Application of SlCRY1a gene in improving salt stress resistance of tomato

Abstract

The present invention belongs to the field of modern agricultural industry, and specifically relates to SlCRY1a The invention uses a gene to improve the salt stress resistance of tomatoes. SlCRY1a The results showed that salt stress can significantly induce SlCRY1a transcription, and under salt stress SlCRY1a Overexpression can increase the accumulation of tomato biomass, increase the chlorophyll fluorescence content of leaves, reduce the relative conductivity content of leaves and reduce the accumulation of reactive oxygen, thereby improving the tolerance of tomatoes to salt stress. The present invention provides gene resources for breeding new salt-tolerant tomato varieties in the modern agricultural industry, has good potential application value, and lays a theoretical foundation for studying the mechanism of tomato plants responding to adverse signals and the molecular mechanism of responding to complex and changeable environmental factors.

Description

Technical Field

[0001] The present invention belongs to the field of modern agricultural industry, and specifically relates to SlCRY1a Application of genes in improving salt stress resistance in tomato. Background Art

[0002] tomato( Solanum lycopersicum L.) is one of the most popular vegetable crops in China. It has important economic and nutritional value. Its fruits are rich in nutrients such as lycopene, sugar, organic acid, vitamins (A, B1, B2, B6, C, E), minerals (potassium, calcium, phosphorus, iron and zinc). my country is the world's largest tomato producer. According to statistics, in 2022, the number of processed tomatoes in my country has reached 6.2 million tons. By 2023, this figure has jumped to 8 million tons, of which the area of ​​greenhouse tomato cultivation accounts for 57.2% of the total area of ​​tomatoes. With the continuous expansion of the demand for tomatoes, tomatoes have been cultivated continuously in facilities for many years, accompanied by unreasonable use of fertilizers and unreasonable irrigation measures, resulting in increasingly serious salinization of facility soil, which greatly restricts the growth of tomatoes, reduces the yield and quality of tomatoes, and causes significant economic losses. Facility soil salinization has become one of the bottleneck problems restricting the development of facility tomato production in my country. Therefore, it is urgent to explore the response mechanism of tomatoes to salt stress and find the key genes that improve tomato salt stress resistance. This has important theoretical and practical significance for improving tomato resistance, reducing the harm of salt stress, promoting the sustainable and healthy development of my country's facility agriculture, helping farmers increase their income and revitalizing the countryside. Summary of the invention

[0003] The first aspect of the present invention aims to provide an overexpression SlCRY1a Application of genes in improving salt stress resistance in tomato.

[0004] The object of the second aspect of the present invention is to provide application of b1) to b3) in at least one of c1) to c4).

[0005] The third aspect of the present invention aims to provide a use of a SlCRY1a protein inhibitor in at least one of d1) to d4).

[0006] The fourth aspect of the present invention aims to provide a method comprising the step of reducing the expression level and / or activity of SlCRY1a protein in tomatoes.

[0007] The fifth aspect of the present invention aims to provide a method comprising the step of increasing the expression level and / or activity of the SlCRY1a protein in tomatoes.

[0008] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0009] In a first aspect of the present invention, there is provided an overexpression SlCRY1a Application of genes in improving salt stress resistance in tomato.

[0010] Said SlCRY1a The amino acid sequence of the protein is shown in SEQ ID NO:2.

[0011] Said SlCRY1a The gene is any nucleotide sequence from a1) to a4):

[0012] a1) the nucleotide sequence shown in SEQ ID NO: 1;

[0013] a2) a nucleotide sequence encoding the same protein, wherein the nucleotide sequence shown in SEQ ID NO: 1 is replaced, deleted and / or one or more nucleotides are added without changing the function of the original nucleotide sequence;

[0014] a3) a nucleotide sequence that can hybridize with the sequence shown in SEQ ID NO: 1 and has the same function;

[0015] a4) is a nucleotide sequence that has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with any of the sequences a1), a2), or a3) and encodes a protein with the same function.

[0016] Preferably, the hybridization conditions are hybridization at 65° C. in a 0.1×SSPE solution containing 0.1 wt % SDS or a 0.1×SSC solution containing 0.1 wt % SDS, and the membrane is washed with the solution.

[0017] The second aspect of the present invention provides the use of b1) to b3) in at least one of c1) to c4):

[0018] b1) SlCRY1a protein;

[0019] b2) biological materials related to SlCRY1a protein;

[0020] b3) An agent that targets and upregulates the expression of SlCRY1a protein and / or enhances the activity of SlCRY1a protein.

[0021] c1) Improve salt stress resistance of tomatoes;

[0022] c2) Cultivating tomato varieties;

[0023] c3) preparing a product for improving salt stress resistance of tomatoes;

[0024] c4) preparing products of cultivated tomato varieties.

