Application of ghr-miR398 in regulating cotton resistance to Fusarium wilt

Abstract

The present invention discloses the application of ghr-miR398 in regulating the resistance of cotton to wilt. It belongs to the field of genetic engineering technology. The present invention isolates cotton ghr-miR398, and the study on its function shows that the precursor sequence pre-ghr-miR398 of overexpression ghr-miR398 can improve the resistance of cotton to wilt, and the silencing of ghr-miR398 by short tandem repeat sequence STTM can reduce the resistance of cotton to wilt, and ghr-miR398 inhibits the growth and development of mycelium by affecting the expression of FoGAL gene in cotton wilt pathogen, thereby reducing the infection ability of wilt pathogen. This discovery reveals the molecular mechanism of ghr-miR398 in regulating cotton resistance to wilt, and provides a new theoretical basis and practical direction for guiding cotton disease resistance genetic breeding and cultivation using modern biotechnology, and thus has relatively important practical value.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and more specifically to the application of ghr-miR398 in regulating cotton resistance to wilt disease. Background Art

[0002] Cotton is an important economic crop. However, cotton is often threatened by a variety of diseases caused by fungal pathogens during its cultivation. Fusarium wilt is one of the most harmful diseases in cotton production, and is known as the "cancer" of cotton together with Verticillium wilt. At present, chemical methods are mostly used to prevent and control Fusarium wilt, which not only has poor control effects, but also causes serious environmental pollution. Therefore, how to effectively improve cotton's resistance to Fusarium wilt and explore new strategies for preventing and controlling Fusarium wilt have always been important issues that need to be solved for the healthy development of the cotton industry.

[0003] MicroRNAs (miRNAs) play an important role in regulating plant immune responses and are often considered to be "master regulators" for fine regulation of plant gene expression. miRNAs are a class of evolutionarily conserved, non-coding small RNAs with regulatory functions, with a length of about 18 to 24 nucleotides. miRNAs bind to target gene mRNAs in a complementary base pairing manner, mediating the degradation or translation inhibition of target gene mRNAs, thereby playing an important regulatory role in gene expression at the post-transcriptional level. ath-miR393 in Arabidopsis is the first miRNA reported to regulate immune responses in plants. ath-miR393 can be induced to express by the flagellin flg22 of Pseudomonas syringae. This miRNA inhibits auxin signal transduction by promoting the degradation of mRNAs of genes such as auxin receptors TIR1, AFB2, and AFB3, thereby limiting the growth of Pseudomonas syringae and improving plant disease resistance. In rice, miR395 promotes sulfate accumulation by inhibiting the expression of rice sulfate assimilation-related gene (OsAPS1) and two sulfate transporter genes (OsSULTR2.1 and OsSULTR2.2), thus making rice broad-spectrum resistant to bacterial pathogens. The above studies show that miRNAs are key regulators of plant immune responses and have great research and application value. Analyzing the molecular mechanism of miRNAs regulating immune responses has become a hot issue in the field of plant disease resistance research.

[0004] miRNAs regulate gene expression mainly by cutting target gene mRNA. Further studies have found that miRNAs can not only play a role within organisms, but also are important signals and regulatory factors for communication between species. The regulation of post-transcriptional levels between species mediated by miRNAs is called miRNA-mediated cross-kingdom RNA interference or cross-kingdom gene silencing. Pathogenic microorganisms can improve their own infection ability and toxicity by exporting miRNA-like (milRNA) to host plants. Studies have found that after wheat stripe rust (Puccinia striiformis f.sp. Tritici, Pst) infects wheat, it can export its own milRNA1 (pst-milRNA1) into wheat. Pst-milRNA1 will cause the silencing of the key disease resistance gene PR2 in wheat, thereby reducing wheat's resistance to stripe rust. In cotton, miR166 and miR159 can be exported into Verticillium dahliae, mediating cross-kingdom gene silencing of the key pathogenic genes Clp-1 and HiC-15 of Verticillium dahliae, thereby reducing the infection ability of Verticillium dahliae and improving the disease resistance of cotton.

[0005] In summary, miRNAs-mediated cross-kingdom gene silencing has been considered a key regulatory mechanism in the process of plant-pathogen interaction. Screening the key miRNAs that regulate cotton resistance to Fusarium wilt and clarifying their molecular mechanisms for regulating cotton disease resistance have important theoretical significance and practical value for guiding cotton genetic breeding and cultivation using modern biotechnology. Currently, most of the research on miRNAs is based on sRNA sequencing, and there is little research on the molecular mechanism and application of a certain miRNA regulating plant immune response.

