In a third aspect, the present invention provides a polypeptide obtained by multivalent synthesis of the above-mentioned nanoantibody.

[0098] Preferably, the multivalent synthesis comprises a divalent, trivalent or tetravalent synthesis;

[0099] Preferably, the bivalent synthetic amino acid sequence comprises: SEQ ID No: 121, SEQ ID No: 122;

[0100] Preferably, the bivalent synthetic amino acid is a humanized bivalent polypeptide, and further preferably, the amino acid sequence of the humanized bivalent polypeptide comprises: SEQ ID No: 123, SEQ ID No: 124;

[0101] Preferably, the amino acid sequence of the trivalent polypeptide comprises: SEQ ID No: 125, SEQ ID No: 126, SEQ ID No: 127, SEQ ID No: 128, SEQ ID No: 129, SEQ ID No: 130, SEQ ID No: 131, SEQ ID No: 132, SEQ ID No: 133;

[0102] Preferably, the amino acid sequence of the tetravalent polypeptide comprises: SEQ ID No: 134, SEQ ID No: 135, SEQ ID No: 136, SEQ ID No: 137, SEQ ID No: 138, SEQ ID No: 139, SEQ ID No: 140, SEQ ID No: 141, SEQ ID No: 142, SEQ ID No: 143, SEQ ID No: 144, SEQ ID No: 145, SEQ ID No: 146.

[0103] In a fourth aspect, the present invention provides a nucleic acid encoding the above-mentioned Nanobody or the above-mentioned polypeptide.

[0104] In a fifth aspect, the present invention provides an expression vector comprising an expression cassette of the nucleic acid described above in claim 1.

[0105] In a sixth aspect, the present invention provides a host cell comprising the expression vector as claimed in claim 1.

[0106] In a seventh aspect, the present invention provides the use of the nanobody and / or the polypeptide in immunodetection, enrichment and / or purification.

[0107] Preferably, the nanobody and / or the polypeptide is used in the preparation of a virus adsorbent, a virus purification kit, or a virus detection kit; further preferably, the virus is AAV.

[0108] In an eighth aspect, the present invention provides a virus adsorbent comprising a carrier matrix and the above-mentioned nanobody and / or the above-mentioned polypeptide.

[0109] In a ninth aspect, the present invention provides a virus purification kit comprising a carrier matrix and the above-mentioned nanoantibody and / or the above-mentioned polypeptide.

[0110] In a tenth aspect, the present invention provides a virus detection kit, characterized in that it comprises a carrier matrix and the above-mentioned nanoantibody and / or the above-mentioned polypeptide.

[0111] In the eleventh aspect, the present invention provides an AAV detection method for non-diagnostic purposes, wherein the above-mentioned nanoantibody and / or the above-mentioned polypeptide is coupled by HRP and then detected by direct enzyme immunosorbent assay or sandwich enzyme immunosorbent assay.

[0112] The nanobody of the present invention is an anti-AAV nanobody with a new amino acid sequence discovered through screening. The nanobody and its polypeptide have high affinity and activity, can specifically recognize and bind to AAV, and the adsorbent prepared by the nanobody and its polypeptide has a strong adsorption capacity for AAV, which can be applied to AAV affinity chromatography, which is conducive to the industrial application of AAV affinity chromatography columns. In addition, it can also be applied to the field of AAV detection, and empty capsids and virus particles can be detected together. BRIEF DESCRIPTION OF THE DRAWINGS

[0113] Figure 1 is the purified Nanobody in Example 1 of the present invention;

[0114] Figure 2 This is the kinetic sensorgram of the nanobody in Example 5 of the present invention;

[0115] Figure 3 is a schematic diagram of the bivalent Nanobody in Example 7 of the present invention;

[0116] Figure 4 is the standard curve of direct ELISA detection in Example 11 of the present invention;

[0117] Figure 5 It is the standard curve of sandwich ELISA detection in Example 11 of the present invention. DETAILED DESCRIPTION

[0118] The above and other aspects of the present invention will be further described below, wherein:

[0119] (1) Unless otherwise indicated, the term "sequence" as used herein (e.g., in phrases such as "antibody sequence," "variable region sequence," "V HH The term "sequence" or "protein sequence" should generally be understood to include the relevant amino acid sequence and the nucleic acid sequence or nucleotide sequence encoding the amino acid sequence, unless the context requires a narrower interpretation.

[0120] (2) Unless otherwise indicated, all methods, steps, techniques and operations not specifically described are known and well-known to those skilled in the art. For example, reference is still made to the comprehensive background technology cited above and other references cited therein.

[0121] (3) The term "specificity" refers to the ability of a particular antigen-binding molecule (such as a Nanobody or polypeptide of the invention) to bind to different types of antigens or antigenic determinants. The specificity of an antigen-binding molecule can be determined based on its affinity and / or activity. Affinity is expressed as the dissociation equilibrium constant (K) between the antigen and the antigen-binding molecule. D ), is a measure of the binding strength between antigen and antigen-binding molecule, K D The smaller the value, the stronger the binding strength between the antigen and the antigen-binding molecule. D The larger the value, the weaker the binding strength between the antigen and the antigen-binding molecule. a represents the binding constant, K a The larger the value, the faster the binding. a The smaller the K, the slower the binding; d represents the dissociation constant, K d The larger the K, the faster the dissociation. d The smaller the K, the slower the dissociation; and D =K d / K a .

[0122] (4) The amino acid residues of single-domain antibodies (i.e., nanobodies) are in accordance with the V given by Kabat et al. in "Sequence of proteins of immunological interest", US Public Health Services, Publication No. 91. HH The domains are numbered according to the common numbering scheme used by Riechmann and Muyldermans for V from Camelidae. HH Domain. According to this numbering method, FR1 of a single domain antibody includes amino acid residues at positions 1 to 30, CDR1 of a single domain antibody includes amino acid residues at positions 31 to 36, FR2 of a single domain antibody includes amino acid residues at positions 37 to 49, CDR2 of a single domain antibody includes amino acid residues at positions 50 to 65, FR3 of a single domain antibody includes amino acid residues at positions 66 to 94, CDR3 of a single domain antibody includes amino acid residues at positions 95 to 102, and FR4 of a single domain antibody includes amino acid residues at positions 103 to 113. In this regard, it should be noted that as described in the art regarding V HH Domain and About V HH It is well known that the total number of amino acid residues in each CDR may be different and may not correspond to the total number of amino acid residues indicated by the Kabat numbering (i.e., one or more positions according to the Kabat numbering may not be occupied in the actual sequence, or the actual sequence may contain more amino acid residues than the number allowed by the Kabat numbering). This means that, generally according to the Kabat numbering, the amino acid residues in the actual sequence may be the same or different than the actual numbering. It can also be said that according to the Kabat numbering, the amino acid residue numbering of the CDR is not taken into account, but position 1 according to the Kabat numbering corresponds to the start of FR1, and vice versa; position 36 according to the Kabat numbering corresponds to the start of FR2, and vice versa, position 66 according to the Kabat numbering corresponds to the start of FR3; and vice versa, position 103 according to the Kabat numbering corresponds to the start of FR4, and vice versa.

[0123] (5) The term “immobilized capacity” refers to the total amount of ligand coupled to a unit volume of affinity medium (adsorbent).

[0124] (6) The term "homologous" refers to a family of Nanobody sequences that bind to the same antigen, have the same number of amino acids and have an amino acid sequence identity greater than 70%.

[0125] The amino acid sequence of the Nanobodies of the invention essentially comprises complementarity determining regions CDR and framework regions FR.

[0126] The complementary determining region CDR includes complementary determining region CDR1, complementary determining region CDR2 and complementary determining region CDR3, and the framework region FR includes framework region FR1, framework region FR2, framework region FR3 and framework region FR4.

[0127] The complementary determining region CDR1 comprises the following formula (I):

[0128] Ser-Gly-Xaa 11 -Xaa 12 -Phe-Xaa 13 -Xaa 14 -Asn-Xaa 15 (I)

[0129] The complementary determining region CDR2 comprises the following formula (II):

[0130] XA 21 -Thr-Xaa 22 -Xaa 23 -Gly-Xaa 24 -Thr(II),

[0131] The complementary determining region CDR3 comprises the following formula (III):

[0132] His-Val-Asp-Glu-Leu-Arg-Xaa 31 -Ser-Ser-Trp-Thr-Thr-Ser-Asn-Leu(III),

[0133] Among them, Xaa 11 independently selected from Arg, Ser, Thr; and / or, Xaa 12 independently selected from Ala, Gly, His, Ile, Met, Asn, Arg, Ser, Thr; and / or, Xaa 13 independently selected from Ile, Arg, Ser, Thr, Val; and / or, Xaa 14 are independently selected from Ala, Ile, Leu; and / or, Xaa 15 Independently selected from Ala, Ile, Leu, Ser, Thr, Val;

[0134] and / or, Xaa 21 independently selected from Phe, Ile, Leu, Val; and / or, Xaa 22 independently selected from Pro, Arg, Ser; and / or, Xaa23 independently selected from Ala, Asp, Gly; and / or, Xaa 24 Independently selected from Asp, Gly, Asn, Ser, Thr, Val;

[0135] and / or, Xaa 31 Independently selected from Asp, Glu, Gln.