[0025] Preferably, the biomaterial comprises at least one of d1) to d12):

[0026] d1) a nucleic acid molecule encoding a S1CRY1a protein;

[0027] d2) an expression cassette containing the nucleic acid molecule described in d1);

[0028] d3) a recombinant vector containing the nucleic acid molecule described in d1);

[0029] d4) a recombinant vector containing the expression cassette described in d2);

[0030] d5) a recombinant cell containing the nucleic acid molecule described in d1);

[0031] d6) a recombinant cell containing the expression cassette described in d2);

[0032] d7) a recombinant cell containing the recombinant vector described in d3);

[0033] d8) a recombinant cell containing the recombinant vector described in d4);

[0034] d9) a recombinant microorganism containing the nucleic acid molecule described in d1);

[0035] d10) a recombinant microorganism containing the expression cassette described in d2);

[0036] d11) a recombinant microorganism containing the recombinant vector described in d3);

[0037] d12) A recombinant microorganism containing the recombinant vector described in d4).

[0038] Preferably, the tomato variety comprises the following characteristics: improved resistance to salt stress.

[0039] Preferably, the recombinant cell comprises Escherichia coli.

[0040] Preferably, the recombinant microorganism comprises Agrobacterium.

[0041] The third aspect of the present invention provides the use of a SlCRY1a protein inhibitor in at least one of d1) to d4):

[0042] d1) Reduce salt stress resistance of tomatoes;

[0043] d2) Cultivating tomato varieties;

[0044] d3) preparing a product for reducing salt stress resistance of tomatoes;

[0045] d4) preparing a product of cultivated tomato variety.

[0046] Preferably, the tomato variety comprises the following characteristics: reduced resistance to salt stress.

[0047] Preferably, the SlCRY1a protein inhibitor comprises at least one of a substance that inhibits the activity of the SlCRY1a protein, a substance that degrades the SlCRY1a protein, and a substance that reduces the expression level of the SlCRY1a protein.

[0048] Preferably, the substance that reduces the expression level of S1CRY1a protein comprises at least one of e1) to e13):

[0049] e1) at least one of siRNA, dsRNA, miRNA, ribozyme, shRNA, and CRISPR / Cas system targeting SlCRY1a protein;

[0050] e2) a nucleic acid molecule encoding e1);

[0051] e3) an expression cassette comprising the nucleic acid molecule described in e2);

[0052] e4) a recombinant vector comprising the nucleic acid molecule described in e2);

[0053] e5) a recombinant vector comprising the expression cassette described in e3);

[0054] e6) a transgenic cell comprising the nucleic acid molecule described in e2);

[0055] e7) a transgenic cell comprising the expression cassette described in e3);

[0056] e8) a transgenic cell comprising the recombinant vector described in e4);

[0057] e9) a transgenic cell comprising the recombinant vector described in e5);

[0058] e10) a recombinant microorganism containing the nucleic acid molecule described in e2);

[0059] e11) a recombinant microorganism containing the expression cassette described in e3);

[0060] e12) a recombinant microorganism containing the recombinant vector described in e4);

[0061] e13) a recombinant microorganism containing the recombinant vector described in e5);

[0062] Preferably, the recombinant cell comprises Escherichia coli;

[0063] Preferably, the recombinant microorganism comprises Agrobacterium.

[0064] A fourth aspect of the present invention provides a method comprising: a step of reducing the expression level and / or activity of SlCRY1a protein in tomatoes.

[0065] Preferably, the method is at least one of f1) to f2): f1) a method for reducing the salt stress resistance of tomatoes in a plant; f2) a method for breeding tomato varieties.

[0066] Preferably, the tomato variety comprises the following characteristics: reduced resistance to salt stress.

[0067] Preferably, the tomato variety comprises the following characteristics: salt stress resistance is reduced relative to a reference level; the reference level is the level of the wild type.

[0068] Preferably, the step of reducing the expression level and / or activity of the SlCRY1a protein in tomatoes is to introduce at least one of g1) to g3) into tomato tissues and / or tomato cells.

[0069] g1) the sgRNA of the third aspect of the present invention; g2) the biological material of the sgRNA of the third aspect of the present invention; g3) the CRISPR / Cas system of the third aspect of the present invention.

[0070] Preferably, the CRISPR / Cas system comprises sgRNA and Cas protein.

[0071] Preferably, the CRISPR / Cas system comprises biological material containing the sgRNA.

[0072] Preferably, the introduction method comprises at least one of using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, and electroporation.

[0073] A fifth aspect of the present invention provides a method comprising: a step of increasing the expression level and / or activity of the SlCRY1a protein in tomatoes.

[0074] Preferably, the method is at least one of h1) to h2): h1) a method for improving the salt stress resistance of tomatoes; h2) a method for breeding tomato varieties.

