A nanoprobe for detecting miRNA-21 and its preparation method and application

Abstract

The present invention discloses a nanoprobe for detecting miRNA-21 and its preparation method and application, and relates to the field of bio-nanomaterials, including constructing a long RCA chain rich in G-quadruplex sequence by RCA reaction according to the sequence of miRNA-21, and loading a Blocker chain on the long RCA chain, so as to obtain a nanoprobe LGBN for detecting miRNA-21. The present invention proposes a nanoprobe of a long RCA chain loaded with a Blocker chain rich in a G-quadruplex sequence, the nanoprobe has a certain confinement effect, can significantly improve the reaction speed, and then the nanoprobe is prepared into a kit, which can be used for detecting serum samples, effectively reducing the reaction time, and having a lower detection limit. The kit proposed by the present invention can shoot the product through a portable mobile terminal, and the concentration of miRNA-21 can be obtained by reading and calculating in the cloud, which removes the limitation of the instrument, does not require complicated operation and large instruments, has the characteristics of simplicity, feasibility and portability, and thus builds a fast and simple POCT platform.

Description

Technical Field

[0001] The present invention relates to the field of biological nanomaterials, and in particular to a nanoprobe for detecting miRNA-21 and a preparation method and application thereof. Background Art

[0002] MicroRNA (miRNA) is a class of endogenous highly conserved non-coding RNAs with a length of 21–25 nucleotides, which achieve pathological and physiological functions by regulating the expression of target genes. Existing studies have found that miRNA-21 levels are elevated in human failing heart tissues. It plays a pro-fibrotic role in fibroblasts, an angiogenesis inhibitory role in endothelial cells, and an anti-inflammatory function in immune cells. These functions play a great role in the development of heart failure. In addition, studies have confirmed the correlation between circulating miRNA-21 levels and BNP, EF, and NYHA grades. Therefore, miRNA-21 in circulating blood is expected to become a new biomarker for the diagnosis or auxiliary diagnosis of heart failure.

[0003] The content of miRNA-21 in circulating blood is low, and conventional methods are difficult to detect, costly, and time-consuming, which limits its application as a disease biomarker in clinical testing. At present, the most widely used miRNA detection technology is RT-qPCR technology, but this technology requires high-precision thermal cycling and special DNA polymerases to achieve continuous amplification. Therefore, it has limitations in terms of time-consuming, sometimes non-specific, high cost, and dedicated instruments. At present, a series of rapid and accurate analysis methods have been constructed based on DNA nanomaterials and signal amplification technology, such as colorimetry, fluorescence analysis, electrochemiluminescence, and surface-enhanced Raman scattering, which can generally meet the detection of actual clinical samples, but these analysis methods require large instruments such as fluorescence spectrometers, which are complicated to operate and not easy to carry. These defects limit their POCT application. For example, 3D nanomachines based on wireframe DNA cubes release a large amount of fluorescent signals through catalytic hairpin assembly (CHA), and quantitatively detect the content of miRNA-21 by changes in fluorescent signals. However, these methods require complex operations and high-precision instruments, which greatly limits their clinical POCT application.

[0004] Although the previous POCT detection methods are simple and portable, they often have low sensitivity and may not meet the requirements for the detection of biomarkers in clinical serum. Even some portable quantitative tests based on dual-signal output cascade enzymatic reactions have problems such as low sensitivity, poor detection limit (LOD), and long reaction time. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the present invention provides a nanoprobe for detecting miRNA-21 with rapid reaction and low detection limit, and a preparation method and application thereof.

[0006] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:

[0007] Provided is a nanoprobe for detecting miRNA-21, comprising constructing an RCA long chain rich in a G-quadruplex single-stranded sequence through an RCA reaction according to the sequence of miRNA-21, and loading a Blocker chain on the RCA long chain to obtain a nanoprobe LGBN for detecting miRNA-21.