[0136] Among them, amino acid substitution can generally be described as, wherein the amino acid residue can be substituted by an amino acid with a similar chemical structure, or by an amino acid with a dissimilar chemical structure, as long as there is little or substantially no effect on the function, activity or other biological properties of the polypeptide. Preferably, the amino acid residue can be substituted by an amino acid with a similar chemical structure.

[0137] For the above-mentioned substitution modes, for example, the situations disclosed in documents WO04 / 037999, WO 98 / 49185, WO 00 / 46383 and WO 01 / 09300 can be cited, but it is not limited thereto. In addition, the (preferred) types and / or combinations of the substitutions selected based on the relevant information of other references cited in WO 04 / 037999 and WO 06 / 122786 can also be cited.

[0138] The amino acid substitutions of the present invention may include, but are not limited to, substitutions in which one amino acid in the following groups (a) to (e) is replaced by another amino acid in the same group: (a) Ala, Ser, Thr, Pro and Gly; (b) Asp, Asn, Glu and Gln; (c) His, Lys and Arg; (d) Met, Leu, Ile, Val and Cys; (e) Phe, Tyr and Trp.

[0139] Preferred amino acid substitutions can be listed but are not limited to the following: Ala is substituted with Gly or Ser; Arg is substituted with Lys; Asn is substituted with Gln or His; Asp is substituted with Glu; Cys is substituted with Ser or Thr; Gln is substituted with Asn; Glu is substituted with Asp; Gly is substituted with Ala or Pro; His is substituted with Asn or Gln; Ile is substituted with Leu or Val; Leu is substituted with Ile or Val; Lys is substituted with Arg, Glu or Gln; Met is substituted with Leu, Tyr or Ile; Phe is substituted with Met, Tyr or Leu; Ser is substituted with Thr; Thr is substituted with Ser; Tyr is substituted with Trp; Trp is substituted with Tyr.

[0140] The amino acid sequence and structure of the above-mentioned Nanobody include framework regions in addition to the three complementarity determining regions (CDR1 to CDR3).

[0141] For the framework region, it is more conservative than the complementary determining region. Those skilled in the art will reasonably screen the sequence structure of the framework region according to the actual use and function of the nanobody. As the amino acid sequence of the framework region, an amino acid sequence with a homology of more than 50% is preferred, and an amino acid sequence with a homology of more than 70% is further preferred, and an amino acid sequence with a homology of more than 95% is further preferred.

[0142] The contribution of the framework region to affinity is small, so amino acid substitutions in the framework region generally do not affect the affinity of the nanobody, and as long as it can exist in a soluble form, the amino acids in the framework region are also suitable for the above-mentioned amino acid substitutions. Among them, humanization is a typical example of amino acid substitutions in the framework region. In the present invention, the amino acid homology of the framework region of A4-H1 and A4-003 is 82%, and the amino acid homology of the framework region of A4-H3 and A4-015 is 85%, which does not affect the affinity of the original sequence.

[0143] Examples of the frame region include a frame region FR1, a frame region FR2, a frame region FR3, and a frame region FR4, but the frame region is not limited thereto.

[0144] Specific examples of the framework region include the following:

[0145] The framework region FR1 is represented by the following formula (IV):

[0146] ValGlnLeuGlnGluSerGlyGlyGlyXaa 41 XA 42 XA 43 XA 44 GlyGlySerLeuXaa 45 LeuSerCysXa a 46 Ala formula (Ⅳ)

[0147] The framework region FR2 is represented by the following formula (V):

[0148] XA 51 GlyTrpTyrArgXaa 52 XA 53 XA 54 XA 55 LysXaa 56 ArgGluXaa 57 ValaXaa 58 , (V);

[0149] The framework region FR3 is represented by the following formula (VI):

[0150] XA 61 Tyr 62 XA 63 XA 64 ValLysGlyArgPheThrIleSerArgAspAsnXaa 65 LysXaa 66 XoA 67 TyrLeuGlnMAsnXaa 68 LqCy 69 ProGluAspThrAlaValTyrTyrCys, (VI);

[0151] The framework region FR4 is represented by the following formula (VII):

[0152] TrpGlyGlnGlyThrGlnValThrValSerSer, (VII); wherein,

[0153] XA 41 independently selected from Leu, Ala; and / or, Xaa 42 independently selected from Val, Ala; and / or, Xaa 43 Independently selected from Gln, His; and / or, Xaa 44 independently selected from Pro, Ala, Ser, Thr; and / or, Xaa 45 independently selected from Arg, Lys; and / or, Xaa 46 independently selected from Ala, Val, Leu, Ile, Phe; and / or, Xaa 51 independently selected from Met, Val; and / or, Xaa 52 independently selected from Gln, Arg; and / or, Xaa 53 independently selected from Ala, Arg; and / or, Xaa 54 independently selected from Pro, Ala; and / or, Xaa 55 independently selected from Gly, Pro, Ala, Arg; and / or, Xaa 56 Independently selected from Gln, Trp; and / or, Xaa 57 independently selected from Leu, Phe, Lys, Ile, Met; and / or, Xaa 58 independently selected from Thr, Ala, Ser, Pro, Asn; and / or, Xaa 61 independently selected from Asn, Ser, Lys, Thr, Trp; and / or, Xaa 62 are independently selected from Ala, Gly; and / or, Xaa 63Independently selected from Gly, Asp, Glu, Asn; and / or, Xaa 64 independently selected from Ser, Phe; and / or, Xaa 65 independently selected from Ala, Pro, Thr, Gly, Asp; and / or, Xaa 66 independently selected from Asn, Asp, Ser, Thr; and / or, Xaa 67 independently selected from Val, Ile, Ala; and / or, Xaa 68 independently selected from Ser, Thr, Asn; and / or, Xaa 69 Independently selected from Arg, Gln.

[0154] For the amino acid substitutions in the CDR and FR regions, SEQ ID No: 1 to SEQ ID No: 114 in the sequence table of the present invention can be cited, but they are not limited to the above examples, as long as there is little or no effect on the function, activity or other biological properties of the polypeptide.

[0155] Furthermore, the total number of residues in a Nanobody may be in the interval 110 - 120. However, parts, fragments or analogs of Nanobodies are not particularly limited in their length and / or size, as long as such parts, fragments or analogs meet the further requirements listed below and are also suitable for the purposes described herein.

[0156] The nanobody antibodies in the present invention belong to the same family of nanobodies, and their amino acid sequences have the same total length, and each framework region FR and antigen binding region CDR has the same length and high sequence identity, similar structure, and has substantially equivalent antigen binding ability. The framework region FR and the complementary determining region CDR are arranged in a staggered order, such as FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0157] As a method for preparing "nanoantibodies", in its broadest sense, it is not limited to a specific biological resource or a specific preparation method. For example, the nanoantibodies of the present invention can be obtained by: (1) isolating the V chain of a naturally occurring heavy chain antibody; HH domain; (2) by expressing a naturally occurring V HH The nucleotide sequence of the domain; (3) by HH domains are "humanized" (as described below) or by expressing a polypeptide encoding the humanized V HH (4) using synthetic or semi-synthetic techniques to prepare proteins, polypeptides or other amino acid sequences; (5) preparing nucleic acids encoding Nanobodies by applying nucleic acid synthesis techniques and then expressing the nucleic acids thus obtained; and / or (6) by any combination of the foregoing.

[0158] In addition, based on a variation of the Nanobodies of the invention, also includes a V HH The amino acid sequence of the nanobody corresponds to the structural domain but has been humanized. Humanization is to use the V of a conventional 4-chain antibody from humans. H One or more amino acid residues existing at corresponding positions in the structural domain replace the naturally occurring V HH One or more amino acid residues of a domain sequence.

[0159] Specific examples of Nanobodies with humanized amino acid sequences include SEQ ID No: 115 (denoted as "A4-H1"), SEQ ID No: 116 (denoted as "A4-H2"), SEQ ID No: 117 (denoted as "A4-H3"), SEQ ID No: 118 (denoted as "A4-H4"), SEQ ID No: 119 (denoted as "A4-H5"), and SEQ ID No: 120 (denoted as "A4-H6"), but are not limited thereto.

[0160] In addition, the present invention also relates to a HH The domain or at least one protein or polypeptide based thereon, for example, SEQ ID No:147.