[0075] Preferably, the tomato variety comprises the following characteristics: improved resistance to salt stress.

[0076] Preferably, the tomato variety comprises the following characteristics: salt stress resistance is increased relative to a reference level; the reference level is the level of the wild type.

[0077] Preferably, the step of increasing the expression level and / or activity of the SlCRY1a protein in tomatoes is to introduce a nucleic acid molecule encoding the SlCRY1a protein into tomato tissues or tomato cells.

[0078] The beneficial effects of the present invention are:

[0079] The present invention first discovered that tomato SlCRY1a The application of genes in tomato variety breeding, SlCRY1a The gene can regulate the salt tolerance, biomass accumulation, photosynthesis level, plant height, and improve the antioxidant capacity of the plant. SlCRY1a Gene overexpression and gene knockout transgenic plants were used for functional studies. SlCRY1a The gene plays a positive regulatory role in tomato salt stress tolerance. SlCRY1a The gene provides genetic resources for breeding new salt-tolerant tomato varieties and has good potential application value. In the field of modern agricultural industry, it lays a theoretical foundation for studying the regulatory network and signal mechanism of tomato response to stress signals, and has important significance and wide application value for breeding new salt-tolerant tomato varieties, promoting tomato commercialization, and modern breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] Figure 1 for SlCRY1a Western Blot detection results of genes and proteins in gene overexpression tomato lines; A is tomato SlCRY1a A is the expression level of the gene, and B is the expression level of tomato SlCRY1a protein.

[0081] Figure 2 For mutant cry1a Plant SlCRY1a Gene expression levels.

[0082] Figure 3 The results of the present invention are shown in Figure 2. SlCRY1a Changes in gene expression.

[0083] Figure 4 The wild-type plants and overexpression plants in the embodiment of the present invention are CRY1a -OE and mutants cry1a Aboveground growth phenotype, fresh weight and dry matter accumulation level of plants after 7 days of normal and salt stress treatments; A is the aboveground growth of tomatoes, B is the aboveground fresh weight level of tomatoes, C is the decrease ratio of aboveground fresh weight of tomatoes of the three materials under salt stress, D is the aboveground dry weight level of tomatoes, and E is the decrease ratio of aboveground dry weight of tomatoes of the three materials under salt stress.

[0084] Figure 5 The wild-type plants and overexpression plants in the embodiment of the present invention are CRY1a -OE and mutants cry1a Statistical results of plant heights after 7 days of normal and salt stress treatment; A is the statistical result of tomato plant heights, and B is the percentage of tomato plant height decrease in the three materials under salt stress.

[0085] Figure 6 The wild-type plants and overexpression plants in the embodiment of the present invention are CRY1a -OE and mutants cry1a Root growth phenotype, fresh weight and dry matter accumulation level of plants after 7 days of normal and salt stress treatment; among them, A is the growth of the underground part of tomatoes, B is the fresh weight level of tomato roots, C is the decrease ratio of fresh weight of tomato roots of the three materials under salt stress, D is the dry weight level of tomato roots, and E is the decrease ratio of dry weight of tomato roots of the three materials under salt stress.

[0086] Figure 7 The wild-type plants and overexpression plants in the embodiment of the present invention are CRY1a -OE and mutants cry1a Relative conductivity levels of leaves of plants after 7 days of normal and salt stress treatments.

[0087] Figure 8 The wild-type plants and overexpression plants in the embodiment of the present invention are CRY1a -OE and mutants cry1a Changes in the maximum photochemical efficiency (Fv / Fm) of PSII in leaves of plants after 7 days of normal and salt stress treatments.

[0088] Fig. 9 The wild-type plants and overexpression plants in the embodiment of the present invention are CRY1a -OE and mutants cry1a Changes in ROS accumulation levels in leaves of plants after 7 days of normal and salt stress treatment. DETAILED DESCRIPTION

[0089] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0090] Example 1 SlCRY1a Construction of gene overexpression vector