[0008] A method for preparing the above-mentioned nanoprobe for detecting miRNA-21 is also provided, and the specific steps are as follows:

[0009] S1: Designing primer strands, template strands and blocker strands according to the miRNA-21 sequence; using the primer strands and template strands to prepare a circular template CT;

[0010] S2: RCA long chains were synthesized using the circular template CT;

[0011] S3: Take 100 μL of RCA long chain, add 64 μL of 30 μM Blocker chain and 10 μL of 2 M MgCl2; add ultrapure water to 240 μL, mix well and incubate at 37°C for 1 hour to obtain the nanoprobe LGBN for detecting miRNA-21.

[0012] Furthermore, the specific method for preparing the circular template in step S1 is: preparing the primer strand and the template strand into a primer strand solution and a template strand solution with a concentration of 10 μM respectively by using a TE buffer; wherein the pH of the TE buffer is 7.4;

[0013] Take 80 μL of primer chain solution and template chain solution respectively, mix them into 40 μL of 10×T4 DNA ligase buffer, and use ultrapure water to make up to 394 μL; heat the mixture at 95°C for 10 min, cool it to 25°C for annealing after heating; add 6 μL of T4 DNA ligase to the annealed product, mix well, and cyclize at 16°C for 16 h, and finally heat at 65°C for 10 min to inactivate the circular template CT.

[0014] Furthermore, the specific method for synthesizing the RCA long chain in step S2 is as follows: 30 μL of circular template CT, 10 μL of 10 mM dNTP, 5 μL of 10× phi 29 DNA ligase buffer, 48 μL of ultrapure water, 5 μL of 1 M KCl and 2 μL of phi 29 DNA polymerase were mixed, incubated at 30°C for 30 min, and after the reaction was completed, heated at 65°C for 10 min to inactivate the RCA long chain.

[0015] Provided is an application of the above-mentioned nanoprobe for detecting miRNA-21, which is used for preparing a kit for detecting miRNA-21.

[0016] Furthermore, the kit includes liquid A and liquid B, wherein liquid A is composed of 20 μL of nanoprobe LGBN for detecting miRNA-21, 2 μL of Exo III enzyme with a concentration of 20 U / L, 6 μL of KCl with a concentration of 1 M, 10 μL of HEPES buffer and 18 μL of hemin with a concentration of 1 μM; wherein the pH of the HEPES buffer is 7.4;

[0017] Solution B is composed of 27.6 μL of 5 mM TMB colorimetric solution, 86 μL of 3% H2O2, and 426.4 μL of 0.2 M citric acid-Na2HPO4; wherein the pH of citric acid-Na2HPO4 is 5.4.

[0018] Further, the method of using the kit is:

[0019] P1: Take 4 μL of the serum sample to be tested and mix it with the reagent A of the kit and react at 37°C for 45 minutes;

[0020] P2: Add solution B to the product after reaction in P1, mix well and react for 1 minute;

[0021] P3: Add 300 μL of 2M H2SO4 to the product after the P2 reaction; determine the RGB value of the product or the ultraviolet absorbance at a wavelength of 450 nm, and calculate the miRNA-21 concentration of the serum sample to be tested based on the RGB value or ultraviolet absorbance.

[0022] Further, the method for calculating the concentration based on ultraviolet absorbance is specifically as follows: measuring the ultraviolet absorbance of the product after the serum and the kit react at a wavelength of 450nm , according to the formula , the concentration of miRNA-21 in the assay product can be calculated ,in, and is the linear regression coefficient of UV absorbance, It is the absorbance at 450nm of the product obtained after the reaction of ultrapure water and the reagents in the kit.

[0023] Further, the method for calculating the concentration based on the RGB value is as follows: photograph the product after the serum and the kit react, extract the RGB value of the product, take the blue channel B value, and calculate the concentration according to the formula , the concentration of miRNA-21 in the assay product can be calculated ,in and is the linear regression coefficient of B value.

[0024] The beneficial effects of the present invention are:

[0025] The present invention proposes a nanoprobe with a long RCA chain loaded with a Blocker chain rich in a G-quadruplex sequence. The nanoprobe has a certain confinement effect and can significantly increase the reaction speed. The nanoprobe is then prepared into a kit, which can be used to detect serum samples, effectively reducing the reaction time and having a lower detection limit.