[0006] In summary, how to provide a miRNA that regulates cotton wilt is an urgent problem that needs to be solved by those skilled in the art. Summary of the invention

[0007] In view of this, the present invention provides the use of ghr-miR398 in regulating cotton resistance to Fusarium wilt.

[0008] In order to achieve the above object, the present invention adopts the following technical solution:

[0009] Application of ghr-miR398 in regulating cotton resistance to Fusarium wilt, the nucleotide sequence of ghr-miR398 is as follows:

[0010] UGUGUUCUCAGGUCACCCCUU, SEQ ID NO.1.

[0011] Furthermore, the resistance of cotton to Fusarium wilt was improved by overexpressing ghr-miR398.

[0012] Furthermore, overexpression of ghr-miR398 was achieved by overexpressing the precursor sequence of ghr-miR398, pre-ghr-miR398;

[0013] The nucleotide sequence of the precursor sequence pre-ghr-miR398 of ghr-miR398 is as follows:

[0014] GCCAAGATGGTTTACCCCAGAGGGGTGCCACCTAAGAACACAGGTCATCCCTTAACCAAATAGCTTGTGTTCTCAGGTCACCCCTTTGGGGTACATATATCTTCGCCATTCCCTTTTGTTTGC, SEQ ID NO. 2.

[0015] Furthermore, the pathogenic bacteria of the wilt disease is Fusarium oxysporum.

[0016] Furthermore, ghr-miR398 reduced the infection ability of Fusarium oxysporum by inhibiting the expression of FoGAL gene in Fusarium oxysporum;

[0017] The nucleotide sequence of the FoGAL gene is shown in SEQ ID NO.3;

[0018]

[0019] Application of ghr-miR398 in cotton breeding.

[0020] Furthermore, the cotton breeding includes breeding cotton varieties resistant to Fusarium wilt.

[0021] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects achieved by the present invention are:

[0022] The present invention isolates cotton ghr-miR398, and studies on its function show that overexpression of the precursor sequence pre-ghr-miR398 of ghr-miR398 can improve cotton resistance to wilt, silencing ghr-miR398 through the short tandem repeat sequence STTM can reduce cotton resistance to wilt, and ghr-miR398 inhibits the growth and development of hyphae by affecting the expression of FoGAL gene in cotton wilt pathogens, thereby reducing the infection ability of wilt pathogens. This discovery reveals the molecular mechanism of ghr-miR398 participating in regulating cotton resistance to wilt, provides a new theoretical basis and practical direction for guiding cotton disease resistance genetic breeding and cultivation using modern biotechnology, and thus has relatively important practical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0024] Figure 1 The secondary structure diagram of the precursor sequence pre-ghr-miR398 of cotton ghr-miR398 in Example 1 of the present invention;

[0025] Figure 2 PCR amplification diagram of the nucleotide fragment of the precursor sequence pre-ghr-miR398 in Example 1 of the present invention, wherein M is DL2000 DNA Marker; 1-2 are nucleotide fragments of the precursor sequence pre-ghr-miR398;

[0026] Figure 3 This is a PCR amplification diagram of the short tandem repeat sequence STTM nucleotide fragment of ghr-miR398 in Example 2 of the present invention, wherein M is DL2000 DNA Marker; 1-2 are the short tandem repeat sequence STTM nucleotide fragments of ghr-miR398;

[0027] Figure 4The effect of the ghr-miR398 overexpression cotton on the resistance to wilt disease of the present invention, wherein A is the typical trait of the ghr-miR398 overexpression cotton after inoculation with wilt pathogen in Example 4; B is the identification of cotton by RT-qPCR in Example 3 (red and green are two parallels); C is the biomass of pathogens in the ghr-miR398 overexpression cotton after inoculation with wilt pathogen in Example 4; CRV::00 represents the empty vector control cotton; CRV::miR398 represents the cotton strain overexpressing ghr-miR398;

[0028] Figure 5 The effect of silencing ghr-miR398 cotton on resistance to wilt disease of the present invention, wherein A is a typical trait of silencing ghr-miR398 cotton after inoculation with wilt pathogen in Example 5; B is the identification of cotton by RT-qPCR in Example 3 (red and green are two parallels); C is the biomass of pathogens in silencing ghr-miR398 cotton after inoculation with wilt pathogen in Example 5; CRV::00 represents an empty vector control cotton strain; CRV::miR398-STTM represents a ghr-miR398-silenced cotton strain;