[0091] SlCRY1a The gene comes from tomato and is numbered Solyc04g074180 in the tomato genome database SGN website (https: / / solgenomics.net / ). SlCRY1a Effects of overexpression on salt stress resistance of tomato, retrieved from SGN website SlCRY1a The full-length CDS sequence of the gene was first cloned from the tomato genome SlCRY1aGene. According to the CDS sequence of the target gene, specific homologous recombination primers were designed for PCR amplification (removing the stop codon) by CE Design V1.03 software. The specific primer sequence of SlCRY1a-F was ttacaattaccatggggcgcgccATGTCAGGTGGTGGTTGTAGCA (5'-3', SEQ ID NO: 3); the sequence of SlCRY1a-R was aacatcgtatgggtaggtaccCCTAAATTTGACGACGACACAAGA (5'-3', SEQ ID NO: 4). PCR amplification was performed using tomato cDNA as a template, and the PCR product was identified and purified by gel electrophoresis. The pFGC1008-HA empty vector was cut with the selected restriction endonucleases AscI and KpnI. After 3 h of enzyme digestion, the target gene and the pFGC1008-HA empty vector were connected at 37 °C for 30 min using Exnase II homologous recombinase from Novozymes. Then, the cells were transformed into tran5α Escherichia coli (Trans5α Chemically Competent Cell, transgen, CD201-01) by heat shock in a 42℃ water bath for 90 s. One day later, a single spot was picked for electrophoresis verification, and the PCR product was sent to Youkang Company for sequencing confirmation. The nucleotide sequence of the gene SlCRY1a obtained is shown in SEQ ID NO:1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:2. The results showed that the cloned sequence was consistent with the sequence published in Solgenomics (Solyc04g074180). The positive plasmid was extracted for use and named pFGC1008::SlCRY1a-HA, which is the overexpression plasmid. SlCRY1a Recombinant plasmid of gene.

[0092] Example 2 SlCRY1a Obtaining transgenic plants

[0093] Example 1 successfully constructed SlCRY1aThe overexpression vector (pFGC1008::SlCRY1a-HA) was transformed into Agrobacterium GV3101 by 2.5 Kv electroporation (Gene Pulser Xcell, Catalog No. 165-2660, bio-rad). Agrobacterium GV3101 was transformed by electroporation, and then pFGC1008::SlCRY1a-HA was transformed into wild-type (Moneymaker) tomatoes by plant tissue culture technology and Agrobacterium infection of cotyledons (infection concentration was about OD600 0.8-1.0). Tissue culture seedlings were obtained by callus induction, resistance induction differentiation and rooting culture, and single plant verification and harvesting were performed.

[0094] The verification method is as follows: Fluorescence quantitative experiment and Western Blot verification using HA tag antibody SlCRY1a Overexpression positive transgenic plants. Fluorescence quantitative experiment results showed that compared with the wild type, SlCRY1a Gene expression was significantly upregulated (e.g. Figure 1 As shown in A); Western Blot results showed that the wild type had no SlCRY1a-HA protein band, and the overexpression plants ( CRY1a -OE) showed a clear SlCRY1a-HA band (e.g. Figure 1 The primer sequences used in the fluorescence quantitative experiment are as follows: RT-SlCRY1a-F: CCAGAAGCTCCACTTCTTCC (5'-3', SEQ ID NO: 5), RT-SlCRY1a-R: TGCATTGCTTCCTTTCTCTG (5'-3', SEQ ID NO: 6), RT-SlACTIN2-F: TGTCCCTATTTACGAGGGTTATGC (5'-3', SEQ ID NO: 7), RT-SlACTIN2-R: CAGTTAAATCACGACCAGCAAGAT (5'-3', SEQ ID NO: 8), RT-SlUBI3-F: GCCGACTACAACATCCAGAAGG (5'-3', SEQ ID NO: 9), RT-SlUBI3-R: TGCAACACAGCGAGCTTAACC (5'-3', SEQ ID NO: 10).

[0095] Effect Example SlCRY1a Evaluation of salt tolerance in transgenic plants

[0096] 1. Experimental Materials

[0097] Tomato variety Moneymaker and mutants selected by the present invention cry1a From Tomato Genetics Resource Center (University of California, Davis), S obtained in Example 2 lCRY1a Gene overexpression plants. The present invention uses plant tissue RNA extraction and fluorescence quantitative PCR technology to verify cry1a The results showed that compared with the wild type, CRY1a Gene expression showed a sharp decrease in mutants (e.g. Figure 2 as shown).

[0098] 2. Experimental methods

[0099] Tomato seeds were sterilized by soaking in 55°C hot water for 15 min and then transferred to a shaking incubator at 28°C and 200 rpm for germination for 2 d. When about 80% of the seeds turned white, they were sown in 72-hole trays filled with a mixture of peat and vermiculite (2:1, v / v) for seedling cultivation in a plant factory. The growth conditions were: room temperature of 25°C / 20°C, photosynthetic photon flux density of 300 μmol·m -2 ·s -1 , the photoperiod is 12 / 12 h (day / night). After the seedlings emerge, water the substrate according to the moisture content to keep it moist. During the whole process, water the Hogland nutrient solution (PH1782, PHYGENE). When the tomato seedlings grow to 3 leaves and 1 heart (about 15 days after sowing), the seedlings are transplanted into nutrient pots with a diameter of 10 cm and a depth of 9 cm and planted in the plant factory.