[0161] According to one non-limiting embodiment of the invention, the above-mentioned polypeptide consists essentially of a Nanobody. "Essentially consisting of" means that the amino acid sequence of the polypeptide of the invention is identical or corresponds to the amino acid sequence of a Nanobody, wherein a limited number of amino acid residues, such as 1 to 10 amino acid residues, and preferably 1 to 6 amino acid residues, such as 1, 2, 3, 4, 5 or 6 amino acid residues, are added to the amino terminus (N-terminus) and / or carboxyl terminus (C-terminus) of the Nanobody or polypeptide.

[0162] The above amino acid residues may not change the biological properties of the Nanobody, and may add other functionalities to the Nanobody. For example, the amino acid residues may:

[0163] a is a purification tag, i.e. an amino acid sequence or residue that facilitates the purification of the Nanobody, for example, using an affinity technique for the sequence or residue for purification. Some preferred but non-limiting examples of such residues are groups of His-tags (His6 or His8), GST-tag, MBP-tag, Myc-tag, Strep-tag, Flag-tag, HA-tag, V5-tag, S-tag, E-tag;

[0164] b is a soluble tag, i.e., a tag that helps increase the solubility of the nanobody, such as SUMO;

[0165] c is the N-terminal amino acid residue, for example, Met, Ala, Gln or MetAlaGln, AlaGln, whereby it can be expressed in a heterologous host cell or host organism;

[0166] d is a C-terminal Cys residue, which can react with -SH on the ligand or with the Au surface, for example;

[0167] e is a hinge to provide a link or spacer between the nanobody and other groups, for example, a combination of GlySer, IgG hinge, IgA hinge, or other artificially synthesized hinges;

[0168] f is one or more amino acid residues which may be provided with a functional group and / or have been functionalized in a known manner, for example amino acid residues such as lysine or cysteine ​​allow for the attachment of a PEG group as is known in the art.

[0169] The polypeptide of the present invention may also include two or more of the above-described Nanobodies, also known as multivalent polypeptides.

[0170] The bivalent polypeptide of the invention comprises 2 Nanobodies, optionally linked by one hinge sequence, the trivalent polypeptide of the invention comprises 3 Nanobodies, optionally linked by two hinge sequences, and the tetravalent polypeptide of the invention comprises 4 Nanobodies, optionally linked by three hinge sequences.

[0171] In the multivalent polypeptides of the invention, the two or more Nanobodies may be the same or different. For example, the two or more Nanobodies in the multivalent polypeptides of the invention: may be directed against the same antigen, i.e., against the same epitope of the antigen or against two or more different epitopes of the antigen; may be directed against different antigens; or a combination thereof.

[0172] For example, the bivalent polypeptide AA or AB of the present invention may include two identical nanobodies A, or two different nanobodies A and nanobodies B, wherein at least one of nanobodies A and B is selected from the nanobodies of the present invention; may include a first nanobody against a certain epitope of a first antigen and a second nanobody against the same epitope or a different epitope of the antigen; may include a first nanobody against a first antigen and a second nanobody against a second antigen different from the first antigen. As specific examples of the amino acid sequence of the bivalent polypeptide, for example, SEQ ID No: 121 (denoted as "A4-B1") and SEQ ID No: 122 (denoted as "A4-B2") can be cited, but are not limited thereto. In addition, as specific examples of humanized bivalent polypeptides, SEQ ID No: 123 (denoted as "A4-B3") and SEQ ID No: 124 (denoted as "A4-B4") can be cited, but are not limited thereto.

[0173] For example, the trivalent polypeptides AAA, AAB, and ABC of the present invention may include three identical nanoantibodies A, may include two identical nanoantibodies A and another nanoantibody B, may include three different nanoantibodies A, nanoantibodies B, and nanoantibodies C, wherein at least one of Nanoantibodies A, B, and C is selected from the nanoantibodies of the present invention, and the order of the three is not limited; may include identical or different nanoantibodies against the same antigen; may include two identical or different nanoantibodies against the same or different epitopes of a first antigen and a third nanoantibody against a second antigen different from the first antigen; may include a first nanoantibody against a first antigen, a second nanoantibody against a second antigen different from the first antigen, and a third nanoantibody against a third antigen different from the first and second antigens.

[0174] For example, the tetravalent polypeptides AAAA, AAAB, AABC, ABCD of the invention (in any order) may include 4 identical Nanobodies A, may include 3 identical Nanobodies A and another Nanobodies B, may include 2 identical Nanobodies A and another 2 different Nanobodies B, Nanobodies C, may include 4 different Nanobodies A, Nanobodies B, Nanobodies C and Nanobodies D, wherein at least one of Nanobodies A, B, C, and D is selected from the Nanobodies of the invention, and the order of the four is not limited; may include identical or different Nanobodies against the same antigen; may include 2 identical or different Nanobodies against the same or different epitopes of a first antigen and a third Nanobodies against a second antigen different from the first antigen; may include a first Nanobodies against a first antigen, a second Nanobodies against a second antigen different from the first antigen, and a third Nanobodies against a third antigen different from the first and second antigens; may include a first Nanobodies against a first antigen, a second Nanobodies against a second antigen different from the first antigen, a third Nanobodies against a third antigen different from the first and second antigens, and a fourth Nanobodies against a fourth antigen different from the first and second antigens and different from the third antigen.

[0175] A polypeptide of the invention comprising at least two nanobodies, wherein at least one nanobody is directed against a first antigen, and at least one nanobody is directed against a second nanobody different from the first antigen (or a second nanobody directed against a different epitope of the first antigen), is also called a "multispecific" antibody. Thus, a bispecific antibody is a nanobody comprising at least one nanobody directed against a first antigen and at least one other nanobody directed against a second antigen, and a trispecific antibody is a nanobody comprising at least one nanobody directed against a first antigen, at least one other nanobody directed against a second antigen, and at least one other nanobody directed against a third antigen; and so on.

[0176] Specific examples of the amino acid sequence of a multivalent polypeptide include trivalent polypeptides whose amino acid sequences are SEQ ID No: 125 (denoted as "A4-C1"), SEQ ID No: 126 (denoted as "A4-C2"), SEQ ID No: 127 (denoted as "A4-C3"), SEQ ID No: 128 (denoted as "A4-C4"), SEQ ID No: 129 (denoted as "A4-C5"), SEQ ID No: 130 (denoted as "A4-C6"), SEQ ID No: 131 (denoted as "A4-C7"), SEQ ID No: 132 (denoted as "A4-C8"), and SEQ ID No: 133 (denoted as "A4-C9"); and tetravalent polypeptides whose amino acid sequences are SEQ ID No: 134 (denoted as "A4-D1"), SEQ ID No: 135 (denoted as "A4-D2"), SEQ ID No.: 136 (recorded as "A4-D3"), SEQ ID No.: 137 (recorded as "A4-D4"), SEQ ID No.: 138 (recorded as "A4-D5"), SEQ ID No.: 139 (recorded as "A4-D6"), SEQ ID No.: 140 (recorded as "A4-D7"), SEQ ID No.: 141 (recorded as "A4-D8"), SEQ ID No.: 142 (recorded as "A4-D9"), SEQ ID No.: 143 (recorded as "A4-D10"), SEQ ID No.: 144 (recorded as "A4-D11"), SEQ ID No.: 145 (recorded as "A4-D12"), and SEQ ID No.: 146 (recorded as "A4-D13"), but are not limited to these.

[0177] About containing one or more V HH For multivalent and multispecific polypeptides of the structural domain and their preparation, reference may be made to the description in EP0822985.

[0178] The hinges used for multivalent and multispecific polypeptides should be well known to those skilled in the art, for example, including Gly-Ser, such as (Gly4Ser)3 or (Gly3Ser2)3 described in WO 99 / 42077; or naturally occurring heavy chain antibody hinge regions or partial regions thereof. For other suitable hinges, reference can also be made to the comprehensive background technology cited above.

[0179] Furthermore, in addition to the one or more Nanobodies, the polypeptides of the invention may also comprise functional groups, parts or residues, such as therapeutically active substances, and / or labels, such as fluorescent labels, isotope labels, biotin labels and enzyme catalytic labels, and the like.

[0180] In addition, the dissociation equilibrium constant (K) of the nanoantibodies or polypeptides of the invention for binding to AAV D ) is 10 -6 ~10 -11 Mole / liter (M), preferably 10 -7 ~10 -11 mol / L (M), more preferably 10 -8 ~10 -10 Mole / liter (M).

[0181] The specific binding between the above-mentioned antigen and the antigen-binding molecule can be determined by any suitable known method, including Sercatchard Analysis and / or competitive binding assays such as radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA), as well as other new methods known in the art, such as plasma resonance technology (SPR) and / or biomembrane interferometry (BLI) technology, etc.

