A strain of Lactobacillus paracasei XY6 and its application in preparing gastrointestinal conditioning and weight loss medicines

Abstract

The present invention belongs to the field of probiotics and its application technology, and is specifically related to a Lactobacillus paracasei XY6 and its application in preparing gastrointestinal conditioning and weight loss medicines. In order to dig out more Lactobacillus paracasei with probiotic functions, the present invention separates and purifies a Lactobacillus paracasei XY6 strain from a fecal sample of a healthy adult in Guangdong, and the strain can produce and secrete 3-hydroxybutyric acid, can inhibit α-glucosidase activity, can inhibit xanthine oxidase activity, has superior protease activity, has superior cellulase activity and can inhibit renin activity, has anti-inflammatory and improves intestinal flora; hypoglycemic; can prevent and alleviate multiple functions such as hyperuricemia and gout, and has important application value and economic value in the fields of gastrointestinal conditioning and weight loss.

Description

Technical Field

[0001] The invention belongs to the technical field of probiotics and their application, and particularly relates to a strain of Lactobacillus paracasei XY6 and application thereof in the preparation of gastrointestinal conditioning and weight loss medicines. Background Art

[0002] Lactobacillus paracasei, also known as Lactobacillus paracasei, is a facultative anaerobic, non-motile, non-spore-forming Gram-positive short or long rod-shaped polymorphic bacillus. The bacteria vary in length, generally less than 1.5 μm in width, with both ends flush and square, and are mostly arranged in short or long chains, and sometimes spherical bacteria can also be seen.

[0003] Lactobacillus paracasei is one of the bacteria that can be produced and processed, and it is safe and non-toxic to eat. At the same time, Lactobacillus paracasei is also a probiotic that is beneficial to human health. It can promote intestinal peristalsis, keep the intestinal flora balanced, and thus enhance the body's resistance; it has the effect of promoting human specific and nonspecific immunity, enhancing human immunity, and preventing diseases; it is beneficial to development, enhancing human physique, delaying the aging of the body, and prolonging human life. It can settle in the intestines, effectively regulate the flora in the intestines, maintain the internal environment of the intestines, and prevent and treat constipation caused by dysbiosis. At present, Lactobacillus paracasei, as a probiotic lactobacillus with great potential, has become a hot topic of research, and is being continuously used to make probiotic preparations suitable for humans and animals.

[0004] Studies have found that different strains of Lactobacillus paracasei have different probiotic functions, such as: (1) Antibacterial effect: Lactobacillus paracasei not only has antagonistic effects on many bacteria, but some strains can also inhibit the growth of yeast and mold. Studies have shown that Lactobacillus paracasei can significantly reduce the number of Clostridium and Enterobacter in newly weaned piglets. (2) Good physiological effects: As a probiotic, Lactobacillus paracasei can regulate the balance of human intestinal flora and enhance immune function. It has broad development prospects in disease prevention. Studies have shown that Lactobacillus paracasei can enhance the host's nonspecific resistance to microbial pathogens, accelerate the clearance of pathogens in the intestine, treat intestinal flora disorders, inhibit the increase of intestinal permeability, and thus prevent food allergies and acute diarrhea; it can also increase anti-low-density oxidized lipid antibodies and CD4T-lymphocytes, enhance the phagocytic effect of granulocytes, and then regulate the host's immunity to prevent tumors. (3) Lactobacillus paracasei strains such as LC-01, K56, and Lc19 all have good effects on improving constipation and laxative effects. (4) Promote intestinal peristalsis: Lactobacillus paracasei can act as a probiotic, not only helping digest food in the intestines, but also relieving diarrhea and loose stools. (5) Lower blood pressure: Lactobacillus paracasei can lower cholesterol and blood pressure. (6) Prevent tumors: Lactobacillus paracasei can prevent the growth of tumors and will not affect physical health, so its safety is relatively good.