[0100] Salt stress treatment and control: When the tomato seedlings grew to five leaves and one heart, salt stress treatment was carried out: 200 mL of Hoagland nutrient solution (PH1782, PHYGENE) containing 250 mM NaCl per plant was used as salt stress treatment, and the same volume (200 mL) of Hoagland nutrient solution containing 0 mM NaCl was used as control. Root irrigation was performed separately, and the treatment was performed once every three days. After 7 days of salt stress treatment, phenotypic photography was performed, and dry and fresh weight, maximum photochemical efficiency of photosystem II, relative conductivity, and leaf ROS accumulation level were calculated; for gene and protein experiments under salt stress response, RNA and protein sampling was performed at 0h, 6h, 12h, 24h, 48h, and 72h of salt stress treatment.

[0101] Tomato total RNA extraction, cDNA synthesis and gene expression analysis: RNA was extracted from young tomato leaves treated with salt stress for 0 h, 6 h, 12 h, 24 h, 48 h, and 72 h. After the plant leaf tissue was ground with liquid nitrogen, the total RNA of the tissue was extracted using the Plant Total RNA Extraction Kit (Tiangen, Beijing) according to the instructions. After confirming the concentration and quality of the RNA sample with Nanodrop, the RNA was reverse transcribed into cDNA using the ReverTraAce qPCR RT Kit (Toyobo) (containing genomic DNA removal enzyme) according to the instructions. Real-time fluorescence quantitative PCR used the SYBR fluorescent dye kit (Takala) and the PCR reaction was performed on the Roche light cycler480PCR instrument. Tomato ACTIN2 and UBI3 ( Ubiquitin 3 ) genes were used as double internal references, and the relative expression of genes was calculated according to the method of (Livak and Schmittgen., 2001). The primer sequence information is listed in Example 2.

[0102] Protein extraction and Western-blot detection of tomato leaves: For the extraction of total tomato protein, young tomato leaves treated with salt stress for 0h, 6h, 12h, 24h, 48h, and 72h were taken. About 0.1 g was ground into powder in liquid nitrogen, and 0.2~0.3mL of extraction solution (100 mM HEPES, pH 7.5, 5 mM EDTA, 5 mM EGTA, 10 mM DTT, 10 mM NaVO3,10 mM NaF, 50 mM-glycerophosphate, 10% (v / v) glycerol, 1 mM PMSF and 5% (w / v) PVPP) was added. After vortex mixing, centrifugation was performed at 13000 rpm and 4 ℃ for 20 min. The supernatant was the obtained protein. The protein content was quantified using Coomassie Brilliant Blue, and the supernatant was mixed with 2× loading buffer (250 mM Tris-HCl, pH 6.8, 10% (w / v) SDS, 0.5% (w / v) bromophenol blue, 50% (v / v) glycerol, 10 mM DTT) were mixed in equal volumes and heated at 95°C for 10 min. 80 or 100 μg of total protein were separated by 10% (w / v) SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membrane. TBST (20 mM Tris, pH 7.5, 30 mM NaCl, 0.05% (v / v) Tween 20) containing 5% (w / v) BSA was used as the blocking solution for 1 h at room temperature, and the membrane was washed 3-5 times with TBST, each time for 5 min.

[0103] For CRY1a protein: incubate with 0.1% (v / v) HA polyclonal antibody (Abcam, ab18181, Cambridge, MA, USA) at room temperature for 1 h, wash and incubate with anti-mouse-HRP conjugated antibody (Abcam, ab205719, Cambridge, MA, USA) at room temperature for 1 h. Wash the membrane with TBST 5 times, 5 min each time. Finally, use the high-sensitivity chemiluminescence kit (Perkin Elmer, Massachusetts, USA) to observe the signal on the blot according to the manufacturer's instructions. Plant actin monoclonal antibody (Plant actin Monoclonal Antibody, Q30, Cat#YM3034) was used as a control for Western-blot analysis.

[0104] The relative conductivity of the plant was determined as follows: the tomato leaves after treatment were cut into strips of appropriate length (avoiding the main veins), and 4 fresh samples were weighed quickly, each weighing 0.2 g, and placed in graduated centrifuge tubes containing 20 mL of deionized water, covered with lids, and placed in a 28°C shaker for 1.5 h-2 h. The conductivity R1 of the extract was measured with a conductivity meter, and then heated in a boiling water bath for 15 min, cooled to room temperature, and shaken, and the conductivity R2 of the extract was measured again. Relative conductivity = R1 / R2*100%.

[0105] The specific method for determining the maximum photochemical efficiency of photosystem II was as follows: after the plants were placed in a dark environment for 30 minutes, a chlorophyll fluorescence imager (IMAG-PAM; Heinz Walz, Germany) was used to irradiate the plants with detection light (<0.5 μmol m- 2 s -1 ), the minimum fluorescence Fo was measured, and then saturation pulse light (4000 μmol m -2 s -1 ), and measure the maximum fluorescence Fm.