[0026] The kit proposed in the present invention can take pictures of the product through a portable mobile terminal, and the concentration of miRNA-21 can be obtained by reading and calculating through the cloud, which eliminates the limitation of the instrument, does not require complicated operations and large instruments, and has the characteristics of simplicity, feasibility and portability. A fast and simple POCT platform has been built.

[0027] The nanoprobe proposed in the present invention has excellent specificity and anti-interference ability, can effectively avoid false detection of similar sequences, and realizes accurate detection of miRNA-21 content in actual serum samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 AFM characterization images of RCA long chain and nanoprobe LGBN and schematic diagram of height contrast curve;

[0029] Figure 2 It is a comparison chart of the kit's detection of serum with different concentrations of miRNA-21 and a schematic diagram of the linear fitting curve between the blue channel B value and the miRNA-21 concentration;

[0030] Figure 3 This is a schematic diagram of the polypropylene gel electrophoresis characterization in Example 3;

[0031] Figure 4 Schematic diagram of particle size characterization and circular dichroism characterization in Example 4;

[0032] Figure 5 Schematic diagram of the ability comparison between the free G-quadruplex probe FGBN and the nanoprobe LGBN;

[0033] Figure 6 Schematic diagram of the comparison of reaction kinetics between free G-quadruplex probe FGBN and nanoprobe LGBN;

[0034] Figure 7 Schematic diagram of the anti-interference ability detection of the nanoprobe LGBN. DETAILED DESCRIPTION

[0035] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0036] Example 1 Preparation of Nanoprobe LGBN

[0037] The nanoprobe LGBN was prepared by the following method:

[0038] S1: Designing primer strands, template strands and blocker strands according to the miRNA-21 sequence; using the primer strands and template strands to prepare a circular template CT;

[0039] The DNA sequence of miRNA-21 is shown in SEQ ID NO. 1: TAGCTTATCAGACTGATGTTGA;

[0040] The DNA sequence of the primer strand is shown in SEQ ID NO. 2: TCGGCTTAGCCTCAACCCCCA;

[0041] The DNA sequence of the template chain is shown in SEQ ID NO.3: PO4 / GGCTAAGCCGACCCTAACCCCAGTCTGATCCCTAACCCTGGGGGTTGA; wherein PO4 / means a phosphate group is modified at the 5' end of the DNA chain;

[0042] The DNA sequence of the Blocker strand is shown in SEQ ID NO. 4: CCCCAGTCTGATAAGCTA;

[0043] The primer strand and the template strand are respectively prepared into a primer strand solution and a template strand solution with a concentration of 10 μM by using TE buffer; wherein the pH of the TE buffer is 7.4;

[0044] Take 80 μL of primer chain solution and template chain solution respectively, mix them into 40 μL of 10×T4 DNA ligase buffer, and use ultrapure water to make up to 394 μL; heat the mixture at 95°C for 10 min, cool it to 25°C for annealing after heating; add 6 μL of T4 DNA ligase to the annealed product, mix well, and cyclize at 16°C for 16 h, and finally heat at 65°C for 10 min to inactivate the circular template CT.

[0045] S2: RCA long chains were synthesized using the circular template CT;

[0046] Mix 30 μL of circular template CT, 10 μL of 10 mM dNTP, 5 μL of 10× phi 29 DNA ligase buffer, 48 μL of ultrapure water, 5 μL of 1 M KCl and 2 μL of phi 29 DNA polymerase, incubate at 30°C for 30 min, and after the reaction, heat at 65°C for 10 min to inactivate the RCA long chain.

[0047] S3: Take 100 μL of RCA long chain, add 64 μL of 30 μM Blocker chain and 10 μL of 2 M MgCl2; add ultrapure water to 240 μL, mix well and incubate at 37°C for 1 hour to obtain the nanoprobe LGBN for detecting miRNA-21.