[0005] Because Lactobacillus paracasei has source diversity, it has genetic diversity and functional diversity, which is manifested as different Lactobacillus paracasei strains having different probiotic functions. At present, although a small number of studies have begun to focus on the development and utilization of Lactobacillus paracasei, there are still few studies on the isolation and identification, probiotic characteristics and metabolic mechanism of Lactobacillus paracasei, which to a certain extent also affects the development and utilization of Lactobacillus paracasei. Therefore, it is necessary to further develop its probiotic function according to the different sources of Lactobacillus paracasei, clarify its application prospects, further enrich the number of probiotic Lactobacillus paracasei, and make it play a greater role in human health. In summary, the research and application of probiotic Lactobacillus paracasei has a relatively broad development space. Summary of the invention

[0006] In order to overcome the deficiencies of the above-mentioned prior art, the present invention isolates and purifies a Lactobacillus paracasei XY6 strain from a fecal sample of a healthy adult in Guangdong, China. The strain can produce and secrete 3-hydroxybutyric acid, inhibit α-glucosidase activity, inhibit xanthine oxidase activity, has excellent protease activity, has excellent cellulase activity, can inhibit renin activity, and has important potential application value in the fields of gastrointestinal conditioning and weight loss.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides a Lacticaseibacillus paracasei XY6 strain, which was deposited in the China Center for Type Culture Collection on September 27, 2023, with the accession number: CCTCC NO: M 20221501; the complete 16S rDNA sequence of the Lacticaseibacillus paracasei XY6 strain is shown in SEQ ID No: 1.

[0009] The second aspect of the present invention provides use of the Lactobacillus paracasei XY6 strain described in the first aspect in the preparation of a renin inhibitor.

[0010] Studies have shown that the probiotic Lactobacillus paracasei XY6 strain can effectively inhibit renin activity, suggesting that Lactobacillus paracasei XY6 strain can be used as a renin inhibitor to inhibit renin activity, thereby preventing and treating hypertension and other cardiovascular diseases and kidney diseases.

[0011] The third aspect of the present invention provides the use of the Lactobacillus paracasei XY6 strain described in the first aspect in producing 3-hydroxybutyric acid.

[0012] Research has found that the probiotic Lactobacillus paracasei XY6 strain can produce 3-hydroxybutyric acid (3-HB), suggesting that Lactobacillus paracasei XY6 strain can be used to produce 3-HB, and through this characteristic of producing 3-HB, it can be used to provide energy for various body activities, fight osteoporosis, prevent and treat chronic syndrome, improve brain cognitive function, improve lipid metabolism, and relieve intestinal inflammation.

[0013] The fourth aspect of the present invention provides use of the Lactobacillus paracasei XY6 strain described in the first aspect in the preparation of an α-glucosidase inhibitor.

[0014] Studies have shown that the probiotic Lactobacillus paracasei XY6 strain can effectively inhibit the activity of α-glucosidase, which is related to type 2 diabetes. Inhibiting α-glucosidase is one of the methods to control postprandial hyperglycemia, suggesting that Lactobacillus paracasei XY6 strain is expected to be used in areas such as lowering blood sugar and inhibiting obesity.

[0015] The fifth aspect of the present invention provides use of the Lactobacillus paracasei XY6 strain described in the first aspect in the preparation of a xanthine oxidase inhibitor.

[0016] Studies have shown that the probiotic Lactobacillus paracasei XY6 strain can inhibit the activity of xanthine oxidase (XOD), suggesting that Lactobacillus paracasei XY6 strain can be used to inhibit the activity of xanthine oxidase through XOD activity, reduce purine in the body, reduce uric acid production, thereby controlling uric acid levels and preventing gout attacks.

[0017] The sixth aspect of the present invention provides the use of the Lactobacillus paracasei XY6 strain described in the first aspect in producing protease.

[0018] Preferably, the protease includes, but is not limited to, a protease that degrades milk protein.

[0019] Research has found that the probiotic Lactobacillus paracasei XY6 strain can produce protease, suggesting that Lactobacillus paracasei XY6 strain has the potential to be used to produce protease, and through this property of producing protease, it can be used to promote the human body's digestion and absorption of protein in food, anti-allergy, and help animals digest and absorb nutrients.

[0020] The seventh aspect of the present invention provides the use of the Lactobacillus paracasei XY6 strain described in the first aspect in producing cellulase.

[0021] Research has found that the probiotic Lactobacillus paracasei XY6 strain can produce cellulase, suggesting that Lactobacillus paracasei XY6 strain can be used to produce cellulase, and through this characteristic of producing cellulase, it can be used to promote the human body's digestion and absorption of protein in food, improve the absorption of small peptides and amino acids, and anti-allergy.

[0022] The eighth aspect of the present invention provides a bacterial agent with probiotic function, wherein the bacterial agent comprises the Lactobacillus paracasei XY6 strain described in the first aspect.