[0106] Fluorescence parameter calculation method: PSⅡ maximum photochemical efficiency (Fv / Fm) = (Fm-Fo) / Fm.

[0107] The method for determining ROS accumulation in tomato leaves was as follows: DAB staining was used to detect the H2O2 content in tomato leaves. The tomato leaves were immersed in 0.1% DAB (w / v) staining solution and treated with light at 25°C for 6 h. NBT staining was used to detect the O2 .-To test the content of NBT, soak the tomato leaves in 0.05% NBT (w / v) staining solution at 25℃ in the dark for 6 h. Stop staining when dark spots similar to damage appear on the leaves, pour out the stain, and then decolorize the stained leaves with 95% ethanol, and finally take pictures.

[0108] 3. Experimental results

[0109] 1) Tomato SlCRY1a responds to salt stress

[0110] The tomato varieties selected for the experiment were the wild-type Moneymaker and the SlCRY1a overexpression and SlCRY1a mutant strains obtained in Example 2. The seeds were sown in plastic pots filled with a 3:1 peat and vermiculite composite cultivation medium. After emergence, the medium was watered according to the moisture content of the medium to keep it moist. The Hoagland nutrient solution was watered throughout the process. When the tomato seedlings grew to five leaves and one heart, salt stress treatment was carried out: 200 mL of Hoagland nutrient solution (PH1782, PHYGENE) containing 250 mM NaCl per plant was used as salt stress treatment, and an equal volume (200 mL) of Hoagland nutrient solution containing 0 mM NaCl was used as control. Root irrigation treatment was performed respectively, and the treatment was performed once every three days. After 7 days of salt stress treatment, phenotypic photography was performed, and the dry and fresh weight, maximum photochemical efficiency of photosystem II, relative conductivity and leaf ROS accumulation level were calculated. For gene and protein experiments under salt stress response, RNA and protein sampling were performed at 0h, 6h, 12h, 24h, 48h and 72h of salt stress treatment.

[0111] First, wild-type Moneymaker tomato seedlings grown to five leaves and one heart were treated with salt stress by applying 200 mL of Hoagland nutrient solution containing 250 mM NaCl to each plant. RNA samples were collected at 0h, 6h, 12h, 24h, 48h, and 72h after salt stress treatment, and relevant tests were performed. SlCRY1a The results of gene transcription are as follows Figure 3 As shown, salt stress can significantly induce SlCRY1a With the increase of salt stress treatment time, SlCRY1a The transcription of the gene first increased, then decreased, and then gradually increased. Salt stress treatment for 72 h induced SlCRY1a The gene expression level was the highest, and this result indicated that tomato SlCRY1a responded to salt stress.

[0112] 2) Effects of SlCRY1a on tomato phenotype

[0113] Then, the five-leaf, one-heart wild-type tomato seedlings (WT) and the SlCRY1a gene overexpression strain obtained in Example 1 ( CRY1a -OE) and mutant plants ( cry1a) were treated with salt stress: 200 mL of Hoagland's nutrient solution containing 250 mM NaCl per plant was used as salt stress treatment, and an equal volume (200 mL) of Hoagland's nutrient solution containing 0 mM NaCl was used as control. Root irrigation was performed every three days, and the growth phenotype and salt damage phenotype of the wild-type, overexpression and mutant tomato plants were observed after one week.

[0114] The actual shooting results of the aboveground growth of tomatoes are as follows Figure 4 As shown in A, the fresh weight of the aboveground parts is as follows Figure 4 As shown in B, the aboveground fresh weight of tomatoes of the three materials decreased by Figure 4 As shown in C, the aboveground dry weight is as follows Figure 4 As shown in D, the aboveground dry weight of tomatoes of the three materials decreased by Figure 4 As shown in E. The effect of salt stress on the growth and development of individual plants can be manifested in many aspects. Among them, the change in plant biomass is an intuitive reflection of the plant's salt stress. It is also a direct indicator of plant tolerance. To a certain extent, it can reflect the plant's growth condition and ability to resist salt stress. The results showed that after wild-type tomato plants were subjected to salt stress, the leaves turned yellow, and the fresh weight and dry weight of the aboveground parts decreased significantly, with a decrease of 39.7% and 37.2%, respectively. cry1a The plant's tolerance to salt stress is the worst. cry1a The leaves at the base of the plant's aboveground stems turned yellow. cry1a The mutant plants showed the largest decreases in fresh weight and dry weight of the aboveground part, which were 53.2% and 46.8%, respectively. CRY1a -OE plants have the strongest tolerance to salt stress. CRY1a -OE plants still have bright green leaves, no yellowing of leaves, and CRY1a The -OE plants showed the smallest decrease in aboveground fresh weight and biomass after salt stress, with decrease rates of 25.8% and 25.3%, respectively.

