An InDel molecular marker linked to rice aroma gene Badh2 and its primers, kit and detection method

Abstract

The invention provides an InDel molecular marker linked to the rice aroma gene Badh2 and its primers, kit and detection method, belonging to genetic engineering. The InDel molecular marker includes a Badh2-74640 marker or a Badh2-86421 marker. The InDel molecular marker provided by the invention enables genotyping by 1.5% agarose gel electrophoresis, so that grassroots breeding units with insufficient equipment and experimental conditions can also carry out molecular marker-assisted breeding, thereby lowering the threshold of molecular marker-assisted breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and particularly relates to an InDel molecular marker linked to a rice aroma gene Badh2 and a primer, a kit and a detection method thereof. Background Art

[0002] At present, the volatile substance 2-acetyl-1-pyrroline (2-AP) in rice is considered to be one of the main volatile substances in aromatic rice, and the detection of 2-AP does not require a very high concentration, but can be detected at low concentrations. The chewing method and the KOH method are the most commonly used aroma identification methods in traditional breeding, but these two methods rely on human senses and are greatly affected by subjective factors.

[0003] Previous studies have shown that the recessive gene fgr located on chromosome 8 of rice encodes betaine aldehyde dehydrogenase homologue 2 (Badh2), which can inhibit the expression of the fgr gene, knock out the fgr gene, or cause the fgr gene to mutate, resulting in the loss of Badh2 enzyme function, which will increase the 2-AP precursor substance and accumulate 2-AP to make the rice fragrant. Therefore, the fgr gene is considered to be the same fragrance gene as the Badh2 gene. By modifying Badh2 to make it a non-functional allele badh2, rice can be changed from non-fragrant to fragrant. Studies have reported that the Japanese rice variety "Koshihikari" contains the badh2 gene. Editing Badh2 using CRISPR / CAS9 technology can make non-fragrant rice fragrant.

[0004] Since the determination of rice aroma traits is relatively complex and requires special conditions and rich experience, and the traditional method has subjective uncertainty, the phenotypic determination work has brought a lot of inconvenience to breeders. Molecular marker technology can reduce the dependence of breeders on phenotypic breeding, thereby accelerating the breeding of rice aroma varieties, and is therefore welcomed by breeders.

[0005] There are two main types of Badh2 molecular markers commonly used in the prior art. One is the CAPS marker, which requires enzyme digestion and electrophoresis after PCR, and the steps are complicated; the other is the KASP marker, which requires separate and expensive detection equipment for molecular marker identification. Generally, grassroots breeding units do not have special funds to purchase such equipment and do not have the conditions for detection, which often hinders molecular breeding. Summary of the invention

[0006] In view of this, the purpose of the present invention is to provide an InDel molecular marker linked to the rice aroma gene Badh2 and its primers, kit and detection method. The InDel molecular marker provided by the present invention enables genotyping by 1.5% agarose gel electrophoresis, so that grassroots breeding units with insufficient equipment and experimental conditions can also carry out molecular marker-assisted breeding, thereby lowering the threshold of molecular marker-assisted breeding.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides an InDel molecular marker linked to the rice aroma gene Badh2, wherein the InDel molecular marker comprises a Badh2-74640 marker and / or a Badh2-86421 marker;

[0009] In the present invention, the Badh2-74640 marker start end is located at position 20374640 of chromosome 8 of the rice Nipponbare reference genome;

[0010] The starting end of the Badh2-86421 marker is located at position 20386421 of chromosome 8 of the rice Nipponbare reference genome.

[0011] The Badh2-74640 marker is obtained by amplification of the Badh2-74640 primer; the nucleotide sequence of the upstream primer of the Badh2-74640 primer is shown in SEQ ID No. 1: CTTGCAGCCATGAATGTTCC;

[0012] The nucleotide sequence of the downstream primer is shown in SEQ ID No. 2: GGTGCCATTTGCTGATTTGC;

[0013] The Badh2-86421 marker is obtained by amplification of the Badh2-86421 primer; the nucleotide sequence of the upstream primer of the Badh2-86421 primer is shown in SEQ ID No.3: TTCTCATAGTAGAGGAGGTG;

[0014] The nucleotide sequence of the downstream primer is shown in SEQ ID No. 4; GCTTTTCCAGATTCTGAGAAGC.