[0029] Figure 6 The cotton ghr-miR398 in Example 6 of the present invention is induced and exported to the fungal hyphae after infection with Fusarium wilt, wherein A is the growth of the hyphae after cotton Fusarium wilt (Fov) infects cotton; B is the detection of the expression level of ghr-miR398 by RT-qPCR, Fov cotton Representative fungal hyphae recovered from cotton infected with Fov. WT represents the Fov hyphae cultured in vitro;

[0030] Figure 7 In Example 6 of the present invention, cotton ghr-miR398 targets the FoGAL gene in cotton wilt pathogen (Fov) to improve cotton disease resistance, wherein A is the identification of the expression level of the ghr-miR398 target gene FoGAL by RT-qPCR; B is the luciferase complementary imaging experiment to verify the cleavage site of ghr-miR398 and FoGAL; C is the expression level of FoGAL in FoGAL after knocking out FoGAL. gal Growth of mycelium on PDA medium; D is Fov gal Typical properties of cotton after inoculation with spore suspension; E is the biomass of pathogens in cotton after inoculation with different wilt pathogens; F is the determination of electrical conductivity of cotton after inoculation with different wilt pathogens; Fov WT represents the wild type of Fusarium wilt; Fov cotton represents hyphae recovered from cotton infected with Fusarium wilt; Fov gal represents the Fusarium wilt fungus with the FoGAL gene knocked out;

[0031] Figure 8 The overexpression of cotton ghr-miR398 in Fusarium wilt pathogenicity is shown in Example 7 of the present invention, wherein A is the number of Fov miR398-OE Growth of mycelium on PDA medium; B is Fov miR398-OE Typical properties of cotton after inoculation with spore suspension; C is the biomass of pathogens in cotton after inoculation with different wilt pathogens; D is the determination of electrical conductivity of cotton after inoculation with different wilt pathogens; Fov WT represents the wild type of Fusarium wilt; Fov miR398-OE represents Fusarium wilt fungus overexpressing cotton ghr-miR398;

[0032] Fig. 9 This is an analysis of the application potential of ghr-miR398 in different resistant varieties verified in Example 8 of the present invention, wherein A is a typical trait of different resistant varieties of cotton after inoculation with Fusarium wilt; B is the identification of the expression level of ghr-miR398 in different varieties of cotton by RT-qPCR; C is the biomass of the pathogen in different varieties of cotton after inoculation with Fusarium wilt; D is the correlation analysis between the expression level of ghr-miR398 and the biomass of the pathogen in different varieties of cotton. DETAILED DESCRIPTION

[0033] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] The reagents required in the embodiments of the present invention are all conventional experimental reagents, purchased from conventional biochemical reagent stores, such as:

[0035] Various restriction enzymes, including BcuI and PacI;

[0036] Various antibiotics, including ampicillin, kanamycin, rifampicin, acetosyringone (AS), MES.

[0037] Various biochemical kits, such as reverse transcription kit, plasmid extraction kit and agarose gel recovery kit, were purchased from Magen Biotechnology Company.

[0038] Taq DNA polymerase and DNA molecular standard marker were purchased from Quanshijin and Takara.

[0039] MS medium, agar, sucrose, and NaCl were purchased from Qingdao Haibo Biological Company.

[0040] The experimental methods not mentioned in the examples are conventional experimental methods and will not be described in detail here.

[0041] The plant materials selected in the present invention are: China Cotton Research Institute 29 (Lu Zhong Shen Zi No. 0254), Shi Kang 126 (National Cotton 2008002), China Cotton Research Institute 35 (National Cotton 990005), Xipu 6 (Hebei Cotton 2010007), and Shandong Cotton Research Institute 22 (Lu Agricultural Research Zi

[2005] No. 027).

[0042] The cotton wilt pathogen used in the present invention is Fusarium oxysporum f. sp vasinfectum.

[0043] Example 1

[0044] Construction of plant overexpression vector pCLCrV-A-pre398

[0045] 1) Primer design of pre-ghr-miR398 sequence

[0046] The nucleotide sequence of ghr-miR398 is as follows:

[0047] UGUGUUCUCAGGUCACCCCUU, SEQ ID NO.1.