[0115] The statistical results of tomato plant height phenotype are as follows Figure 5 As shown in A, the plant height reduction ratio of the three materials under salt stress is as follows: Figure 5 As shown in B. Studies have shown that under normal growth conditions, the mutant cry1a The maximum plant height was 36.1 cm, which was significantly higher than that of WT and CRY1a -OE plants, while overexpression plants CRY1a -OE plant height was significantly lower than that of wild-type plants, only 9.4 cm. Crop salt tolerance can be identified by plant dry matter, plant height and other indicators, among which plant height is one of the more sensitive indicators of plant response to salt stress. Under salt stress treatment, WT, CRY1a -OE and cry1a The plant heights of the three plants decreased significantly, but under salt stress CRY1a -OE plants had the lowest height reduction rate of 18.2%. cry1a The highest reduction in plant height of the mutant plants was 30.0%, which further proved that CRY1a -OE plants have a stronger tolerance to salt stress.

[0116] The actual shooting results of tomato root growth are as follows Figure 6 As shown in A, the fresh weight of the roots is Figure 6 As shown in B, the root fresh weight of the three materials decreased by Figure 6 As shown in C, the root dry weight measurement results are as follows Figure 6 As shown in D, the root dry weight of the three materials decreased under salt stress. Figure 6 As shown in E. Salt stress can significantly inhibit the growth of tomatoes, resulting in short plants, yellowing leaves, and poor root development. Root changes are also one of the indicators to measure the tolerance of plants to salt stress. The results showed that the root system of WT plants was significantly inhibited under salt stress, the number of roots decreased, and the fresh weight and dry weight of the roots were significantly reduced, compared with the control without salt stress, the decrease ratio was 50.3% and 45.4%, respectively. cry1a When plants were subjected to salt stress, their root system was most severely inhibited, the root system was the shortest and the least, and the fresh weight and dry weight of the root system decreased most significantly, with a decrease of 60.7% and 52.1% respectively. CRY1a -OE plants had the least root inhibition, and the fresh weight and dry weight of the roots decreased the least, with the decrease rates being 37.0% and 34.4% respectively. CRY1a The root system of -OE plants was least affected by salt stress and had the strongest tolerance to salt stress.

[0117] Overall, CRY1a -OE plants have the strongest tolerance to salt stress. The leaves remain dark green without yellowing or falling off. The root system is long and has many lateral roots. They are basically not inhibited. The decline in aboveground and root biomass is the lowest, and they can accumulate more biomass under salt stress.

[0118] The relative conductivity measurement results of tomato leaves are as follows: Figure 7As shown. Under normal circumstances, plant cell membranes have the ability to selectively permeate substances. When plants are affected by stressful environments, the cell membranes are damaged, the membrane permeability increases, and electrolytes in the cells leak out, resulting in an increase in the conductivity of the cell extract. Therefore, the greater the relative conductivity, the greater the degree of damage to the plant tissue and the more serious the leakage of cellular molecular substances. The results showed that under normal circumstances, there was no significant difference in the relative conductivity of the leaves of the three materials; however, the relative conductivity content of the leaves of wild-type (WT) tomato plants increased significantly after salt stress, which was 300.0% higher than that of the control without salt stress. cry1a The relative conductivity of the leaves of the mutant plants increased sharply after salt stress, increasing by 378.8% compared with the control without salt stress; however, under salt stress conditions, CRY1a -OE plants had significantly lower leaf relative conductivity than the wild type (WT) and cry1a Mutant plants and CRY1a -OE plants had the lowest increase in leaf relative conductivity, which was 107.5%. CRY1a Gene can significantly improve salt tolerance of tomatoes.

[0119] In addition, the maximum photochemical efficiency of photosystem II (PS II) of tomato plants was measured as follows Figure 8 As shown. The maximum photochemical efficiency of PSⅡ Fv / Fm is the most basic parameter of chlorophyll fluorescence parameters. It reflects the potential maximum photosynthetic capacity of plants. It is an effective indicator for measuring the degree of light inhibition and is usually used as the best indicator for measuring adverse stress. Generally, the Fv / Fm of plant leaves that have not suffered adverse stress and have undergone sufficient dark adaptation is generally constant between 0.70 and 0.85, while after suffering adverse stress, the Fv / Fm of plant leaves will show a significant downward trend. The results showed that under normal conditions (no salt stress control group), WT, CRY1a -OE and cry1a There was no significant difference in the Fv / Fm of the leaves of the three materials, all of which were around 0.81; however, salt stress caused the Fv / Fm of the wild-type tomato (WT) leaves to show a significant downward trend, from 0.82 to 0.43; cry1a The Fv / Fm ratio of the mutant plant leaves decreased most significantly, from 0.80 to 0.30; however, under salt stress CRY1a -OE plant leaves Fv / Fm decreased the least, from 0.82 to 0.71. CRY1a The maximum photochemical efficiency (Fv / Fm) of PSII in leaves of -OE plants was significantly higher than that of wild-type tomatoes (WT) and cry1a Mutant plants, and under salt stress cry1a The Fv / Fm of the mutant plant leaves was the lowest. CRY1a-OE plants had the strongest tolerance to salt stress and their light absorption capacity after salt stress was closer to the normal level.