[0182] The nanobodies, polypeptides, and nucleic acids encoding the same of the present invention can be prepared in a known manner, which will be clear to those skilled in the art from the further description herein. A particularly useful method for preparing the nanobodies, polypeptides, and nucleic acids generally comprises the following steps:

[0183] (1) expressing a nucleic acid encoding a Nanobody or polypeptide of the invention in a suitable host cell or host organism or in another suitable expression system, optionally followed by;

[0184] (2) Isolating and / or purifying the Nanobodies or polypeptides of the invention thus obtained.

[0185] Alternatively, other methods may include the following steps:

[0186] (3) culturing and / or maintaining the host of the invention under conditions such that the host of the invention expresses and / or produces a Nanobody and / or polypeptide of the invention; optionally followed by;

[0187] (4) Isolating and / or purifying the Nanobody or polypeptide of the invention thus obtained.

[0188] Nucleic acid of the present invention can be the form of single-stranded or double-stranded DNA or RNA, and preferably double-stranded DNA form.For example, nucleotide sequence of the present invention can be genomic DNA, cDNA or synthetic DNA (as DNA with codon usage that is particularly suitable for expressing in the host cell or host organism to be used, that is, codon optimized).

[0189] The nucleic acids of the invention can be prepared or obtained in a manner known per se, based on the information given herein on the amino acid sequences of the Nanobodies or polypeptides of the invention, and / or can be isolated from suitable natural sources. HH The nucleic acid sequence of the structural domain is subjected to site-directed mutagenesis to provide the nucleic acid of the present invention encoding the analog.

[0190] Nucleic acid of the present invention can also be in such a form, is present in and / or is the part of a genetic construct, which is well known to those skilled in the art. Such a genetic construct generally comprises at least one nucleic acid of the present invention, can be in the form of a vector, such as a plasmid, YAC, viral vector or transposon. Especially, the vector can be an expression vector, that is, a vector (such as in a suitable host cell, host organism and / or expression system) for external and in vivo expression can be provided.

[0191] The nucleic acids of the invention and / or the genetic constructs of the invention can be used to transform host cells or host organisms, i.e. for expressing and / or producing the Nanobodies or polypeptides of the invention. Suitable hosts or host cells are well known to those skilled in the art and can be, for example, any suitable fungal, prokaryotic or eukaryotic cell or organelle or organism, for example: bacterial strains, including but not limited to Escherichia coli and Bacillus subtilis; fungal cells, including but not limited to Trichoderma, Aspergillus or other filamentous fungi; yeast cells, including but not limited to Serachromyces and Pichia; amphibian cells or cell lines, such as Xenopus oocytes; oocytes); cells or cell lines derived from insects, such as Serpodoptera Serf9 and Serf21 cells or Drosophila cell lines Serchneider and Kc cells; plants or plant cells, such as tobacco plants; mammalian cells or cell lines, such as cells or cell lines derived from humans and / or other mammals, including but not limited to CHO cells, BHK cells, Hela cells and CHS cells, etc.; and all other hosts or host cells known per se for the expression and production of antibodies and antibody fragments (including but not limited to single domain antibodies and ScFv fragments), which are well known to those skilled in the art.

[0192] For production, the Nanobodies and polypeptides of the invention can be produced in the milk of transgenic mammals, for example in the milk of rabbits, cows, goats or sheep, but also in plants or parts of plants, including but not limited to their leaves, flowers, fruits, roots or seeds.

[0193] As mentioned above, one advantage of using nanobodies is that polypeptides based thereon can be expressed and prepared in prokaryotic systems, and suitable prokaryotic expression systems, vectors, host cells, etc. are well known to those skilled in the art, such as the references cited above. However, it should be noted that the present invention in its broadest sense is not limited to expression in bacterial systems.

[0194] Preferably, in the present invention, the Nanobodies or polypeptides are produced in bacterial cells, in particular in bacterial cells suitable for large-scale drug production, as described above.

[0195] When the Nanobodies or polypeptides of the invention are expressed for production in cells, the Nanobodies or polypeptides of the invention may be produced intracellularly (e.g. in the cytoplasm or periplasmic space), then isolated from the host cell, and optionally further purified; or may be produced extracellularly (i.e. secretory expression), then isolated from the culture medium, and optionally further purified.

[0196] Some preferred but non-limiting vectors for use with these host cells include vectors for expression in mammalian cells - pMANneo (Clonetech), pUCTtag (ATCC37460) and pMClneo (Stratagene); vectors for expression in bacterial cells - pET vectors (Novagen) and pQE vectors (Qiagen); vectors for expression in yeast or other fungal cells - pYES2 (Invitrogen) and Picha expression vector (Picha expression vector) (Invitrogen); vectors for expression in insect cells - pBlueBacⅡ (Invitrogen) and other baculovirus vectors; and the like.

[0197] The corresponding techniques for transforming the host or host cell of the present invention are well known to those skilled in the art.

[0198] After transformation, those hosts that can detect and select to have transformed nucleotide sequence / genetic construct of the present invention successfully.Converted host cell (it can be in the form of stable cell line) or host organism (it can be in the form of stable mutant line or strain) form another aspect of the present invention.

[0199] The amino acid sequence of the invention can then be isolated from the host cells / host organisms and / or from the culture medium in which the host cells or host organisms are cultivated, by means of protein separation and / or purification techniques known per se, such as (preparative) chromatography and / or electrophoresis techniques, differential precipitation techniques, affinity techniques (e.g. using specific / cleavable amino acid sequences fused to the amino acid sequence of the invention) and / or preparative immunological techniques (i.e. using antibodies directed against the amino acid sequence to be isolated).

[0200] The nanobody or polypeptide of the present invention can specifically bind to the antigen AAV, and therefore a preferred but non-limiting application of the present invention is an AAV adsorbent, which comprises a carrier matrix and the nanobody or polypeptide.

[0201] The aforementioned AAV includes AAV1 to AAV10 classified by serotype, and the nanoantibody of the present invention has a broad-spectrum adsorption capacity for different serotypes of AAV.

[0202] The aforementioned carrier matrix can be a porous material, for example, agarose gel microspheres, cellulose spheres, magnetic beads, silica microspheres, activated carbon or resin microspheres, etc.

[0203] The carrier used for the aforementioned adsorbent can be obtained by commercial purchase, and specific examples include, for example, agarose gel Sepharose CL-6B (GE Healthcare, US), resin microsphere Nanomicro series (Suzhou Nanomicro Technology Co., Ltd.), but not limited to these products.

[0204] When using the above carrier, preferably, the above carrier can be activated. The activation method can be, for example, but not limited to, the following method: first, epoxy activation, then diaminopropyl imine (DADPA) activation, and finally, iodoacetic acid activation, etc.

[0205] The aforementioned adsorbent is obtained by coupling a nanobody or a polypeptide to an activated carrier. The specific method is not particularly limited. For example, the final adsorbent can be obtained by mixing a purified nanobody or polypeptide solution with the carrier, separating by centrifugation, and finally washing / filtering the gel.

[0206] The adsorbent of the present invention can be used to specifically identify AAV.

[0207] The nanobodies, polypeptides or adsorbents of the present invention can be used to purify AAV, and can also be used to prepare a kit for detecting AAV.

[0208] Example

[0209] The following examples are given to illustrate the specific implementation of the present invention, but the implementation of the present invention is not limited to the following examples, and any selection and change can be made within the scope that does not affect the technical effect to be achieved by the present invention.

[0210] A. Screening of Nanobodies that Specifically Bind to AAV

[0211] Example 1

[0212] Construction of anti-AAV nanobody library.

[0213] The phage display library used in the present invention is an immune library with T7 phage as a carrier, and the establishment steps are as follows:

[0214] (1) Alpacas (numbered 1139 and 462) were immunized with AAV. Jugular vein blood was collected from two alpacas after four immunizations. Peripheral blood lymphocytes were isolated and total RNA was extracted (PuerLink TM RNA Mini Kit, Life Technologies: 12183018A);

[0215] (3) Total RNA was reverse transcribed into cDNA and amplified using two rounds of nested PCR. HH Gene;

[0216] In the first round of PCR, cDNA was used as a template, UP primer1 and DOWN primer1 were used as upstream and downstream primers, respectively. After amplification, a band of 650-750 bp was recovered, which was used as a template for the second round of PCR. The upstream and downstream primers were UP primer2 and DOWN primer2, respectively. A PCR product of 450-500 bp was recovered.