[0015] The present invention provides a kit for detecting rice aroma gene Badh2, the kit comprising the above Badh2-74640 primer and / or Badh2-86421 marker. In the present invention, the kit also preferably contains reagents used for PCR amplification, such as rTaq enzyme, 10× buffer and 2× dNTP, etc. The present invention does not specifically limit the storage amount of each reagent in the kit, and those skilled in the art can use the amount conventionally placed in the kit.

[0016] The present invention also provides an application of the above-mentioned InDel molecular marker and / or the above-mentioned kit in detecting rice aroma gene Badh2.

[0017] The present invention provides a method for detecting a rice aroma gene Badh2, the method comprising the following steps:

[0018] 1) using the extracted DNA of the tested rice as a template, performing PCR amplification using the above-mentioned Badh2-74640 primer and / or Badh2-86421 primer to obtain a PCR product;

[0019] 2) When the length of the PCR product obtained by amplification in step 1) is 318 bp or 314 bp, the tested rice does not contain the aroma gene and is a BADH2 allele;

[0020] When the length of the PCR product obtained by amplification in step 1) is 342 bp or 276 bp, the tested rice contains the aroma gene, which is the badh2 allele.

[0021] In the present invention, the site for extracting rice DNA in step 1) is rice leaves; the present invention has no particular limitation on the method for extracting rice leaf DNA, and those skilled in the art may use conventional methods, such as the CTAB method.

[0022] In the present invention, the PCR amplification procedure in step 1) includes: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min; 25°C for 2 min.

[0023] In the present invention, the system for PCR amplification in step 1) includes: each 15 μL consists of 0.25 μL of 10 μmol / L forward primer, 0.25 μl of 10 μmol / L reverse primer, 0.15 μL of rTaq enzyme, 1.5 μL of 10×buffer, 1.75 μL of 2×dNTP and 12.1 μL of ddH2O.

[0024] The present invention provides the use of the above-mentioned InDel molecular marker and / or the above-mentioned kit in improving rice varieties.

[0025] The beneficial effects of the present invention are:

[0026] Compared with the current detection method for rice aroma gene Badh2, the present invention only needs to use agarose electrophoresis for detection, which is very suitable for grassroots breeding units for molecular breeding. The main advantages are as follows: Compared with polyacrylamide gel electrophoresis, agarose electrophoresis has the advantages of fast gel preparation time, easy operation, non-toxicity and low price; compared with markers such as CAPS, the use of InDel markers does not require restriction endonuclease digestion again after amplification, which saves time and effort; compared with markers such as KASP, this marker detection method does not require special reagents and expensive detection equipment, and can be performed using an ordinary electrophoresis instrument, which is very suitable for grassroots breeding units to carry out molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is a flow chart of the present invention;

[0028] Figure 2 This is a diagram of the results of the Badh2 InDel marker polymorphism screening;

[0029] The samples in the left picture are arranged from left to right: Yueguang, Zhenshan 97 and Reke 181, and the same is true for the right picture;

[0030] Figure 3 This is the result of testing the germplasm genotype of Badh2-74640;

[0031] (The letter B in the figure represents the homozygous badh2 genotype with fragrance, and the letter A represents the homozygous BADH2 genotype without fragrance. Figures 4 to 6 Similarly);

[0032] Figure 4 This is the result of testing the germplasm genotype of Badh2-86421;

[0033] Figure 5 This is a diagram showing the results of testing the F2 population for Badh2-74640;

[0034] Figure 6 This is a graph showing the results of Badh2-86421 detection in the F2 population. DETAILED DESCRIPTION

[0035] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0036] Example 1

[0037] The rice materials used in the present invention are mainly derived from some micro-core germplasm resources, including some approved rice varieties and some intermediate materials for breeding.