[0120] Changes in ROS accumulation levels in tomato leaves Fig. 9 As shown, DAB staining Fig. 9 As shown in A, NBT staining Fig. 9 As shown in B. Under salt stress, excessive ions flow into the plant body, resulting in an imbalance in the energy flow of plant photosynthesis, which leads to the generation of ROS. The large amount of ROS generated in this way has a great harm to plant cells and even causes plant death. DAB and NBT staining methods are usually used to more intuitively see the H2O2 and O2 . - The results showed that under normal conditions, the leaves of the three materials were lightly stained and had no difference; under salt stress conditions, the leaves of the WT plants showed darker dark brown and blue-purple spots, while cry1a The leaves of the mutant plants were more stained, indicating that the leaves of the plants accumulated more H2O2 and O2 . - ,However, CRY1a -H2O2 and O2 in leaves of OE plants . - The accumulation was significantly reduced, as evidenced by the dark brown and blue-purple spots on the leaves becoming significantly lighter, with no significant difference from the leaves of plants under normal conditions ( Fig. 9 AB in ). It can be seen that overexpression CRY1a The gene can eliminate excess ROS in the plant, thereby improving the salt tolerance of tomatoes.

[0121] In summary, SlCRY1a Genes are of great value in the field of modern tomato agriculture. SlCRY1a Tomato plants with the gene have taller plants. CRY1a- OE plants have the characteristics of dwarfing. Currently, dwarfing is an important part of greenhouse tomato cultivation. Appropriate dwarfing can increase light intensity, promote fruit growth and development, and increase yield. SlCRY1a Tomato plants with the gene can promote dwarfing and dense planting of tomatoes in facility cultivation. In saline-alkali environments, high salt has a significant stress effect on plants, inhibiting the growth and development of crops aboveground and underground, reducing biomass, causing yield reduction, and thus causing significant economic losses. SlCRY1aFor tomatoes with the gene, even under salt stress, the growth of the aboveground growth part and the root system are closer to normal levels, the leaf color remains dark green without yellowing or falling off, the root system is long and has many lateral roots, which are basically not inhibited, the aboveground and root biomass decrease in the lowest proportion, the plant height decreases in the lowest proportion, and it can accumulate more biomass under salt stress, and its leaf relative conductivity and chlorophyll fluorescence ability in a saline-alkali environment are closer to normal levels, and it can reduce the accumulation of excessive ROS in the plant. Its ability to resist salt stress is more suitable for survival and cultivation in a saline-alkali environment, providing high-quality germplasm resources for tomato breeding on saline-alkali land.

Claims

1. Overexpression SlCRY1a Application of genes in improving salt stress resistance in tomatoes; Said SlCRY1a The nucleotide sequence of the gene is shown in SEQ ID NO: 1; The application is constructed SlCRY1a Gene overexpression vectors and biological materials to obtain tomato plants with high salt stress resistance; The biological material contains SlCRY1a Recombinant cells containing gene overexpression vectors.

2. The use according to claim 1, Features: Said SlCRY1a The amino acid sequence encoded by the gene is shown in SEQ ID NO:

2.

3. Overexpression SlCRY1a The use of genetically related biological materials in breeding tomato varieties; Said SlCRY1a The nucleotide sequence of the gene is shown in SEQ ID NO: 1; The application is constructed SlCRY1a Gene overexpression vectors and biological materials to obtain tomato plants with high salt stress resistance; The biological material contains SlCRY1a Recombinant cells of gene overexpression vectors; The tomato variety comprises the following characteristics: improved resistance to salt stress; The tomato variety comprises the following characteristics: salt stress resistance is improved relative to a reference level; the reference level is the level of the wild type.

4. A method comprising: the step of increasing the expression level of SlCRY1a protein in tomatoes; The method is at least one of h1) to h2): h1) a method for improving salt stress resistance of tomatoes; h2) a method for breeding tomato varieties; The tomato variety comprises the following characteristics: improved resistance to salt stress; The tomato variety comprises the following characteristics: salt stress resistance is improved relative to a reference level; the reference level is the level of the wild type; The step of increasing the expression level of the SlCRY1a protein in tomatoes is to add the SlCRY1a The gene overexpression vector and biological material are introduced into tomato tissue or tomato cells.

5. The method according to claim 4, Features: The introduction method includes at least one of using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, and electroporation.

Images