[0048] The nucleotide sequence of the precursor sequence of ghr-miR398, pre-ghr-miR398, is as follows:

[0049] GCCAAGATGGTTTACCCCAGAGGGGTGCCACCTAAGAACACAGGTCATCCCTTAACCAAATAGCTTGTGTTCTCAGGTCACCCCTTTGGGGTACATATATCTTCGCCATTCCCTTTTGTTTGC, SEQ ID NO. 2.

[0050] After analysis, the precursor sequence pre-ghr-miR398 ( Figure 1 ) 20 bp and 21 bp were selected upstream and downstream respectively, that is, the sequence used to design the primers was the gene fragment containing the precursor sequence pre-ghr-miR398, with a size of 123 bp.

[0051] pre-ghr-miR398-F: 5'-ACTAGTGCCAAGATGGTTTACCCCAG-3', SEQ ID NO.4;

[0052] pre-ghr-miR398-R: 5'-TTAATTAAGCAAACAAAAGGGAATGGCGA-3', SEQ ID NO.5.

[0053] 2) Cloning of pre-ghr-miR398

[0054] Specific PCR primers (pre-ghr-miR398-F and pre-ghr-miR398-R) were used for amplification. The PCR amplification product was detected using a 1.5% agarose gel, and a single band of about 123 bp at the target position was obtained ( Figure 2 ).

[0055] Use gel recovery kit to recover the target fragment, and connect the recovered target fragment into T vector (pMD19-T vector). Transform 5 µL of the ligation product into 50 µL of E. coli DH5α competent cells. After culturing in LB liquid medium, centrifuge the bacterial liquid and apply it to LB solid medium containing ampicillin for resistance screening. Use universal primer M13 to perform colony PCR verification of resistant monoclonal clones.

[0056] The PCR product was sent to Shanghai Bioengineering for sequencing. The nucleotide sequence of the sequencing result is shown in SEQ ID NO.2.

[0057] 3) Construction of cotton ghr-miR398 plant overexpression vector

[0058] The obtained pre-ghr-miR398 fragment was used as a template and amplified using specific PCR primers (pre-ghr-miR398-F and pre-ghr-miR398-R). After agarose gel electrophoresis, the target fragment was recovered by gel recovery, and the recovered fragment was connected to the T vector (pMD19-T vector) and transformed into Escherichia coli competent cells. The Escherichia coli bacterial liquid plasmid containing the pre-ghr-miR398 target fragment obtained above was extracted using a plasmid extraction kit. The pCLCrV-A expression vector was selected, and the vector and plasmid were subjected to double restriction digestion reaction. The pre-ghr-miR398 fragment digestion product and the vector digestion product were recovered, and the vector and the target fragment were connected using T4 DNA ligase. The ligation product was transformed into Escherichia coli DH5α competent cells. The bacterial liquid was applied to LB solid medium containing kanamycin, and a single clone was picked and identified by colony PCR. Pick 5 positive clones for sequencing and inoculate them into 10 mL LB liquid culture medium containing kanamycin resistance for shaking. Finally, extract the plasmid of the bacterial liquid with correct sequencing and store it at -20℃ for future use.

[0059] Example 2

[0060] Construction of cotton ghr-miR398 plant silencing vector pCLCrV-A-STTM398

[0061] According to the ghr-miR398 sequence, a short tandem repeat sequence (STTM, AAGGGGTGACCTCTAGAGAACACAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATAAGGGGTGACCTCTAGAGAACACA, SEQ ID NO.6) was designed, and the STTM-ghr-miR398 fragment was synthesized by Shanghai Bioengineering ( Figure 3 ). Select the pCLCrV-A expression vector and perform restriction digestion on the vector. Recover the vector digest and connect the vector to STTM-ghr-miR398 using T4 DNA ligase. Transform the ligation product into E. coli DH5α competent cells. Apply the bacterial solution to LB solid medium containing kanamycin, pick single clones and perform colony PCR identification. Pick 5 positive single clones for sequencing and inoculate them into 10 mL LB liquid medium containing kanamycin resistance and shake the bacteria. Finally, extract the correct bacterial solution plasmid and store it at -20℃ for future use.

[0062] Example 3

[0063] Transformation and identification of cotton using virus-mediated gene transformation technology

[0064] 1) Prepare cotton seedlings. Wash the surface of cotton seeds and place them in wet gauze for germination. Move the germinated cotton seedlings into nutrient soil for greenhouse cultivation under the conditions of 16 hours of light, 8 hours of darkness, 60-75% humidity, and 27°C temperature. After about 7 days of cultivation, select cotton seedlings of the same size for infection.