[0048] The prepared RCA long chain and nanoprobe LGBN were tested by atomic force microscopy (AFM). The test results are as follows: Figure 1 As shown, Figure 1 (a) is the AFM characterization image of the RCA long chain. Figure 1 (b) AFM characterization of the nanoprobe LGBN. Figure 1 (a) It can be seen that the RCA product forms a long chain structure and + Under the action of , G-quadruplexes are formed, causing some long chains to condense into wool balls; Figure 1 (a) and Figure 1 (b) By comparison, it can be seen that after the RCA long chain is loaded with the Blocker chain, the formation of the G-quadruplex is blocked, and a relatively rigid double-chain structure is formed, which is morphologically linear. There is a significant difference in the morphology of the two. Figure 1 (a) and Figure 1 (b) Perform streaking analysis, the results are as follows Figure 1 As shown in (c), the height of the nanoprobe LGBN is significantly lower than that of the RCA long chain, indicating the successful loading of the Blocker chain and the successful synthesis of the nanoprobe LGBN.

[0049] Example 2 Kit and its detection of miRNA-21

[0050] 20 μL of the nanoprobe LGBN prepared in Example 1, 2 μL of Exo III enzyme with a concentration of 20 U / L, 6 μL of KCl with a concentration of 1 M, 10 μL of HEPES buffer and 18 μL of hemin with a concentration of 1 μM were mixed to obtain a reagent kit A solution; wherein the pH of the HEPES buffer was 7.4;

[0051] Take 27.6 μL of 5 mM TMB colorimetric solution, 86 μL of 3% H2O2, and 426.4 μL of 0.2 M citric acid-Na2HPO4 and mix them to obtain reagent kit solution B; wherein the pH of citric acid-Na2HPO4 is 5.4.

[0052] Prepare serum samples to be tested and detect miRNA-21 using the following method:

[0053] P1: Take 4 μL of the serum sample to be tested and mix it with the A solution of the kit in an EP tube, and react at 37°C for 45 minutes;

[0054] P2: Add solution B to the EP tube after reaction in P1, mix well and react for 1 minute;

[0055] P3: Add 300 μL of 2M H2SO4 to the EP tube after the reaction in P2; mix well;

[0056] The product was measured using an ultraviolet spectrophotometer to obtain the ultraviolet absorbance of the product at a wavelength of 450 nm. Under the same environment, use the same volume of ultrapure water to replace the serum sample to be tested, and measure the absorbance of the product obtained after the ultrapure water reacts with the reagents of the kit at 450nm ;

[0057] According to the formula , the concentration of miRNA-21 in the assay product can be calculated ,in, and is the linear regression coefficient of UV absorbance.

[0058] In specific implementation, a mobile terminal can also be used to photograph the measured product. During the photographing process, the measured product is placed in an EP tube and placed in a dark room with a white background. The flash of the mobile terminal is used to directly illuminate the EP tube to obtain an image. After correcting the image according to the white background, the blue channel B value of the measured product area in the image is extracted. According to the formula , the concentration of miRNA-21 in the assay product can be calculated ,in and is the linear regression coefficient of B value.

[0059] The linear regression coefficient is determined according to the environment of the detection site. In specific implementation, when each laboratory constructs a POCT platform, the same kit is used to measure miRNA-21 of different concentrations, and the measurement results are fitted to determine the linear regression coefficient. In this embodiment, the above-mentioned kit and measurement method are used to measure miRNA-21 with concentrations of 0nM, 0.01nM, 0.05nM, 0.1nM, 0.2nM, 0.4nM, 0.6nM, 0.8nM, 1nM, 2nM and 4nM, respectively, and linear fitting is performed.

[0060] In this embodiment, the linear regression coefficient of ultraviolet absorbance obtained by fitting in the range of 10pM-1nM is , ;

[0061] The test results using the blue channel B value as the measured value are as follows Figure 2 As shown, Figure 2 (a) Comparison pictures of the measured products; Figure 2 (b) is a schematic diagram of linear fitting;

[0062] Depend on Figure 2 (a) It can be seen that with the increase of concentration, the color of the product changes from light yellow to dark yellow, and the B value gradually decreases.

