Method for constructing a pig model with complete knockout of Klrb1 gene to resist Pasteurella multocida
By designing and applying specific sgRNA and CRISPR/Cas9 vectors, a pig animal model with anti-polycoidal Pasteuris gene edited by complete knockdown of pig Klrb1 gene was constructed, solving the difficulty in constructing bilateral knockdown of pig Klrb1 gene in the prior art. The problem of this is to achieve efficient gene knockout and improve pig resistance to polyoxic Pasteuris.
Patent Information
- Application Number
- CN202410007547.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-03
- Publication Date
- 2024-12-17
- Estimated Expiration
- 2044-01-03
AI Technical Summary
The prior art is difficult to effectively construct the target site for bilateral knockout of pig Klrb1 gene and the animal model for bilateral knockout of pig Klrb1 gene, and it is impossible to efficiently prevent infection of polyoxic Pasteurella.
Design specific sgRNA and ligate it to CRISPR/Cas9 vector pX458, transfect pig primary fibroblasts by electroporation, perform nuclear transplantation and embryo transfer, and construct anti-polyoxic Pasteuris gene editing with complete knockout of Klrb1 gene Pig animal model.
The complete knockdown of the Klrb1 gene of pigs with convenient operation and high knockout efficiency has been achieved, which has significantly improved the pig's immune ability to fight against polyoxic Pasteuris, prevented the further translation of the gene into protein, and effectively prevented the infection of pathogens.
Smart Images
Figure CN117821459B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering, and specifically relates to a method for constructing a gene-edited pig animal model resistant to Pasteurella multocida with a completely knocked-out Klrb1 gene. Background Art
[0002] Pasteurella multocida: Pasteurella multocida, also known as swine plague, is a serious pathogen and one of the main pathogens causing progressive atrophic rhinitis, hemorrhagic septicemia or infectious pneumonia. The main manifestations in pigs are facial deformation, chronic rhinitis, atrophy and deformation or disappearance of nasal conchae, and can also cause systemic calcium metabolism disorders, slow growth, damage to respiratory structure and function, resulting in reduced body resistance, infection with other pathogens, causing porcine respiratory syndrome, and increasing mortality.
[0003] Klrb1 gene: Killer Cell Lectin Like Receptor B1 (Klrb1) is a protein-coding gene, also known as CD161 and NKRP1A. This is a type II transmembrane C-type lectin-like molecule, expressed in the form of disulfide linkage on the cell membrane. Current studies have shown that KLRB1 protein is enriched in local inflammatory sites. Using IL-2 to stimulate effector cells to downregulate Klrb1 gene expression can lead to increased chondrocyte killing. Its related pathways include the innate immune system and class I MHC-mediated antigen processing and presentation.
[0004] CRISPR / Cas9 gene editing technology: The Clustered Regularly Interspaced Short Palinmic Repeats (CRISPR) gene editing system has inspired the development of powerful genomic tools, and Cas9 protein is one of the most widely used Cas protein subtypes. The CRISPR / Cas9 gene editing system has been widely used in the research of molecular regulatory mechanisms related to agricultural animal traits, and is widely used for its high efficiency and precision.
[0005] In summary, Pasteurella multocida will seriously affect the health status and feed utilization of pigs. Currently, the control of this disease mainly relies on vaccination and antibiotic treatment. Summary of the invention
[0006] The technical problem to be solved by the present invention is: how to provide a target site for bilateral knockout of pig Klrb1 gene and a method for constructing a bilateral knockout animal model of pig Klrb1 gene.
[0007] The technical solution of the present invention is: an sgRNA, whose nucleotide sequence is shown in SEQ ID No.2.
[0008] A biological material contains the sgRNA described above, wherein the biological material is recombinant DNA, a vector or an engineered bacterium.
[0009] Application of the sgRNA or biological material described above in the preparation of Klrb1 gene knockout and Pasteurella multocida-resistant gene-edited pigs.