[0065] 2) Transform Agrobacterium. Add 2 µL of the positive plasmid of the overexpression vector pCLCrV-A-pre398 or the silencing vector pCLCrV-A-STTM398 to 100 µL of EHA105 Agrobacterium competent cells stored at -80°C. After transformation, add 1 mL of LB liquid culture medium and culture at 28°C and 200 rpm for 1~2 hours for activation. The activated Agrobacterium is cultured on LB solid culture medium containing kanamycin. Pick a single colony from the plate culture medium and inoculate it into LB liquid culture medium containing kanamycin. Culture it at 28°C and 200 rpm for 16 hours. Use cloning primers to perform PCR identification of the bacterial solution. The positive clone bacterial solution is stored at -20°C for later use. Take 200 μL of the Agrobacterium bacterial solution containing the target gene and add it to 10 mL of liquid LB culture medium containing rifampicin (50 mg / L) and kanamycin (50 mg / L). Culture it at 28°C and 220 rpm for 12~24 hours until the OD600 =0.6~0.8.

[0066] 3) Take 2 mL of activated Agrobacterium and add it to 50 mL of liquid LB medium containing rifampicin (50 mg / L), kanamycin (50 mg / L), MES (150 mg / L) and AS (40 mg / L), and culture at 28°C and 220 rpm for 4-6 h.

[0067] 4) Place the bacterial suspension into a sterilized 50 mL centrifuge tube and centrifuge at room temperature at 2000 rpm for 5 min. Discard the supernatant and add an appropriate amount of permeabilization solution (containing 10 mM MgCl2, 150 mg / L MES, 40 mg / L AS) to a concentration of OD 600 =0.8, and let stand at room temperature for 3h.

[0068] 5) Use a disposable syringe without a needle to inject the bacterial solution into the plants and incubate in the dark at 27°C for 6 hours.

[0069] 6) After dark culture, the plants are transferred to normal greenhouse conditions for culture.

[0070] 7) Identification of cotton strains

[0071] 21 days after cotton was infected with the overexpression vector pCLCrV-A-pre398 or the silencing vector pCLCrV-A-STTM398, RT-qPCR was used to identify the cotton.

[0072] Using RT-qPCR technology, with cotton empty vector CRV::00 as control, the expression level of ghr-miR398 in the overexpression ghr-miR398 strain was detected, and the ghr-miR398 in the detected strains was significantly higher than that in the control cotton. Using RT-qPCR technology, with cotton empty vector CRV::00 as control, the expression level of ghr-miR398 in the silenced ghr-miR398 strain was detected, and the ghr-miR398 in the detected strains was significantly lower than that in the control cotton. The results show that the present invention successfully obtained cotton strains that overexpress and silence ghr-miR398. Results are shown in Figure 4 Medium B and Figure 5 Middle B.

[0073] Example 4

[0074] Resistance analysis of cotton plants overexpressing ghr-miR398

[0075] In order to clarify the biological function of ghr-miR398, cotton overexpressing ghr-miR398 was inoculated with cotton wilt pathogen using the root infection method. First, the cotton wilt pathogen was inoculated on a PDA plate and incubated inverted at 28°C in the dark for 28 days. Then, 10 mL of MgCl2 solution (10 mM) was added to the cotton wilt pathogen culture medium. The bacteria on the surface of the culture medium were carefully scraped with a blade and filtered through four layers of gauze to obtain a crude spore suspension extract. After counting under a microscope, the spores were diluted to 10 with MgCl2 solution (10 mM). 6 / mL for later use. Use the spore suspension of Fusarium wilt (10 6 / mL) was used to irrigate the roots of overexpressed ghr-miR398 cotton and control seedlings after root injury. The disease of cotton was observed 5 days after inoculation. Figure 4 As shown in Figure A, the cotton strain overexpressing ghr-miR398 (CRV::miR398) is significantly more resistant to Fusarium wilt than the control cotton (CRV::00). In order to better indicate the degree of infection of Fusarium wilt on cotton, the present invention detected the biomass of Fusarium wilt in the cotton leaves after infection. In the cotton overexpressing ghr-miR398, the biomass of Fusarium wilt was significantly lower than that of the control cotton ( Figure 4 The above results indicate that overexpression of ghr-miR398 improves cotton resistance to Fusarium wilt.