[0063] The miRNA-21 concentration range of 10pM-1nM was refitted to obtain the following Figure 2 (c) shows the linear fitting diagram of miRNA-21 concentration range of 10pM-1nM; Figure 2 (c) shows that the linear regression equation in the miRNA-21 concentration range of 10pM-1nM is B=126.8-103.7c miRNA-21 (R 2 =0.993), that is, the linear regression coefficient of B value , ; The detection limit LOD is 9.5pM.

[0064] Example 3 Synthesis of the nanoprobe LGBN and characterization of the probe's response to miRNA-21 by polyacrylamide gel electrophoresis (PAGE)

[0065] The RCA long chain in Example 1 was characterized by PAGE, and the results were as follows: Figure 3 As shown in (a), Figure 3 (a) It can be seen that a new band appeared in Lane 4, indicating the successful synthesis of the circular template CT. The sample in Lane 5 was retained in the sample loading tank, indicating the formation of a product with a larger molecular weight, which verified the successful progress of the RCA reaction.

[0066] The PAGE characterization results of the synthesis process of the nanoprobe LGBN in Example 1 and the response process of the probe to miRNA-21 in Example 2 are as follows: Figure 3 (b) As shown in Figure 3 (b) It can be seen that the band representing the Blocker chain in Lane 4 completely disappeared, indicating that the Blocker chain was successfully loaded onto the RCA long chain and the nanoprobe LGBN probe was successfully constructed. In Lane 7, after adding miRNA-21, the same band as Lane 6 (double-stranded hybridization of miRNA-21 and Blocker chain) appeared, indicating the successful response of the probe to miRNA-21. Finally, after adding miRNA-21 and Exo III enzyme to Lane 8, the double-stranded disappeared and a band representing miRNA-21 appeared, verifying the feasibility of using Exo III enzyme for signal amplification.

[0067] Example 4 Particle size characterization and circular dichroism characterization of RCA product and nanoprobe LGBN

[0068] The particle sizes of the RCA long chain and the nanoprobe LGBN of Example 1 were measured by dynamic light scattering. Figure 4 As shown, the horizontal axis is the particle size Size, and the vertical axis is the dynamic light scattering intensity Intensity; Figure 4 (a) It can be seen that the average particle sizes of the RCA long chain and the nanoprobe LGBN are approximately 187.4nm and 219.7nm, respectively. The results show that after loading the Blocker chain, the particle size of the nanoprobe increases significantly, indicating the successful loading of the Blocker chain.

[0069] Then, the formation of single-stranded G-quadruplex in the probe was characterized by circular dichroism. Figure 4 b, where the horizontal axis is the wavelength and the vertical axis is the circular dichroism CD signal value; Figure 4 (b) It can be seen that the RCA product and the nanoprobe LGBN after adding miRNA-21 have negative peaks at around 240nm and a positive peak at 270nm, which is consistent with the characteristic peak of the G-quadruplex single chain, indicating that the G-quadruplex single chain is successfully formed in the two, while the absence of the characteristic peak of the G-quadruplex single chain in the nanoprobe LGBN indicates that the Blocker chain successfully blocked the formation of the G-quadruplex single chain. In summary, the results of the circular dichroism spectrum also illustrate the responsiveness of the probe to miRNA-21.

[0070] Example 5 Comparison of the analytical capabilities of free G-quadruplex single strand loaded with blocker strand probe FGBN and nanoprobe LGBN for miRNA-21

[0071] The signal responses of different concentrations of miRNA-21 were examined using free G-quadruplex single-stranded loaded blocker chain formation probe FGBN and the nanoprobe LGBN prepared in Example 1. The results are as follows: Figure 5 As shown, Figure 5 (a) and Figure 5 The vertical axis of (c) is the absorbance value Abs, and the horizontal axis is the wavelength Wavelength. Figure 5 (b) and Figure 5 The vertical axis of (d) is the signal response value A / A 0, the horizontal axis is the concentration of miRNA-21 ,Depend on Figure 5 (a) and Figure 5 (b) It can be seen that when the concentration of miRNA-21 is 10pM–1nM, the signal response value of the nanoprobe LGBN to miRNA-21 ( A / A 0) is linearly related to the concentration of miRNA-21, and the related linear equation is: A / A 0=1.346+2.236c miRNA-21 (R 2 =0.992), the detection limit LOD was 8.3pM.