[0038] DNA was extracted using the CTAB method, and the source of DNA was rice leaves.

[0039] Primer design:

[0040] According to the information in the RGAP database (http: / / rice.uga.edu / ), the physical location of Badh2 was found to be Chr8:20379794–20386061. After comparing the BADH2 gene sequences of Minghui 63 and Zhenshan 97 (sequences from RIGW (http: / / rice.hzau.edu.cn / rice_rs3 / )) and Nipponbare (sequences from the RGAP database), it was found that there was only a 10bp InDel difference. This marker is not suitable for agarose electrophoresis typing and cannot obtain a clear band pattern through agarose electrophoresis. Therefore, a 20–70bp InDel was screened in the 30kb interval upstream and downstream of BADH2. This InDel is closely linked to the Badh2 gene and can often be used as a linkage marker to identify the Badh2 genotype in breeding. Its effect is basically the same as that of the internal marker of the Badh2 gene. Primers were designed using the online primer design website BatchPrimer3 (http: / / probes.pw.usda.gov / batchprimer3 / ) (Table 1). Primers were commissioned to be synthesized by Tianyi Huiyuan Company. Badh2-74640 is located 5.2 kb upstream of Badh2; Badh2-86421 is located 6.6 kb downstream of Badh2. Both markers are closely linked markers of Badh2 and can be used to identify the Badh2 gene. The flow chart of the present invention is shown in FIG. Figure 1 shown.

[0041] Table 1 Marking information

[0042]

[0043] Example 2

[0044] The design process of molecular markers is as follows: determine the physical location of the cloned target gene Badh2, extract the InDel information within the 30kb upstream and downstream intervals based on the released genome sequences of Minghui 63, Zhenshan 97 and Nipponbare, design and synthesize primer sequences, and then screen and test the markers, and obtain the primers in Example 1.

[0045] 1. Sample testing

[0046] PCR product test: PCR product test was performed on a 61 electrophoresis instrument. 20 ng of DNA sample was added to the microwell reaction plate, and the reaction system was shown in Table 2. The PCR reaction conditions were: 94°C pre-denaturation for 3 minutes; the amplification program was 94°C denaturation for 30 seconds, 58°C annealing for 30 seconds, 72°C extension for 30 seconds, 72°C extension for 5 minutes after 35 cycles, and 25°C for 2 minutes to end the reaction. After the PCR product reaction was completed, electrophoresis was performed on a 61 electrophoresis instrument, and the gel was photographed using a gel imaging instrument after electrophoresis at 400V and 200mA for 30 minutes. The genotype is determined based on the size of the product after electrophoresis. If the sample amplification product is the Reke 181 genotype (the PCR product is 342bp (Badh2-74640) or 276bp (Badh2-86421)), the tested rice sample is determined to be a homozygous fragrant genotype badh2; if the sample amplification product is a non-181 genotype (the PCR product is 318bp (Badh2-74640) or 314bp (Badh2-86421)), the tested rice sample is determined to be a homozygous non-fragrant genotype BADH2.

[0047] Table 2 PCR amplification system

[0048] Volume (μL) 10μmol / L Forward Primer 0.25 10μmol / L Reverse Primer 0.25 rTaq 0.15 <![CDATA[10×buffer(Mg 2+ )]]> 1.5 2×dNTP 0.75 <![CDATA[d2H2O]]> 12.1 Total volume 15

[0049] 2. Genotype data

[0050] According to the above detection method, the designed markers were verified using the fragrance gene donors "Yue Guang" and "Re Ke 181" and the non-fragrant rice variety "Zhen Shan 97". Badh2-74640 and Badh2-86421, the markers can be typed normally ( Figure 2 The detection results of Badh2-74640 or Badh2-86421 on badh2 donors Yueguang and Reke 181 were a fragrance genotype (badh2), and the control variety Zhenshan 97 was a non-fragrant haplotype (BADH2), which proved the accuracy of the present invention in detecting the Badh2 gene.