[0023] Preferably, the bacterial agent is a fermentation product of Lactobacillus paracasei XY6 strain.

[0024] Preferably, the bacterial agent also includes auxiliary materials.

[0025] More preferably, the excipients include carriers and excipients. The excipients refer to diluents, adhesives, lubricants, disintegrants, solubilizers, stabilizers, etc. that can be used in the pharmaceutical field, as well as some pharmaceutical matrices. The carrier is a functional pharmaceutical excipient available in the pharmaceutical field, including surfactants, suspending agents, emulsifiers, and some new pharmaceutical polymer materials, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid polylactic acid copolymer (PLGA), hyaluronic acid, etc.

[0026] Preferably, in the field of medical applications, the dosage forms of the bacterial agent include tablets, granules, capsules, pills, sustained-release preparations, oral liquid preparations, and injections.

[0027] More preferably, the above dosage forms refer to the dosage forms commonly used in clinical practice. The pharmaceutical preparations can be administered orally or parenterally (eg, intravenously, subcutaneously, intraperitoneally or topically). If some drugs are unstable under gastric conditions, they can be prepared into enteric-coated tablets.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] The present invention separates and purifies a Lactobacillus paracasei XY6 strain from a fecal sample of a healthy adult in Guangdong, China. The strain has multiple probiotic effects, including the ability to produce and secrete 3-hydroxybutyric acid, the ability to inhibit α-glucosidase activity, the ability to inhibit xanthine oxidase activity, the superior protease activity, the superior cellulase activity, and the ability to inhibit renin activity. Therefore, the Lactobacillus paracasei XY6 strain has multiple functions such as being able to resist inflammation and improve intestinal flora; lowering blood sugar; preventing and alleviating hyperuricemia and gout; promoting digestion and absorption of protein foods, improving protein allergies; promoting the absorption of cellulose, improving constipation; lowering blood pressure and protecting the kidneys. It can be seen that the Lactobacillus paracasei XY6 strain newly isolated by the present invention has multiple probiotic effects, can be used in the fields of gastrointestinal conditioning and weight loss, for example, being made into a medicine for gastrointestinal conditioning and weight loss, and has important application value and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the phylogenetic tree of Lactobacillus paracasei XY6 strain (Lactobacillus paracasei KS3 is derived from the Chinese invention patent "CN116286519B", and the other strains are derived from the Genome database of NCBI);

[0031] Figure 2 The Lactobacillus paracasei strain XY6 can produce and secrete 3-hydroxybutyrate;

[0032] Figure 3The fermentation liquid of Lactobacillus paracasei XY6 can secrete substances that significantly inhibit the activity of α-glucosidase;

[0033] Figure 4 The XY6 strain of Lactobacillus paracasei can inhibit the activity of XOD;

[0034] Figure 5 This is the degradation experiment of Lactobacillus paracasei XY6 strain on milk plate (left side, blank control group; right side, experimental group);

[0035] Figure 6 This is the degradation experiment of cellulose plate by Lactobacillus paracasei XY6 strain (left side, blank control group; right side, experimental group);

[0036] Figure 7 The fermentation broth of Lactobacillus paracasei XY6 can secrete substances that significantly inhibit renin activity. DETAILED DESCRIPTION

[0037] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0038] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0039] The experimental materials involved in the following examples are as follows:

[0040] (1) Strain: Lactobacillus paracasei XY6 strain, commissioned by Runze Laboratory to be isolated from an intestinal feces sample of a healthy adult (BMI=19.5) in Guangzhou, Guangdong, China, and stored in a glycerol tube at -80°C. Generally, the strain is inoculated on the surface of an MRS solid culture medium plate and inverted in a 37°C constant temperature anaerobic incubator for 24 hours to obtain colonies, or shaken in a 37°C constant temperature anaerobic incubator in an MRS liquid culture medium for 24-48 hours to obtain a fermentation liquid.

[0041] (2) Kits: 3-Hydroxybutyrate (3-HB) detection kit (Cloud-Clone Corp., Cat: CEB022Ge), α-glucosidase inhibitor screening kit (abcam, Cat: ab284520), xanthine oxidase activity assay kit (Box Biotechnology, Cat: AKAO006M), renin inhibitor screening kit (abnova, Cat: KA1361).