[0072] Depend on Figure 5 (c) and Figure 5 (d) It can be seen that the signal response value of probe FGBN to miRNA-21 is linearly related to the concentration of miRNA-21 in the range of 100pM-1nM, and the related linear equation is: A / A 0=1.002+1.093c miRNA-21 (R 2 =0.996), the detection limit LOD was 79.7pM.

[0073] In summary, compared with the probe FGBN, the sensitivity of the nanoprobe LGBN was increased by about 2.1 times, and the LOD was reduced by about 9.6 times. The above results show that the nanoprobe LGBN has better analytical ability for miRNA-21.

[0074] Example 6 Comparison of the reaction kinetics of free G-quadruplex single strand loaded with blocker strand by probe FGBN and nanoprobe LGBN to miRNA-21

[0075] The probe FGBN loaded with the Blocker chain by the free G-quadruplex single chain and the nanoprobe LGBN prepared in Example 1 were used to detect the response rate of miRNA-21 of the same concentration. The results are as follows: Figure 6 As shown by Figure 6It can be seen that at 45 minutes, the absorbance Abs of the nanoprobe LGBN to miRNA-21 (LGBN+miRNA-21) is close to the maximum value, that is, the reaction is over, while at this time, the probe FGBN to miRNA-21 (probe FGBN+miRNA-21) only reaches half of its maximum signal response value, and it takes 90 minutes to fully react. This shows that the nanoprobe LGBN has a confinement effect, which can greatly increase the reaction rate and reduce the reaction time.

[0076] Example 7 Detection of the specific response ability of the nanoprobe LGBN to miRNA-21 and the anti-interference ability to ions and macromolecules in serum samples

[0077] In addition to miRNA-21, other miRNAs are included in the serum samples. At the same time, the sequence of miRNA-21 is mismatched. MS-1, MS-2, and MS-3 are miRNAs with 1, 2, and 3 mismatched bases in the base sequence, respectively. The positions of the mismatched bases are shown in the bases marked with wavy lines. The sequences of each miRNA are shown in Table 1.

[0078] Table 1

[0079]

[0080] Measure the signal response value of the nanoprobe LGBN to each miRNA ( A / A 0), the result is as follows Figure 7 As shown in (a), it can be seen from the figure that the nanoprobe LGBN has almost no signal response ability to other miRNAs in serum and mismatched MS-1, MS-2, and MS-3.

[0081] Serum also contains many ions and biomacromolecules, including: Na + , K + Mg 2+ , Ca 2+ 、H2PO4 + , threonine Thr, leucine Leu and tryptophan Trp; these substances may interfere with the detection of miRNA-21 by the probe. The nanoprobe LGBN was used to detect miRNA-21 mixed with different ions or biomacromolecules. The results are as follows Figure 7 As shown in (b), it can be seen from the figure that the ions and biomacromolecules in the serum have almost no effect on the nanoprobe LGBN, and the nanoprobe LGBN has good anti-interference ability.

Claims

1. A method for preparing a nanoprobe for detecting miRNA-21, wherein the nanoprobe for detecting miRNA-21 is constructed by RCA reaction according to the sequence of miRNA-21 to form a long RCA chain rich in a G-quadruplex sequence, and a Blocker chain is loaded on the long RCA chain to obtain a nanoprobe, characterized in that: The specific steps are as follows: S1: Designing primer strands, template strands and blocker strands according to the miRNA-21 sequence; using the primer strands and template strands to prepare a circular template CT; The DNA sequence of miRNA-21 is: TAGCTTATCAGACTGATGTTGA; The DNA sequence of the primer strand is: TCGGCTTAGCCTCAACCCCCA; The DNA sequence of the template chain is: PO4 / GGCTAAGCCGACCCTAACCCCAGTCTGATCCCTAACCCTGGGGGTTGA; wherein PO4 / means a phosphate group is modified at the 5' end of the DNA chain; The DNA sequence of the Blocker strand is: CCCCAGTCTGATAAGCTA; S2: RCA long chains were synthesized using the circular template CT; S3: Take 100 μL of RCA long chain, add 64 μL of 30 μM Blocker chain and 10 μL of 2 M MgCl2; add ultrapure water to 240 μL, mix well and incubate at 37°C for 1 hour to obtain the nanoprobe LGBN for detecting miRNA-21.