[0217] UP primer1:CTTGGTGGTCCTGGCTGCTCT(SEQ ID No:152),

[0218] DOWN primer1:GGTACGTGCTGTTGAACTGTTCC (SEQ ID No:153),

[0219] UP primer2: TATCTAGTCGAATTCCGCCCAGGTGCAGCTC (SEQ ID No: 154), DOWNprimer2: AGCGACTAAGCTT TTGTGGTTTTGGTGTC (SEQ ID No: 155);

[0220] (3) The PCR product was double-digested with EcoR Ι and Hind Ⅲ and subjected to agarose electrophoresis to recover the 350-500 bp gene band, which was V HH Gene fragments;

[0221] (4) Use T4 ligase to connect the T7 vector ( 10-3Cloning Kit, 70550-3) and V HH Gene fragments;

[0222] (5) mixing the ligation product with the packaging protein to form a complete T7 phage, and amplifying the mixture to obtain a phage original library;

[0223] (6) After testing, the titer of the original library was 3.14×10 10 pfu / mL, with a diversity of 1.7×10 6 .

[0224] Example 2

[0225] Screening of nanobodies.

[0226] First, dilute the antigen (AAV2) to 10 μg / mL with TBS, take 100 μL and add it to a 96-well plate, and incubate at 4°C for 12 hours. Aspirate the antigen dilution in the well, wash the plate 3 times with TBS, pat dry, add 1% protein-free blocking solution (purchased from Sangon Biotechnology Co., Ltd.), 300 μL / well, and incubate at room temperature for 2 hours (1% protein-free blocking solution and 1% BSA are used alternately during screening). Aspirate the blocking agent in the well, wash the plate 6 times with TBST, pat dry, add the amplified phage, 100 μL / well, and incubate at room temperature for 30 minutes. Wash the plate 10 times with TBST, add T7 elution buffer (1% SDS) to elute the phage, incubate at room temperature for 30 minutes, and amplify the eluate for the next round of screening.

[0227] The antigen (AAV5) was then diluted and coated in the same manner, and the eluate was incubated, selected, and amplified again for the next round of screening.

[0228] The antigen (AAV8) was diluted and coated in the same manner, and the above eluate was incubated, panned, and amplified again for the next round of screening.

[0229] The antigen (AAV9) was diluted and coated in the same manner, and the above eluate was incubated, selected, and amplified again.

[0230] Example 3

[0231] Construction of genetically engineered bacteria

[0232] (1) After four rounds of screening, the screening eluate was subjected to solid amplification, plaques were picked, and PCR amplification was performed using the plaque amplification solution as a template and UP primer 3 and DOWN primer 3 as upstream and downstream primers;

[0233] UP primer3: TTCCTTAACATATGGCCCAGGTGCAGCTCGT (SEQ ID No: 156), DOWNprimer3: TTAAGGAACTCGAGCACGGTGACCAGGGTC (SEQ ID No: 157);

[0234] (2) A portion of the PCR product was outsourced for sequencing to obtain the sequence information of the nanobody, and the sequence information is shown in Table 1.

[0235] (3) Another part of the PCR product was double-digested with NdeI and XhoI, and the digestion product was recovered. At the same time, the digestion was performed in the same way and the vector was recovered. The digestion product and the vector were ligated with T4 ligase, and the ligation product was transferred into Escherichia coli to obtain a genetically engineered bacterium expressing AAV-specific nanobodies.

[0236] Table 1 Nanobody sequence information

[0237]

[0238]

[0239] Example 4

[0240] Preparation of AAV nanobodies

[0241] (1) The basic culture medium of the nanobody is TB medium, which is inoculated at a 5% inoculum and cultured at 37°C for 3-5 h, and the inducer IPTG (final concentration 0.25 mM, the same below) is added for overnight induction;

[0242] (2) After induction, the mixture was centrifuged at 4000 rpm for 20 min to obtain wet bacteria containing nanobodies.

[0243] (3) Add lysis buffer (10 mM imidazole, 500 mM NaCl, pH 7.40.02M PB) to the obtained wet bacteria at a ratio of 1:10, and use a 700 bar high-pressure homogenizer to disrupt the cells;

[0244] (4) Centrifuge at 4°C and 10,000 rpm for 20 min and collect the supernatant;

[0245] (5) The supernatant was filtered through a 0.45 μm filter and then passed through an affinity chromatography column (GE Healthcare, US) for separation and purification of AAV nanobodies, wherein the filler of the affinity chromatography column was Ni Sepharose High Performance;

[0246] (6) The nanoantibodies purified by affinity chromatography were subjected to SDS-PAGE electrophoresis to determine the purity, and the protein solution with higher purity was selected to determine the protein concentration using the BCA method. The SDS-PAGE of the purified nanoantibodies was shown in Figure 1 In the above analysis, the nano antibody bands are correct and the purity is high after one purification. Since the nano antibodies of the present invention belong to the same family, their molecular weights and charges are similar, so their electrophoretic band positions are also roughly the same. For simplicity, only the electrophoretic patterns of A4-001 (SEQ ID No: 1) to A4-022 (SEQ ID No: 22) are listed. Figure 1 From left to right, they are:

[0247] Left: protein marker, supernatant after whole-cell disruption of A4-001 (SEQ ID No: 1), precipitate, flow-through during purification, and purified A4-001 to A4-003 (SEQ ID No: 1 to 3) (in the order from left to right in the left figure),

[0248] Middle: purified A4-004-A4-008 (SEQ ID No: 4-8), protein marker, purified A4-009-A4-014 (SEQ ID No: 9-14) (in the order from left to right in the left figure),

[0249] Right: Purified A4-015-A4-022 (SEQ ID No: 15-22) and protein markers (in the order from left to right in the left figure).

[0250] Example 5

[0251] The SPR technique was used to analyze the binding ability of nanobodies to AAV. AAV was amino-coupled to a CM5 sensor chip at a density of 500-800 RU, and nanobodies were injected at 7 different concentrations ranging from 1 to 100 nM. The flow rate was 45 μL / min in all experiments. The chip regeneration condition was glycine-HCl pH 1.5. The binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameter K a , K d and K D (Table 2 and Figure 2 , limited by space, Figure 2Only the kinetic sensorgrams of the nanobodies with sequence names A4-001, A4-002, A4-003, and A4-004 are given). Figure 2 The middle curves from top to bottom are the response curves of nanobodies at concentrations of 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM, 3.125 nM, and 1.5625 nM, respectively. The kinetic parameters shown in Table 2 were calculated by equation fitting. Nanobodies have high affinity for AAV2, AAV5, AAV8, and AAV9, with K D Range 10 -6 ~10 -11 (M).

[0252] Table 2 Affinity of nanobodies to different AAVs

[0253]

[0254]

[0255]

[0256]

[0257] B. Sequence Optimization of Anti-AAV Nanobodies

[0258] Example 6: Humanization of Nanobodies and Affinity Determination

[0259] Humanization method 1

[0260] The protein sequences of nanobodies A4-015 and A4-036 were compared with those of human germlines, and the differential amino acids were marked in the framework region. Then, the differential amino acids of the two were replaced with human amino acids by site-directed mutagenesis to generate humanized nanobodies A4-H3, A4-H4, A4-H5, and A4-H6. The humanized nanobodies were then expressed and purified.

[0261] Humanization method 2

[0262] The protein sequence of the nanobody was compared with the human germline, the complementary determining region sequence of A4-003 was transplanted into the human germline antibody framework region, and humanized nanobody sequences A4-H1 and A4-H2 were generated by gene synthesis. The humanized nanobody was then expressed and purified.

[0263] (1) The basic culture medium of humanized nanobodies is TB medium, which is inoculated at 5% inoculation volume, cultured at 37° C. for 3 to 5 hours, and the inducer IPTG is added for overnight induction;

[0264] (2) After induction, centrifuge at 4000 rpm for 20 min to obtain wet bacteria containing humanized nanobodies;

[0265] (3) Add lysis buffer (10 mM imidazole, 500 mM NaCl, pH 7.40.02M PB) to the obtained wet bacteria at a ratio of 1:10, and use a 700 bar high-pressure homogenizer to disrupt the cells;

[0266] (4) Centrifuge at 4°C and 10,000 rpm for 20 min and collect the supernatant;

[0267] (5) The supernatant was filtered through a 0.45 μm filter and then passed through an affinity chromatography column (GE Healthcare, US) to separate and purify the humanized nanoantibodies, wherein the filler of the affinity chromatography column was Ni Sepharose High Performance;

[0268] (6) The nanoantibodies purified by affinity chromatography were subjected to SDS-PAGE electrophoresis to determine the purity, and the protein solution with higher purity was selected to determine the protein concentration using the BCA method.

[0269] Application of SPR technology to analyze the binding ability of humanized nanoantibodies to AAV

[0270] AAV was amino-coupled to a CM5 sensor chip at a density of 500-800 RU, and the nanobody was injected at 6 different concentrations ranging from 1 to 100 nM, with a flow rate of 45 μL / min in all experiments. The chip regeneration condition was glycine-HCl pH 1.5. The binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameter K a , K d and K D Table 3 is obtained.