[0010] A method for constructing a gene-edited pig animal model with complete knockout of the Klrb1 gene and resistance to Pasteurella multocida comprises the following steps:
[0011] (1) Designing sgRNA targeting the porcine Klrb1 gene and ligating the DNA sequence corresponding to the sgRNA to the Cas9 vector pX458;
[0012] (2) using the vector obtained in step (1) to transfect into cultured primary porcine fibroblasts by electroporation;
[0013] (3) The porcine primary fibroblast cell line obtained by transfection in step (2) is subjected to nuclear transplantation and embryo transplantation to obtain a model pig with complete knockout of the Klrb1 gene.
[0014] Furthermore, the nucleotide sequence of the sgRNA is shown in SEQ ID No.2.
[0015] Compared with the prior art, the present invention has the following beneficial effects:
[0016] 1. The present invention constructs a pig with complete Klrb1 gene knockout for the first time based on the CRISPR / Cas9 gene editing system, which has the advantages of convenient operation and high knockout efficiency.
[0017] 2. The sgRNA targeting site designed by the present invention is located on exon 1 of the porcine Klrb1 gene, which is conserved and encodes an important functional region. It has high targeting efficiency and can effectively prevent the gene from being further translated into protein. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 Schematic diagram of the plasmid map of the CRISPR / Cas9 vector (pX458);
[0019] Figure 2 Observation of the status of primary fibroblasts cultured from piglet ear fibroblast tissue;
[0020] Figure 3 Schematic diagram of the location of sgRNA targeting exon 1 of the porcine Klrb1 gene, and the five different primary fibroblast cell lines with complete knockout of the Klrb1 gene obtained;
[0021] Figure 4 Schematic diagram of the construction process of the Klrb1 gene-edited pig animal model provided by the present invention;
[0022] Figure 5 Schematic diagram of the observation of recipient follicle morphology;
[0023] Figure 6 Genotype identification results of Klrb1 gene-edited pigs and control pigs;
[0024] Figure 7 Schematic diagram of the morphological observation of the nasal turbinates and lungs after the Klrb1 gene-edited pigs and the control group pigs were challenged with the Pasteurella multocida HN06 strain. DETAILED DESCRIPTION
[0025] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.
[0026] 1 Cloning and analysis of exon 1 sequence region of porcine Klrb1 gene.
[0027] 1.1 Exon 1 of the porcine Klrb1 gene is located at the beginning of the coding sequence, has a conserved sequence, and encodes an important functional region, which is of great significance to protein translation, such as Figure 3 As shown, exon 1 is involved in the coding of two important variants. The nucleotide sequence of exon 1 region of porcine Klrb1 gene is shown in SEQ ID No.1.
[0028] 2 Design of gene targeting sgRNA.
[0029] 2.1 Use the website CRISPR Design (http: / / crispr.mit.edu / ) to design sgRNA, and connect the DNA sequence corresponding to the sgRNA to the CRISPR / Cas9 vector (pX458). The nucleotide sequence of the sgRNA is shown in SEQ ID No. 2 (GGAAAGACAGGTGATATATGCGG).
[0030] 3. Collect ear tissue from male Large White piglets and use the tissue adhesion method to culture ear fibroblasts in vitro.
[0031] 3.1 Cells were cultured in basic growth medium (10% FBS (HyClone), 100 units / mL penicillin, and 100 μg / ml streptomycin (Sigma, USA)). All cells were maintained in a humidified incubator at 37°C and 5% carbon dioxide.
[0032] 3.2 Use the PCR Mycoplasma Detection Kit (TransGen) to confirm that the cells are not contaminated by mycoplasma. Cell morphology observation shows that the cells are spindle-shaped, with a strong three-dimensional sense and good refractive index. Figure 2 shown.
[0033] 3.4 The pX458 vector was used to prepare a primary ear margin fibroblast cell line with complete knockout of the Klrb1 gene by electroporation.
[0034] 3.5 The knockout cell lines were genotyped and the nucleotide sequences of the primer pairs used for PCR amplification of the exon 1 region of the Klrb1 gene were as follows:
[0035] F:5'-TGCGGTGACATAAGAGAGACA-3'(SEQ ID No.3)
[0036] R:5'-TGGATGCAAATGCACTGGAAC-3'(SEQ ID No.4)
[0037] Five different Klrb1 gene complete knockout primary ear edge fibroblast cell lines were identified, such as Figure 3 As shown. The DNA double-strand frameshift mutation caused the Klrb1 gene stop codon to be premature, the KLRB1 protein was inactivated, and positive fibroblasts with +1 (T) preference were selected as donor cell nuclei.