2. The preparation method according to claim 1, characterized in that: The specific method of preparing the circular template in step S1 is: preparing the primer chain and the template chain into a primer chain solution and a template chain solution with a concentration of 10 μM respectively by using TE buffer; wherein the pH of the TE buffer is 7.4; Take 80 μL of primer chain solution and template chain solution respectively, mix them into 40 μL of 10×T4 DNA ligase buffer, and use ultrapure water to make up to 394 μL; heat the mixture at 95°C for 10 min, cool it to 25°C for annealing after heating; add 6 μL of T4 DNA ligase to the annealed product, mix well, and cyclize at 16°C for 16 h, and finally heat at 65°C for 10 min to inactivate the circular template CT.

3. The preparation method according to claim 1, characterized in that: The specific method for synthesizing the RCA long chain in step S2 is as follows: 30 μL of circular template CT, 10 μL of 10 mM dNTP, 5 μL of 10× phi 29 DNA ligase buffer, 48 μL of ultrapure water, 5 μL of 1 M KCl and 2 μL of phi 29 DNA polymerase are mixed, incubated at 30° C. for 30 min, and after the reaction is completed, heated at 65° C. for 10 min to inactivate the RCA long chain.

4. A use of the nanoprobe for detecting miRNA-21 according to claim 1, characterized in that: Used for preparing a kit for detecting miRNA-21.

5. The use according to claim 4, characterized in that: The kit includes liquid A and liquid B, wherein the liquid A is composed of 20 μL of nanoprobe LGBN for detecting miRNA-21, 2 μL of Exo III enzyme with a concentration of 20 U / L, 6 μL of KCl with a concentration of 1 M, 10 μL of HEPES buffer and 18 μL of hemin with a concentration of 1 μM; wherein the pH of the HEPES buffer is 7.4; The B solution is composed of 27.6 μL of 5 mM TMB colorimetric solution, 86 μL of 3% H2O2, and 426.4 μL of 0.2 M citric acid-Na2HPO4; wherein the pH of citric acid-Na2HPO4 is 5.

4.

6. The use according to claim 5, characterized in that: The method of using the kit is as follows: P1: Take 4 μL of the serum sample to be tested and mix it with the reagent A of the kit and react at 37°C for 45 min; P2: Add solution B to the product after reaction in P1, mix well and react for 1 minute; P3: Add 300 μL of 2M H2SO4 to the product after the P2 reaction; determine the RGB value of the product or the ultraviolet absorbance at a wavelength of 450 nm, and calculate the miRNA-21 concentration of the serum sample to be tested based on the RGB value or ultraviolet absorbance.

7. The use according to claim 6, characterized in that: The method for calculating the concentration based on ultraviolet absorbance is as follows: measure the ultraviolet absorbance of the product after the serum reacts with the kit at a wavelength of 450nm , according to the formula , the concentration of miRNA-21 in the assay product can be calculated ,in, and is the linear regression coefficient of UV absorbance, It is the absorbance at 450nm of the product obtained after the reaction of ultrapure water and the reagents in the kit.

8. The use according to claim 6, characterized in that: The method for calculating the concentration based on the RGB value is as follows: photograph the product after the serum and the kit react, extract the RGB value of the product, take the blue channel B value, and calculate the concentration based on the formula , the concentration of miRNA-21 in the assay product can be calculated ,in and is the linear regression coefficient of B value.

Images