[0042] (3) MRS plate: beef extract 10 g, peptone 10 g, yeast extract 5 g, triammonium citrate 2 g, sodium acetate 5 g, glucose 20 g, potassium dihydrogen phosphate 2 g, Tween 80 1 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, agar 15 g, make up to 1 L with ddH2O, adjust pH to 6.2-6.6, autoclave at 121°C for 20 min, and prepare MRS plate.

[0043] (4) MRS liquid culture medium: beef extract 10 g, peptone 10 g, yeast extract 5 g, triammonium citrate 2 g, sodium acetate 5 g, glucose 20 g, dipotassium phosphate 2 g, Tween 80 1 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, make up to 1 L with ddH2O, adjust the pH to 6.2-6.6, sterilize at 121°C for 20 min, and prepare MRS liquid culture medium.

[0044] (5) MP plate: skim milk powder 10 g, sodium chloride 1 g, beef extract 10 g, peptone 10 g, yeast extract 5 g, glucose 20 g, triammonium citrate 2 g, sodium acetate 5 g, dipotassium phosphate 2 g, Tween 80 0.5 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, agar 15 g, make up to 1 L with ddH2O, adjust pH to 6.2-6.6, autoclave at 121°C for 20 min, and prepare MP plate.

[0045] (6) CMC plate: sodium carboxymethyl cellulose 10 g, ammonium sulfate 1.5 g, manganese sulfate 0.3 g, calcium chloride 0.2 g, sodium chloride 5 g, urea 0.3 g, beef extract 10 g, peptone 10 g, yeast extract 5 g, glucose 20 g, triammonium citrate 2 g, sodium acetate 5 g, dipotassium hydrogen phosphate 2 g, Tween 80 0.5 mL, magnesium sulfate 0.58 g, manganese sulfate 0.25 g, agar 15 g, ddH2O to make up to 1 L, adjust pH to 6.2-6.6, autoclave at 121°C for 20 min, and prepare CMC plate.

[0046] Example 1 Isolation and Identification of Lacticaseibacillus paracasei XY6 Strain

[0047] The Lacticaseibacillus paracasei strain XY6 was isolated from a fecal sample of a healthy adult in Guangdong, China, as follows:

[0048] The fecal sample was repeatedly washed 3 times with sterile water, placed in a mortar, 500uL sterile water was added for every 100mg of feces, the homogenate was thoroughly ground, an appropriate amount of grinding liquid was taken with a pipette, and it was spread on an MRS plate and cultured at room temperature for 3 days. Then, the colonies to be streaked and purified in the separation experiment plate were numbered with a marker pen, and the strain number was marked on the plate accordingly. After marking, the colonies were picked and inoculated on the MRS plate, and the strains were purified by the plate streaking method. If this method cannot separate the strains, it is necessary to pick the colonies from the enrichment plate, dilute them with the MRS liquid medium gradient, and spread them on the culture medium. Finally, referring to the Bergey Bacterial Identification Manual (Eighth Edition) and the Fungal Classification and Identification Manual, first distinguish the strains belonging to bacteria, and then observe the growth of the colonies. A purified strain was initially isolated, the strain number was XY6, and after 24 hours of culture, the colonies of the strain were observed to be round and smooth, with neat edges, bright raised surfaces in the middle, and opaque milky white.

[0049] Then, the isolated XY6 strain was molecularly identified by 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT), and the whole genome of the XY6 strain was sequenced by Beijing Biomark Biotechnology Co., Ltd. The obtained 16S rDNA sequence (SEQ ID No: 1) was BLAST-aligned in the Genome database of NCBI. The results showed that the homology of the XY6 strain with the known 16S rDNA sequence of Lactobacillus paracasei was >99%, and evolutionary analysis was performed with homologous strains ( Figure 1 ), confirming that XY6 is a different strain of the same species of Lactobacillus paracasei.

[0050] Finally, the strain XY6 was deposited, and the deposit information is as follows: deposit time: September 27, 2022; name of the depository: China Center for Type Culture Collection (CCTCC); deposit number: CCTCC NO:M 20221501; address of the depository: Wuhan University, Wuhan, China; classification name: Lacticaseibacillusparacasei.

[0051] Lactobacillus paracasei is a probiotic strain with a wide range of probiotic effects, such as anti-bacterial, improving constipation and lowering blood pressure, but strains from different sources have different effects. This shows that the new Lactobacillus paracasei XY6 isolated from human feces in the present invention can be used as a probiotic and may have new effects and functions.