[0076] Example 5

[0077] Resistance analysis of cotton plants with silencing ghr-miR398

[0078] In order to further clarify the biological function of ghr-miR398, cotton with silenced ghr-miR398 was inoculated with cotton wilt pathogen using the root infection method, the method was the same as Example 4. Figure 5 As shown in Figure A, the resistance of the cotton line with silenced ghr-miR398 (CRV::miR398-STTM) to Fusarium wilt is significantly lower than that of the control cotton (CRV::00). In order to better indicate the degree of infection of Fusarium wilt to cotton, the present invention detected the biomass of Fusarium wilt in the cotton leaves after infection. In the cotton with silenced ghr-miR398, the biomass of Fusarium wilt was significantly higher than that of the control cotton ( Figure 5 The above results indicate that silencing ghr-miR398 reduces cotton resistance to Fusarium wilt.

[0079] Example 6

[0080] ghr-miR398 inhibits the growth and development of mycelium by affecting the expression of FoGAL gene in cotton wilt pathogen, thereby reducing the infection ability of wilt pathogen

[0081] To determine whether ghr-miR398 in cotton is transported to Fusarium wilt pathogen (Fov), e.g. Figure 6 As shown in A, the present invention recovers fungal hyphae (Fov cotton ), RT-qPCR was used to detect the expression level of ghr-miR398 in fungi ( Figure 6 Middle B). ghr-miR398 in Fov cotton The expression level in Fov was significantly higher than that in Fov cultured in vitro. WT ) strain.

[0082] The present invention uses strict microRNA target gene prediction software to predict the potential target genes of ghr-miR398 in Fusarium wilt pathogen based on the base complementarity between miRNA and target gene. Subsequently, RT-qPCR is used to detect the expression level of the predicted target gene. The results show that compared with the in vitro cultured Fov strain (Fov WT ) compared to Fov cotton The transcription level of FoGAL (XM_031172360) was significantly decreased in Figure 7 In order to test whether ghr-miR398 can cut FoGAL mRNA, the present invention inserted the cutting site of FoGAL mRNA into pGreenII 0800-LUC vector and transformed it and pre-ghr-miR398 into GV3101 Agrobacterium competent cells respectively. Agrobacterium was injected into 6-week-old tobacco leaves by Agrobacterium-mediated transient infection. After 60 h of inoculation, fluorescence signal was detected at the site of transformation of recombinant vector, while no fluorescence was detected at the site of co-transformation of ghr-miR398 and recombinant vector ( Figure 7 In order to clarify whether the target gene FoGAL of ghr-miR398 is essential for the pathogenicity and growth and development of Fusarium wilt, the present invention uses PEG-mediated protoplast transformation to obtain the FoGAL knockout mutant FoV gal .like Figure 7 As shown in C, on PDA medium, compared with the control strain that produced a large number of hyphae, Fo gal The colony growth rate of the mutant was significantly reduced. In addition, after 10 days of culture in PDA, the Fov WT The hyphae diameter was about twice that of the mutant strain, and the Fov gal The pigment produced by the mutant changes from normal white to red. gal Mutants and Fov WT 5 days after the cotton plants were infected with the spore suspension of WT Plants inoculated with Fov galThe mutant strain showed much milder symptoms of cotton wilt ( Figure 7 In order to further describe the infection degree of the two Fov strains on cotton leaves, the present invention detected the biomass of Fusarium wilt in the cotton leaves after infection. Figure 7 As shown in E, the infection Fov WT Compared with cotton plants inoculated with Fov gal The biomass of fungi in plants with mutant strains was significantly reduced. The present invention uses the electrical conductivity of leaves to assess the degree of cell rupture or leaf damage to detect the degree of damage of the two strains to cotton plants, which is consistent with Fovi WT Compared with cotton infected with Fov gal The conductivity of cotton with the strain spore suspension was significantly reduced ( Figure 7 The above results indicate that ghr-miR398 inhibits the growth and development of mycelium by reducing the expression of FoGAL, thereby affecting the disease resistance of cotton to Fusarium wilt.