[0038] 4. The strategy for constructing a pig animal model with complete knockout of the Klrb1 gene includes the following steps: Figure 4 shown.
[0039] 4.1 Use the primary ear fibroblast cell line with complete knockout of Klrb1 gene as the donor nucleus for transplantation. Select medium-sized, uniform, and normal corpus luteum follicles as donor follicles, such as Figure 5 shown.
[0040] 4.2 Embryo transfer was used to confirm that the piglets continued to grow in the recipient sows. A total of 7 recipient sows were transplanted in batches, with a total of 1,418 reconstructed embryos transplanted. The pregnancy rate of the 7 sows was 57.14% (4 / 7). A total of 27 piglets were born, with a survival rate of 55.55% (15 / 27).
[0041] 4.3 Collect piglet ear fibroblast tissue to extract DNA for genotype identification and amplify the exon 1 region of the Klrb1 gene. The nucleotide sequence F / R of the primer pair used for PCR is as follows:
[0042] F:5'-TGCGGTGACATAAGAGAGACA-3'(SEQ ID No.3)
[0043] R:5'-TGGATGCAAATGCACTGGAAC-3'(SEQ ID No.4)
[0044] The exon 1 region information of the Klrb1 gene was amplified, and the complete knockout of the Klrb1 gene was verified by Sanger sequencing. Figure 6 shown.
[0045] 5 pairs of Klrb1 gene complete knockout pigs were challenged with Pasteurella multocida HN06 strain.
[0046] 5.1 All pigs were routinely raised under the same conditions, using a standardized feeding regimen and free access to drinking water.
[0047] 5.2 Piglets at 35 days of age and weighing about 7-10 kg were challenged with Klrb1 gene knockout pigs and normal control pigs by nasal drops. Three days before the challenge, they were treated with 1% acetic acid for 3 days.
[0048] 5.3 Treat each pig with 1 mL of Pasteurella multocida HN06 by nasal drip, with a total bacterial count of 1.4×10 8 cfu / mL.
[0049] 5.4 After 28 days of observation, conduct anatomical analysis and organize the data, such as Figure 7 As shown. Comparing the experimental group and the control group, after the pigs in the control group were challenged with the virus, the pigs were depressed and had poor appetite. Some pigs showed symptoms of coughing, runny nose and high fever. The symptoms were consistent with the symptoms of Pasteurella multocida infection. After dissection, it was found that the nasal concha was atrophic and deformed, especially the abnormal lower curl of the nasal concha was the most significant. Edema and bleeding were observed in the pulmonary interlobular septa. Early abscesses and thrombi in the pulmonary interlobular septa were observed in some parenchymal parts, and necrosis was observed in some fibrous tissues. After the Klrb1 gene was completely knocked out, it was clearly seen that the nasal concha was divided into two upper and lower curls, like fish hooks, and the nasal septum was straight without atrophy. In terms of lung morphology, the whole lung was full and conical, without bleeding spots and necrotic lesions. The immune ability of pigs with bilateral knockout of the Klrb1 gene was significantly improved in terms of resistance to Pasteurella multocida.
Claims
1. Preparation of sgRNA or recombinant DNA, vector or engineered bacteria containing the sgRNA Klrb1 Application of gene knockout in gene-edited pigs resistant to Pasteurella multocida, the nucleotide sequence of the sgRNA is shown in SEQ ID No.
2.
2. A Klrb1 Method for constructing a gene-edited pig animal model with complete gene knockout and resistance to Pasteurella multocida. It is characterized in that The steps include: (1) Designing targeted pigs Klrb1 The sgRNA of the gene is connected to the Cas9 vector pX458, and the nucleotide sequence of the sgRNA is shown in SEQ ID No.2; (2) using the vector obtained in step (1) to transfect into cultured primary porcine fibroblasts by electroporation; (3) Using step (2) to transfect the primary porcine fibroblast cell line, perform nuclear transplantation and embryo transplantation to obtain Klrb1 A pig model with complete gene knockout.