[0052] Lacticaseibacillusparacasei XY616S rDNA sequence (1431bp, SEQ ID No: 1):

[0053]

[0054] Example 2 Function and application of Lactobacillus paracasei XY6 strain

[0055] (1) Lactobacillus paracasei XY6 strain can produce and secrete 3-hydroxybutyrate (3-HB)

[0056] The Lactobacillus paracasei XY6 cultured in MRS liquid medium to the stable phase was expanded into a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected at 24 hours after the stable phase, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The 3-HB concentration in the fermentation supernatant was then determined by a 3-HB specific ELISA kit (CEB022Ge). The results showed that compared with the absence of 3-HB in the blank medium MRS, the concentration of 3-HB in the supernatant of strain XY6 was 1.15μg / mL, indicating that Lactobacillus paracasei XY6 can produce and secrete 3-hydroxybutyrate ( Figure 2 ).

[0057] 3-Hydroxybutyric acid (3-HB) can provide energy for various activities of the body and is a potential energy / functional food. It has been added to athletes' drinks, so the probiotic Lactobacillus paracasei XY6 can be used as an energy additive. At the same time, given that 3-HB can effectively fight osteoporosis, prevent and treat chronic syndromes (hypertension, alcoholic fatty liver, enteritis, and intestinal cancer), improve brain cognitive function (improve learning and memory ability, protect glial cells, and improve Alzheimer's disease), and improve lipid metabolism. The probiotic Lactobacillus paracasei XY6 strain can achieve the above multiple uses by producing 3-hydroxybutyric acid.

[0058] In addition, 3-HB is an endogenous small molecule naturally produced by the body. It plays an important role in maintaining the integrity of colorectal tissues, and has the functions of maintaining intestinal health, preventing colon diseases and reducing inflammation. 3-HB treatment can promote the proliferation of beneficial intestinal bacteria and relieve the symptoms of multiple sclerosis. It has great potential in regulating flora and improving health. Therefore, the probiotic Lactobacillus paracasei XY6 strain can also help improve intestinal flora and relieve intestinal inflammation.

[0059] (2) The fermentation broth of Lactobacillus paracasei XY6 strain can effectively inhibit the activity of α-glucosidase

[0060] The Lactobacillus paracasei XY6 cultured to the stable phase in MRS liquid medium was expanded into a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected when the culture reached the stable phase for 24 hours, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The effect of the fermentation supernatant on the enzymatic activity of α-glucosidase to hydrolyze glucose was then determined using the α-glucosidase inhibitor screening kit (ab284520). The results showed that compared with the blank medium MRS without inhibition, the fermentation supernatant of strain XY6 significantly inhibited the ability of α-glucosidase to hydrolyze glucose, and the inhibition rate was about 57.31%, indicating that the fermentation broth of Lactobacillus paracasei XY6 can effectively inhibit the activity of α-glucosidase ( Figure 3 ).

[0061] α-glucosidase is an enzyme that plays a role in the breakdown of carbohydrates and is associated with type 2 diabetes. Inhibiting α-glucosidase is one of the ways to control postprandial hyperglycemia, thereby contributing to the treatment of diabetes. Therefore, α-glucosidase inhibitors help maintain blood sugar levels and can improve diabetic complications. In addition, inhibiting the activity of α-glucosidase can control obesity.

[0062] Therefore, the probiotic Lactobacillus paracasei strain XY6 has the ability to inhibit α-glucosidase activity, which makes it a potential probiotic for lowering blood sugar and inhibiting obesity.

[0063] (3) Lactobacillus paracasei XY6 strain can inhibit xanthine oxidase (XOD) activity

[0064] The Lactobacillus paracasei XY6 strain cultured in MRS liquid medium to the stable phase was expanded into a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected at 24 hours after the stable phase, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4°C for 10 minutes. The activity of xanthine oxidase in the fermentation supernatant was then determined using a xanthine oxidase activity assay kit (Box Biotechnology, Cat: AKAO006M). The results showed that compared with the blank medium MRS, which had no inhibitory effect on xanthine oxidase activity, the fermentation supernatant of strain XY6 had a significant inhibitory effect on xanthine oxidase activity, with an inhibition rate of 31.33% (*P<0.05), indicating that Lactobacillus paracasei XY6 can produce and secrete metabolites in the stable phase to inhibit the activity of xanthine oxidase (XOD) ( Figure 4 ).