[0271] Compared with the original sequence, the affinity of the humanized nanobody to the antigen AAV has not been significantly reduced, and the affinity to the relevant antigen remains at the same order of magnitude. For example, the affinity of A4-003 to AAV8, AAV2, AAV9, and AAV5 is 1.2×10 -9 , 6.07×10 -9 , 1.84×10 -7 ,8.24×10 -9 M, its two humanized sequences A4-H1 and A4-H2 still have an affinity level of 10 for the above four antigens -9 , 10 -9 , 10 -7 , 10 -9 M.

[0272] Table 3 Kinetic parameters of humanized nanobodies

[0273]

[0274]

[0275] Example 7: Sequence Optimization Strategy 2

[0276] Multivalent antibody modification and affinity determination

[0277] 1. Preparation of bivalent antibodies

[0278] The amino acid sequence of the bivalent polypeptide sequence that specifically binds to AAV is designed, as shown in A4-B1, A4-B2, A4-B3 and A4-B4. It consists of a C-terminal nanobody A, a 15 amino acid Gly / Ser linker and a C-terminal nanobody B (as shown in Figure 3 ). Wherein, nanobody A and nanobody B may be the same or different. Nanobody A of A4-B1 is A4-015, and nanobody B is the same as A; Nanobody A of A4-B2 is A4-014, and nanobody B is A4-012; Nanobody A of A4-B3 is A4-H1, and nanobody B is the same as A; Nanobody A of A4-B4 is A4-H1, and nanobody B is A4-H4.

[0279] The DNA sequences of these divalent polypeptides are artificially synthesized, and the DNA fragments are connected to the pET23a vector to construct a divalent polypeptide plasmid, which is then transformed into Escherichia coli to obtain divalent polypeptide engineering bacteria.

[0280] Then the bivalent peptide was expressed and purified:

[0281] (1) The basic medium for the divalent polypeptide is TB medium, which is inoculated at a volume ratio of 5%, cultured at 37° C. for 3 to 5 h, and the inducer IPTG (final concentration 0.25 mM) is added for overnight induction;

[0282] (2) After induction, the mixture was centrifuged at 4000 rpm for 20 min to obtain wet bacteria containing the divalent polypeptide.

[0283] (3) Add lysis buffer (10 mM imidazole, 500 mM NaCl, pH 7.40.02M PB) to the obtained wet bacteria at a ratio of 1:10, and use a 700 bar high-pressure homogenizer to disrupt the cells;

[0284] (4) Centrifuge at 4°C and 10,000 rpm for 20 min and collect the supernatant;

[0285] (5) The supernatant was filtered through a 0.45 μm filter and then passed through an affinity chromatography column (GE Healthcare, US) to separate and purify the divalent polypeptide, wherein the filler of the affinity chromatography column was Ni Sepharose High Performance;

[0286] (6) The nanoantibodies purified by affinity chromatography were subjected to SDS-PAGE electrophoresis to determine the purity, and the protein solution with higher purity was selected to determine the protein concentration using the BCA method.

[0287] 2. Preparation of trivalent antibodies

[0288] The amino acid sequence of the trivalent polypeptide sequence that specifically binds to AAV is designed, as shown in A4-C1, A4-C2, A4-C3, A4-C4, A4-C5, A4-C6, A4-C7, A4-C8, and A4-C9. It is composed of nanobody A-(GGGGS)3-nanobody B-(GGGGS)3-nanobody C. Among them, nanobody A, nanobody B and nanobody C can be the same or different, and the order can also be swapped. The nanoantibodies A, B, and C of A4-C1 are identical to A4-057; the nanoantibodies A, B, and C of A4-C2 are identical to A4-055; the nanoantibodies A and B of A4-C3 are identical to A4-015, and the nanoantibody C is A4-054; the nanoantibodies A and B of A4-C4 are identical to A4-014, and the nanoantibody C is A4-054; the nanoantibodies A and C of A4-C5 are identical to A4-056, and the nanoantibody B is A4-051; the nanoantibody A of A4-C6 is identical to A4-057; the nanoantibody B of A4-051 is identical to A4-051; the nanoantibody A of A4-C6 is identical to A4-015, and the nanoantibody C is A4-054; the nanoantibodies A and B of A4-C4 are identical to A4-014, and the nanoantibody C is A4-054; the nanoantibodies A and C of A4-C5 are identical to A4-056, and the nanoantibody B is A4-051; the nanoantibody A of A4-C6 is identical to A4-015 ... A of A4-C6 is identical to A4-015. The nanoantibody A of A4-C7 is A4-051, the nanoantibody B is A4-053, and the nanoantibody C is A4-049; the nanoantibody A of A4-C8 is A4-053, the nanoantibody B is A4-051, and the nanoantibody C is A4-052; the nanoantibody A of A4-C9 is A4-051, the nanoantibody B is A4-052, and the nanoantibody C is A4-053.

[0289] The DNA sequences of these trivalent polypeptides are artificially synthesized, and the DNA fragments are connected to the pET23a vector to construct a trivalent polypeptide plasmid, which is then transformed into Escherichia coli to obtain trivalent polypeptide engineering bacteria.

[0290] The trivalent polypeptide is then expressed and purified, and the expression and purification process is the same as above.

[0291] 3. Preparation of Tetravalent Antibodies

[0292] The amino acid sequence of the tetravalent polypeptide sequence that specifically binds to AAV is designed, as shown in A4-D1, A4-D2, A4-D3, A4-D4, A4-D5, A4-D6, A4-D7, A4-D8, A4-D9, A4-D10, A4-D11, A4-D12 and A4-D13. It is composed of nanobody A-(GGGGS)3-nanobody B-(GGGGS)3-nanobody C-(GGGGS)3-nanobody D. Among them, nanobody A, nanobody B, nanobody C and nanobody D can be the same or different, and the order can also be reversed. The nanoantibodies A, B, C, and D of A4-D1 are the same as A4-043; the nanoantibodies A, B, C, and D of A4-D2 are the same as A4-044; the nanoantibodies A, B, and C of A4-D3 are the same as A4-043, and the nanoantibody D is A4-045; the nanoantibodies A, C, and D of A4-D4 are the same as A4-043, and the nanoantibody B is A4-045; the nanoantibodies A, B, and D of A4-D5 are the same as A4 -046, nanobody C is A4-047; nanobody A and B of A4-D6 are the same as A4-067, nanobody C is A4-068, and nanobody D is A4-069; nanobody A and D of A4-D7 are the same as A4-067, nanobody B is A4-068, and nanobody C is A4-069; nanobody B and D of A4-D8 are the same as A4-081, and nanobody A is A4-08 2, nanobody C is A4-076; nanobody B and C of A4-D9 are the same as A4-081, nanobody A is A4-076, and nanobody D is A4-067; nanobody A of A4-D10 is A4-043, nanobody B is A4-036, nanobody C is A4-025, and nanobody D is A4-033; nanobody A of A4-D11 is A4-045, and nanobody B is A 4-033, nanoantibody C is A4-025, and nanoantibody D is A4-028; the nanoantibody A of A4-D12 is A4-033, nanoantibody B is A4-043, nanoantibody C is A4-036, and nanoantibody D is A4-025; the nanoantibody A of A4-D13 is A4-025, nanoantibody B is A4-033, nanoantibody C is A4-043, and nanoantibody D is A4-036.

[0293] The DNA sequences of these tetravalent polypeptides are artificially synthesized, and the DNA fragments are connected to the pET23a vector to construct a tetravalent polypeptide plasmid, which is then transformed into Escherichia coli to obtain tetravalent polypeptide engineering bacteria.

[0294] Then the tetravalent polypeptide is expressed and purified, and the expression and purification process is the same as above.

[0295] SPR technology was used to analyze the binding ability of multivalent peptides to AAV.

[0296] AAV was amino-coupled to a CM5 sensor chip at a density of 500-800 RU, and the nanobody was injected at 5 different concentrations ranging from 1-50 nM, with a flow rate of 45 μL / min in all experiments. The chip regeneration condition was glycine-HCl pH 1.5. The binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameter K a , K d and K D The specific data results are shown in Table 4.

[0297] It can be seen that compared with monovalent nanobodies, the affinity of multivalent nanobodies to antigen AAV is improved to varying degrees. The main manifestation is the dissociation constant K d The dissociation becomes slower, resulting in an increase in affinity, ranging from several times to hundreds of times.