[0083] Example 7

[0084] Overexpression of ghr-mir398 inhibits the growth and development of cotton wilt pathogen and reduces its infection ability

[0085] In order to more fully demonstrate the function of ghr-miR398, the present invention uses PEG-mediated protoplast transformation to overexpress ghr-miR398 in Fov miR398-OE ).like Figure 8 As shown in A, on PDA medium, with Fov WT In comparison, Fov miR398-OE The mycelial growth rate is reduced. Then the Fov miR398-OE and Fov WT After the cotton plants were infected with the spore suspension for 5 days, they were inoculated with Fov WT In contrast, cotton plants inoculated with Fov miR398-OE The wilt symptoms of cotton plants with the strain were much milder ( Figure 8 Middle B). Pathogen biomass analysis showed that the WT Compared with the strains, the miR398-OE The number of plant pathogens in the strains was significantly reduced ( Figure 8 The present invention uses the conductivity of leaves to evaluate the degree of cell rupture or leaf damage to detect the infection degree of the two strains on cotton plants, which is similar to that of cotton plants inoculated with Fov WT Compared with cotton inoculated with Fov miR398-OE The electrical conductivity of cotton leaves in the strain was significantly decreased ( Figure 8The above results indicate that the infection ability of Fusarium oxysporum overexpressing ghr-mir398 is weakened.

[0086] Example 8

[0087] Application of ghr-miR398 in breeding cotton varieties resistant to Fusarium wilt

[0088] In order to clarify the biological function of ghr-miR398, the present invention used five common cotton cultivars (such as Zhongmian Institute 29 (Luzhong Shenzi No. 0254) (resistant to Fusarium wilt), Shikang 126 (Guo Shenmian 2008002) (highly resistant to Fusarium wilt), Zhongmian Institute 35 (Guo Shenmian 990005) (highly resistant to Fusarium wilt), Xipu 6 (Ji Shenmian 2010007) (highly resistant to Fusarium wilt), Lumianyan 22 (Lu Nong Shenzi

[2005] No. 027) (resistant to Fusarium wilt)) to inoculate cotton wilt pathogens. The results are as follows. Fig. 9 As shown in A, different cotton varieties have different resistance to cotton wilt. The resistance of cotton varieties 'Shikang 126' and 'Xipu 6' to wilt is higher than that of other cotton varieties ('Zhongmian 29', 'Zhongmian 35', 'Lumianyan 22'). In order to further clarify the application value of ghr-miR398 in improving cotton disease resistance, RT-qPCR was used to detect the expression levels of ghr-miR398 in different varieties of cotton after inoculation. Fig. 9 As shown in Figure B, the expression level of ghr-miR398 in the highly resistant cotton variety 'Xipu 6' is significantly higher than that in other tested cotton varieties. In order to better indicate the degree of infection of cotton with Fusarium wilt, the present invention detected the biomass of Fusarium wilt in leaves of different cotton varieties after infection with Fusarium wilt. The results showed that the accumulated biomass of Fusarium wilt in cotton varieties with high expression levels of ghr-mir398 was significantly reduced after inoculation with Fusarium wilt ( Fig. 9 Middle C). Correlation analysis showed that the expression level of ghr-miR398 was significantly positively correlated with cotton resistance to Fusarium wilt ( Fig. 9 The above results show that if this miRNA function is applied to the breeding of new cotton varieties, it can improve the resistance of cotton to Fusarium wilt and has potential application value in improving the disease resistance of cotton.

[0089] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0090] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of ghr-miR398 in regulating cotton resistance to Fusarium wilt, characterized in that: The nucleotide sequence of ghr-miR398 is as follows: UGUGUUCUCAGGUCACCCCUU, SEQ ID NO.1; Improving cotton resistance to Fusarium wilt by overexpressing ghr-miR398; The pathogenic bacteria of the wilt disease is Fusarium oxysporum; ghr-miR398 reduces the infection ability of cotton wilt pathogen by inhibiting the expression of FoGAL gene; The nucleotide sequence of the FoGAL gene is shown in SEQ ID NO.

3.

2. The use according to claim 1, characterized in that Overexpression of ghr-miR398 was achieved by overexpressing the precursor sequence of ghr-miR398, pre-ghr-miR398; The nucleotide sequence of the precursor sequence pre-ghr-miR398 of ghr-miR398 is as follows: GCCAAGATGGTTTACCCCAGAGGGGTGCCACCTAAGAACACAGGTC ATCCCTTAACCAAATAGCTTGTGTTCTCAGGTCACCCCTTTGGGGTACATA TATCTTCGCCATTCCCTTTTGTTTGC, SEQ ID NO. 2.

Images