[0065] Xanthine oxidase is a key enzyme in the purine decomposition process, which can catalyze hypoxanthine and xanthine to directly produce uric acid. Therefore, when the activity of xanthine oxidase in the body is abnormally active, it will lead to the production of a large amount of uric acid, thus causing hyperuricemia or gout.

[0066] Xanthine oxidase inhibitors, such as allopurinol, can inhibit the activity of xanthine oxidase, prevent hypoxanthine and xanthine from being metabolized into uric acid, thereby reducing uric acid production and improving gout and hyperuricemia. Xanthine oxidase inhibitors can also reduce the stress response and tissue damage caused by free radicals, and are expected to be used clinically to treat gout and diseases caused by peroxide free radicals. At present, allopurinol is one of the main drugs for the treatment of hyperuricemia and gout, and it is also the only chemical drug that inhibits uric acid production in clinical practice. However, this drug has many side effects, not only causing fever, but also allergic rash, abdominal pain, diarrhea, leukopenia and thrombocytopenia, and multiple organ damage, and even reports of death, and its safety is questioned. Because it has a good inhibitory effect on xanthine oxidase, it has been used to this day. Therefore, it is of great significance to study new low-toxic and efficient xanthine oxidase inhibitors.

[0067] Therefore, the probiotic Lactobacillus paracasei XY6 strain is expected to reduce purine in the body and reduce uric acid production by inhibiting the activity of xanthine oxidase, thereby controlling uric acid levels and preventing gout attacks.

[0068] (4) Lactobacillus paracasei XY6 strain can produce protease

[0069] The ability of Lactobacillus paracasei XY6 to secrete protease to hydrolyze proteins was identified and measured using skim milk plate medium (MP plate) according to the agar well diffusion test. During the test, 3uL of Lactobacillus paracasei XY6 bacterial solution with a concentration of 10Abs was added to the MP plate of the experimental group, and 3uL of blank MRS medium was added to the control group, and the plates were inverted and cultured in a 37°C constant temperature anaerobic incubator for 3 days. The results showed that compared with the control group with blank medium added, strain XY6 could significantly degrade proteins, forming a clear degradation circle ( Figure 5 ), indicating that Lactobacillus paracasei XY6 strain can produce protease that degrades milk protein.

[0070] Lactobacillus paracasei XY6 can produce protease, which can be used as a probiotic strain to promote the digestion and absorption of protein in food by the human body and improve the absorption of small peptides and amino acids. At the same time, it can also be used for anti-allergy (improving food allergies caused by protein indigestion or non-absorption). In addition, it can also be used for the extraction of protease and applied to the production of protease in the washing industry; it can also be used in microbial feed to help animals digest and absorb nutrients and improve the utilization rate of feed.

[0071] (5) Lactobacillus paracasei XY6 strain can produce cellulase

[0072] The ability of Lactobacillus paracasei XY6 to degrade cellulose was identified and determined using cellulose plate medium (MP plate) according to the agar well diffusion method. During the experiment, 3uL of Lactobacillus paracasei XY6 bacterial solution with a concentration of 10Abs was added to the MP plate of the experimental group, and 3uL of blank MRS medium was added to the control group. After inverted culture in a 37°C constant temperature anaerobic incubator for 3 days, Congo red staining was performed. The results showed that compared with the control group with blank culture medium added, strain XY6 could significantly degrade cellulose, forming an obvious degradation circle ( Figure 6 ), indicating that Lactobacillus paracasei XY6 strain can produce cellulase.

[0073] Since Lactobacillus paracasei XY6 strain can produce cellulase, the probiotic Lactobacillus paracasei XY6 strain can play the following multiple roles through the effect of producing cellulase: (1) used to promote digestion and absorption of dietary ingredients; (2) improve constipation, probiotics break down cellulose in the intestine to produce a certain amount of water, which has the effect of softening stool; (3) lowering cholesterol is the most important effect of cellulose, because after being absorbed by the human body, soluble fiber can inhibit the body's absorption of cholesterol, and can combine with cholesterol in the intestine to accelerate the metabolism of cholesterol in the body, prevent the body from inducing hyperlipidemia due to high cholesterol, and can reduce the incidence of arteriosclerosis and coronary heart disease; (4) Cellulose, a non-sweet "sugar", can slow down the blood's absorption of glucose, balance blood sugar concentration, and promote muscle and fat cells' sensitivity to insulin, thereby preventing and assisting in the treatment of diabetes.