[0298] Table 4 Kinetic parameters of multivalent nanobodies

[0299]

[0300] Example 8: Sequence Optimization Strategy 3

[0301] Amino acid modification and affinity determination of nanobodies at the N-terminus and C-terminus. One or more amino acid tags (such as histidine tags, biotin ligase tags, HA tags, sumo tags, GST tags, sulfhydryl tags, polylysine tags, thrombin tags, enterokinase tags, etc.) can be added to the N-terminus and C-terminus of nanobodies or multivalent nanobodies separately or simultaneously through genetic engineering, post-translational modification, and protein engineering. If necessary, amino acid linkers can be added to the amino acid tags to achieve the purposes of efficient expression, modification, purification, and functionalization of nanobodies without affecting the antigen binding ability of nanobodies.

[0302] The amino acid sequences of the modified C-terminal of the nanobody were designed, as shown in A4-T1 (SEQ ID No: 147), A4-T2 (SEQ ID No: 148) and A4-L1 (SEQ ID No: 149). A4-T1 consists of A4-017 and C-terminal 6×His-tag; A4-T2 consists of A4-017 and C-terminal GGGGS and 6×His-tag; A4-L1 consists of A4-017 and C-terminal IgA hinge (SerThrProProThrProSerProSerThrProPro) and 6×His-tag.

[0303] The amino acid sequences of the nanobody N-terminal modifications were designed, as shown in A4-M1 (SEQ ID No: 150) and A4-M2 (SEQ ID No: 151). A4-M1 consists of A4-017 and the N-terminal amino acid MetAlaGln; A4-M2 consists of A4-017 and the N-terminal amino acid Met.

[0304] The DNA sequence of the nano-antibody is artificially synthesized, and the DNA fragment is connected to the pET23a vector to construct a plasmid, which is then transformed into Escherichia coli to obtain the modified nano-antibody engineering bacteria.

[0305] Then the modified nanoantibodies were expressed and purified:

[0306] (1) The basal medium was TB medium, inoculated at 5% inoculum, cultured at 37°C for 3-5 h, and the inducer IPTG was added for overnight induction;

[0307] (2) After induction, centrifuge at 4000 rpm for 20 min to obtain wet bacteria containing the target sequence.

[0308] (3) Add lysis buffer (10 mM imidazole, 500 mM NaCl, pH 7.40.02M PB) to the obtained wet bacteria at a ratio of 1:10, and use a 700 bar high-pressure homogenizer to disrupt the cells;

[0309] (4) Centrifuge at 4°C and 10,000 rpm for 20 min and collect the supernatant;

[0310] (5) The supernatant was filtered through a 0.45 μm filter and then separated and purified by an affinity chromatography column (GE Healthcare, US), wherein the filler of the affinity chromatography column was Ni Sepharose High Performance;

[0311] (6) The nanoantibodies purified by affinity chromatography were subjected to SDS-PAGE electrophoresis to determine the purity, and the protein solution with higher purity was selected to determine the protein concentration using the BCA method.

[0312] Application of SPR technology to analyze the binding ability of modified nanoantibodies to AAV

[0313] AAV was amino coupled to a CM5 sensor chip at a density of 500-800 RU, and nanobodies were injected at 5 different concentrations in the range of 1-50 nM (50 nM, 25 nM, 12.5 nM, 6.25 nM, 1.5625 nM), with a flow rate of 45 μL / min in all experiments. The chip regeneration condition was glycine-HCl pH 1.5. The binding curves obtained at different nanobody concentrations were used to calculate the kinetic parameter Ka , K d and K D As shown in Table 5, compared with the original sequence A4-017, the affinity of the modified nanobody to the antigen AAV remained basically unchanged.

[0314] Table 5 Kinetic parameters of C-terminally modified nanobodies

[0315]

[0316]

[0317] C. Preparation of AAV adsorbent

[0318] Example 9 Preparation of AAV adsorbent

[0319] Activation of agarose gel. Take 2g of agarose microspheres, add 2mol / L NaOH and 0.8mL of 1,4-butanediol diglycidyl ether, mix them in this proportion, and react for more than 60min. After the reaction, wash the gel with a large amount of deionized water and filter it into a wet cake.

[0320] Immobilization of AAV nanobodies. Take the activated agarose gel carrier material, add 2 mL of nanobody solution (PBS is used to prepare the nanobody solution in this embodiment, and physiological saline or pure water can also be used), and react at 37°C and 250rpm for 24 hours. After the reaction is completed, add 3 times the volume of ethanolamine (6% by volume, pH 9.0) for overnight blocking to obtain an AAV adsorbent.

[0321] ① The nano antibody is A4-002, the concentration is 10.38 mg / mL, the glue-water ratio is 1:3, the epoxy density on the glue is 3 μmol / g, and the final nano antibody coupling amount is 11.58 mg / g adsorbent. Recorded as adsorbent A.

[0322] ② The nano antibody is A4-008, the concentration is 6.75 mg / mL, the glue-water ratio is 1:5, the epoxy density on the glue is 3 μmol / g, and the final nano antibody coupling amount is 9.77 mg / g adsorbent. Recorded as adsorbent B.

[0323] ③ The nano antibody is A4-008, the concentration is 6.75 mg / mL, the glue-water ratio is 1:7, the epoxy density on the glue is 3 μmol / g, and the final nano antibody coupling amount is 10.74 mg / g adsorbent. Recorded as adsorbent C.

[0324] ④ The nano antibody is A4-014, the concentration is 3.19 mg / mL, the glue-water ratio is 1:8, the epoxy density on the glue is 2 μmol / g, and the final nano antibody coupling amount is 3.12 mg / g adsorbent. Recorded as adsorbent D.

[0325] ⑤ The nanobody is A4-024, the concentration is 5.14 mg / mL, the glue-water ratio is 1:6, the epoxy density on the glue is 2 μmol / g, and the final nanobody coupling amount is 6.36 mg / g adsorbent. Recorded as adsorbent E.

[0326] Example 10 AAV preparation

[0327] HEK293T cells were cultured and replaced with antibiotic-free medium one day before transfection for 12-24 h to allow the cell density to reach 80%.

[0328] Prepare EZ-Trans-DNA complex. Tube A: pAAV-hrGFP, pAAV-RC, pHelper in a 1:1:1 molar ratio. The total amount of the three plasmids is 36μg / 15mL cells, which is supplemented with DMEM; Tube B: 108μL EZ Trans transfection reagent diluted with DMEM. Mix well. Let stand at room temperature for 10-15 minutes.

[0329] Transfect cells. Slowly drop the prepared transfection system into the culture dish, 3 mL / dish; slowly shake the culture dish to mix, and place it in the incubator for culture. After 24 hours of culture, replace the medium with new culture medium, and use a fluorescence microscope to observe the transfection efficiency.

[0330] Virus collection: 48-72 hours after transfection, the virus can be collected by scraping the cells with a cell scraper and collecting them in a 50 mL centrifuge tube. Centrifuge at 200×g for 5 minutes to collect the cell pellet. Resuspend the cells with PBS and disrupt them by ultrasound.

[0331] Example 11 Evaluation of adsorption performance of AAV adsorbent

[0332] 1 mL of the prepared AAV adsorbent was loaded into a chromatographic column with a height of 2 cm. After loading, the column was first rinsed with the equilibration buffer; then the sample was loaded, and then the equilibration buffer was used to rinse again; then the elution was performed with the elution buffer. The total amount of AAV in the sample, flow-through, equilibration solution, and elution solution was determined, and the AAV yield was calculated. Among them, VP represents the number of viral capsid particles.

[0333] AAV yield = AAV elution amount (VP) ÷ AAV binding amount (VP) × 100%

[0334] Equilibration buffer: 10 mM Tris-300 mM NaCl, pH 7.6; elution buffer: 0.1 M NaAc, 0.5 M NaCl, pH 1.5.

[0335] The binding capacity of adsorbent A to AAV2 is 9.40×10 13 , the elution volume is 8.46×10 13The yield was 90.0%; the binding capacity to AAV5 was 1.17×10 14 , the elution volume is 9.76×10 13 The yield was 83.2%; the binding capacity to AAV6 was 9.20×10 13 , the elution volume is 8.31×10 13 The yield was 90.3%; the binding capacity to AAV8 was 1.02×10 14 , the elution volume is 9.27×10 13 The yield was 90.9%; the binding capacity to AAV9 was 1.26×10 14 , the elution volume is 1.08×10 14 , the yield was 85.5%.

[0336] The binding capacity of adsorbent B to AAV2 was 9.10×10 13 , the elution volume is 7.85×10 13 The yield was 86.2%; the binding capacity to AAV5 was 8.56×10 13 , the elution volume is 7.67×10 13 The yield was 89.6%; the binding capacity to AAV6 was 8.78×10 13 , the elution volume is 7.62×10 13 The yield was 86.8%; the binding capacity to AAV8 was 9.47×10 13 , the elution volume is 7.95×10 13 The yield was 83.9%; the binding capacity to AAV9 was 8.83×10 13 , the elution volume is 7.32×10 13 , the yield was 82.9%.