[0051] 3. Germplasm resource population verification

[0052] Badh2-74640 and Badh2-86421 were selected as identification markers for Badh2 in 96 germplasm resource populations. The results of marker typing in natural populations are shown in Table 3. It can be seen from the table that 21 rice materials were detected with the haplotype of Koshihikari / Reko 181, which was a homozygous badh2 genotype, and the rest were BADH2 genotypes without fragrance. Figure 3 As shown, Badh2-86421 marker is in the germplasm typing results as shown Figure 4As shown (letter B in the figure represents the homozygous badh2 genotype with fragrance, and letter A represents the homozygous BADH2 genotype without fragrance), it can be seen from the figure that the badh2 genotype has been used in the common rice breeding tested, and the Badh2-74640 marker or the Badh2-86421 marker can be used for the efficient detection of the rice Badh2 gene.

[0053] Table 3 InDel molecular marker identification of germplasm resources typing data

[0054] 4. F2 population verification

[0055] Molecular markers are mainly used to track and screen target genes in the process of molecular marker-assisted breeding. This study selected 46 F2 populations obtained by self-pollination of Koshihikari with fragrance gene and Zhenshan 97 without fragrance, as well as two parents, to test the accuracy of Badh2-74640 and Badh2-86421 markers in identifying the Badh2 gene. The typing results of the markers in the F2 population are shown in Table 4. It can be seen from the table that 29 rice materials were detected with the genotype of Koshihikari, which was a homozygous badh2 genotype; 6 materials had the genotype of Zhenshan 97, which was a homozygous BADH2 genotype; and the rest were heterozygous Badh2 genotypes. The typing results of the Badh2-74640 marker in the F2 population are shown in Table 4. Figure 5 As shown, the Badh2-86421 marker typing results in natural populations are as follows Figure 6 As shown (letter B in the figure represents a homozygous badh2 genotype with fragrance, and letter A represents a homozygous BADH2 genotype without fragrance), it can be seen from the figure that Badh2-74640 and Badh2-86421 can be used for tracking and identification of target genes, and the badh2 gene can be introduced through backcrossing screening to improve rice genes. The Badh2-74640 marker or the Badh2-86421 marker can be used for efficient detection of the rice Badh2 gene.

[0056] Table 4 Typing data of F2 population identified by InDel molecular markers

[0057] It can be concluded from the above embodiments that the present invention selects molecular markers with larger InDels so that they can be genotyped by 1.5% agarose gel electrophoresis, thereby enabling grassroots breeding units with insufficient equipment and experimental conditions to carry out molecular marker-assisted breeding and lowering the threshold for molecular marker-assisted breeding.

[0058] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for detecting whether rice contains the aroma gene Badh2, characterized in that: The detection method comprises the following steps: 1) using the extracted DNA of the tested rice as a template, performing PCR amplification using Badh2-74640 primer and / or Badh2-86421 primer to obtain a PCR product; 2) When the length of the PCR product obtained by amplification in step 1) is 318 bp or 314 bp, the tested rice does not contain the aroma gene; When the length of the PCR product obtained by amplification in step 1) is 342 bp or 276 bp, the tested rice contains the aroma gene; The nucleotide sequence of the upstream primer of the Badh2-74640 primer is shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.2; The nucleotide sequence of the upstream primer of the Badh2-86421 primer is shown in SEQ ID No.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

4.

2. The detection method according to claim 1, characterized in that: The site for extracting rice DNA in step 1) is the rice leaves.

3. The detection method according to claim 1, characterized in that: The PCR amplification procedure in step 1) includes: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min; 25°C for 2 min.

4. The detection method according to claim 1, characterized in that: The PCR amplification system in step 1) includes: each 15 μL consists of 0.25 μL of 10 μmol / L forward primer, 0.25 μl of 10 μmol / L reverse primer, 0.15 μL of rTaq enzyme, 1.5 μL of 10×buffer, 1.75 μL of 2×dNTP and 12.1 μL of ddH2O.

Images