[0074] In addition, the Lactobacillus paracasei XY6 strain can also be used for the fermentation and extraction of cellulase; for degrading the cell walls of pathogenic fungi and controlling diseases; for the decomposition of cellulose in compost; and for the preparation of livestock and poultry feed, such as feed for monogastric animals such as pigs and chickens, to overcome their inability to utilize cellulose.

[0075] (6) The fermentation broth of Lactobacillus paracasei XY6 strain can effectively inhibit renin activity

[0076] The Lactobacillus paracasei XY6 cultured in MRS liquid medium to the stable phase was expanded into a new MRS liquid medium at a dilution multiple of 1:30. The bacterial suspension was collected at 24 hours after the stable phase, and the fermentation supernatant was collected after centrifugation at 10,000×g and 4℃ for 10 minutes. The inhibitory ability of the fermentation supernatant on renin was then determined by the renin inhibitor screening kit (KA1361). The results showed that compared with the blank medium MRS without inhibitory effect, the fermentation supernatant of strain XY6 had the ability to inhibit renin, and its inhibition rate was about 11.64% (**P<0.01), indicating that the fermentation broth of Lactobacillus paracasei XY6 can effectively inhibit renin ( Figure 7 ).

[0077] Renin is an approximately 40 kDa aspartic protease that converts angiotensinogen to angiotensin I. Angiotensin-converting enzyme (ACE) is a monomeric zinc metalloenzyme found in the vascular endothelium that converts angiotensin I to angiotensin II, the final active messenger of the renin-angiotensin system (RAS) pathway. Angiotensin II can inhibit renin secretion by acting directly on juxtaglomerular cells. Angiotensin II has many physiological effects, the most important of which is that it can act as a powerful vasoconstrictor, increasing blood pressure by changing peripheral vascular resistance. Since angiotensinogen is the only known substrate of renin, cleavage of angiotensinogen by renin is key to affecting the final activity of the RAS pathway, and renin inhibition would be an attractive strategy for controlling hypertension. In addition, renin inhibitors can prevent the formation of angiotensin I and angiotensin. Therefore, renin inhibitors can be used to prevent and treat hypertension and other cardiovascular and renal diseases by inhibiting the activity of renin.

[0078] It can be seen that the probiotic Lactobacillus paracasei XY6 strain has the ability to inhibit renin, which makes it a potential probiotic for lowering blood pressure and protecting the kidneys.

[0079] In summary, the newly isolated Lactobacillus paracasei XY6 strain of the present invention has multiple probiotic effects: (1) can produce and secrete 3-hydroxybutyric acid; (2) can inhibit α-glucosidase activity; (3) can inhibit xanthine oxidase activity; (4) has excellent protease activity; (5) has excellent cellulase activity; (6) can inhibit renin activity. It can be seen that the newly isolated Lactobacillus paracasei XY6 strain of the present invention has important application value and economic value in the fields of gastrointestinal conditioning and weight loss.

[0080] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. A strain of Lactobacillus paracasei XY6, characterized in that The Lactobacillus paracasei XY6 strain was deposited in the China Center for Type Culture Collection on September 27, 2023, with the accession number: CCTCCNO:M 20221501; the complete 16S rDNA sequence of the Lactobacillus paracasei XY6 strain is shown in SEQ ID No:

1.

2. Application of Lactobacillus paracasei XY6 strain according to claim 1 in the preparation of renin inhibitors.

3. Application of the Lactobacillus paracasei XY6 strain according to claim 1 in producing 3-hydroxybutyric acid.

4. Use of the Lacticaseibacillus paracasei XY6 strain according to claim 1 in the preparation of alpha-glucosidase inhibitors.

5. Use of the Lacticaseibacillus paracasei XY6 strain according to claim 1 in the preparation of xanthine oxidase inhibitors.

6. Use of the Lactobacillus paracasei XY6 strain according to claim 1 in producing a protease for degrading milk protein.

7. Use of the Lactobacillus paracasei XY6 strain according to claim 1 in producing cellulase.

8. A bacterial agent with probiotic function, characterized in that: The bacterial agent comprises the Lactobacillus paracasei XY6 strain according to claim 1.

Images