[0337] The binding capacity of adsorbent C to AAV2 was 1.21×10 14 , the elution volume is 9.42×10 13 The yield was 77.9%; the binding capacity to AAV5 was 8.95×10 13 , the elution volume is 7.48×10 13 The yield was 83.6%; the binding capacity to AAV6 was 9.43×10 13 , the elution volume is 7.88×10 13 The yield was 83.6%; the binding capacity to AAV8 was 1.16×10 14 , the elution volume is 9.94×10 13 The yield was 85.7%; the binding capacity to AAV9 was 9.17×10 13 , the elution volume is 8.53×10 13 , the yield was 93.0%.

[0338] The binding capacity of adsorbent D to AAV2 was 4.93×10 13 , the elution volume is 4.37×10 13 The yield was 88.6%; the binding capacity to AAV5 was 3.22×10 13 , the elution volume is 2.83×10 13 The yield was 87.9%; the binding capacity to AAV6 was 2.59×10 13 , the elution volume is 2.20×10 13 The yield was 84.9%; the binding capacity to AAV8 was 3.83×10 13 , the elution volume is 3.51×10 13 The yield was 91.6%; the binding capacity to AAV9 was 4.30×10 13 , the elution volume is 3.76×10 13 , the yield was 87.3%.

[0339] The binding capacity of adsorbent E to AAV2 was 7.65×10 13 , the elution volume is 6.63×10 13 The yield was 86.7%; the binding capacity to AAV5 was 4.80×10 13 , the elution volume is 4.12×10 13 The yield was 85.8%; the binding capacity to AAV6 was 6.09×10 13 , the elution volume is 5.48×10 13 The yield was 90.0%; the binding capacity to AAV8 was 5.17×10 13 , the elution volume is 4.41×10 13 The yield was 85.3%; the binding capacity to AAV9 was 6.50×10 13 , the elution volume is 5.97×10 13 , the yield was 91.8%.

[0340] In summary, the AAV adsorbent prepared by the present invention has the ability to bind to AAVs of different serotypes with a high yield, and is a new broad-spectrum AAV adsorbent that can be used for the purification of AAVs of different serotypes.

[0341] Example 11 Preparation of AAV Detection Kit

[0342] The nanobody A4-021 solution was changed to PBS (pH 7.4) with a concentration of about 10 mg / mL and the HRP coupling kit (abcam, ab102890) and dialyzed thoroughly.

[0343] Direct ELISA test method:

[0344] Add AAV standard or test sample to a highly hydrophobic 96-well plate, incubate on a horizontal shaker for 2 hours, and wash the plate with PBS; block with 1% to 3% skim milk powder and wash the plate with PBS; add HRP-coupled nanoantibody A4-021, incubate on a horizontal shaker for 2 hours, and wash the plate with PBS; add TMB working solution, incubate at room temperature in the dark for 30 minutes, add 2M sulfuric acid stop solution to terminate the reaction, and measure OD 450 .

[0345] Sandwich ELISA test method:

[0346] The capture ligand was coated on a highly hydrophobic 96-well plate, incubated overnight at 4°C in the dark, and the plate was washed with PBS; 1% to 3% skim milk powder was used for blocking, and the plate was washed with PBS; AAV standard or the sample to be tested was added, incubated on a horizontal shaker for 2 hours, and the plate was washed with PBS; the nanoantibody A4-021 coupled with HRP was added, incubated on a horizontal shaker for 2 hours, and the plate was washed with PBS; TMB working solution was added, incubated at room temperature in the dark for 30 minutes, 2M sulfuric acid stop solution was added to terminate the reaction, and the OD was measured. 450 .

[0347] The capture ligand can be nanobody A4-021 or other nanobodies in the present invention, or anti-AAV antibody, or other ligand molecules that can bind to AAV. The capture antibody used in this example is A4-040.

[0348] The standard curve of AAV8 measured by the kit of the present invention is as follows Figure 4 and Figure 5 As shown, Figure 4 is the standard curve for direct ELISA detection. Figure 5 is the standard curve of sandwich ELISA detection, and the two R 2 All of them can reach above 0.99, indicating that the ELISA detection method established based on the nanobody of the present invention has strong reliability and high sensitivity.

[0349] The prior art uses real-time quantitative PCR detection technology to detect viral particles containing DNA, but cannot detect empty capsids. The present invention can detect empty capsids and viral particles together. The detection of empty capsids is very important because empty capsids are not beneficial for treatment and may even increase immunogenicity. Therefore, quantitative detection of empty capsids and control of their content are key links in AAV preparation.

[0350] Industrial Applicability

[0351] The nanobody of the present invention is an anti-AAV nanobody with a new amino acid sequence discovered by screening a phage library. The nanobody and its polypeptide have high affinity and activity, can specifically recognize and bind to AAV, the prepared affinity chromatography column has a strong adsorption capacity for AAV and can be used for AAV purification, and the prepared detection kit can be used for detecting AAV and quantitative analysis.

[0352] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A nanobody, characterized in that The variable region in the amino acid sequence of the nanobody includes a complementary determining region CDR and a framework region FR, wherein the complementary determining region CDR includes a complementary determining region CDR1, a complementary determining region CDR2 and a complementary determining region CDR3, and the nanobody can specifically recognize and bind to AAV, wherein: The framework regions FR and the complementarity determining regions CDR are arranged alternately in a sequential order; The amino acid sequence of the nanobody includes: SEQ ID NO: 041, SEQ ID NO: 072, SEQ ID NO: 074, SEQ ID NO: 075, SEQ ID NO: 076, SEQ ID NO: 077, SEQ ID NO: 079, SEQ ID NO: 083, SEQ ID NO: 084, SEQ ID NO: 085, SEQ ID NO: 086, SEQ ID NO: 087, SEQ ID NO: 088, SEQ ID NO: 093, SEQ ID NO:

102.

2. The Nanobody according to claim 1, characterized in that The Nanobody is a humanized Nanobody.

3. A polypeptide, characterized in that It is obtained by amino acid modification at the N-terminus and / or C-terminus of the Nanobody according to claim 1 or 2, wherein the method of amino acid modification at the N-terminus and / or C-terminus of the Nanobody comprises: Method 1: adding a tag to the N-terminal and / or C-terminal amino acid of the Nanobody; Method 2, adding a hinge to the N-terminal and / or C-terminal amino acid of the Nanobody; Mode three, after the N-terminal and / or C-terminal amino acids of the Nanobody are tagged, the tags are further linked to protective amino acids; The tag includes at least one of His-tag, GST-tag, Myc-tag, SUMO-tag, Strep-tag, and Flag-tag; the hinge includes at least one of GS hinge, IgG hinge, IgA hinge, and PEG; and the protected amino acid includes Ala, Gln, Glu, Met, or a combination of any two or more of the foregoing amino acids.

4. A polypeptide, characterized in that It is obtained by multivalent synthesis of the nanobody described in claim 1 or 2.

5. A polypeptide according to claim 4, characterized in that The polyvalent synthesis includes divalent, trivalent or tetravalent synthesis; Among them, the tetravalent synthetic polypeptide amino acid sequences include: SEQ ID No: 141, SEQ ID No:

142.

6. A nucleic acid, characterized in that The nucleic acid encodes the Nanobody according to claim 1 or 2 or the polypeptide according to any one of claims 3 to 5.

7. An expression vector, characterized in that: An expression cassette comprising the nucleic acid of claim 6.

8. A host cell, characterized in that A plant or plant cell containing the expression vector according to claim 7.

9. Use of the Nanobody according to claim 1 or 2 and / or the polypeptide according to any one of claims 3 to 5 in immunoassay, enrichment and or purification, wherein the immunoassay is not directly used in the diagnosis or treatment of a disease.

10. The use according to claim 9, characterized in that: The use of the nano antibody and / or the polypeptide in the preparation of a virus adsorbent, a virus purification kit, and a virus detection kit, wherein the virus is AAV.

11. A virus adsorbent, characterized in that: It comprises a carrier matrix and the nanobody according to claim 1 or 2 and / or the polypeptide according to any one of claims 3 to 5.

12. A virus purification kit, characterized in that: It comprises a carrier matrix and the nanobody according to claim 1 or 2 and / or the polypeptide according to any one of claims 3 to 5.

13. A virus detection kit, characterized in that: It comprises a carrier matrix and the nanobody according to claim 1 or 2 and / or the polypeptide according to any one of claims 3 to 5.

14. A method for detecting AAV for non-diagnostic purposes, characterized in that: The nanobody according to claim 1 or 2 and / or the polypeptide according to any one of claims 3 to 5 is coupled with HRP and then detected by direct enzyme immunosorbent assay or sandwich enzyme immunosorbent assay.

Images