Preparation and application of an inhalable liposome and mannose-modified chitosan composite nanocarrier

Abstract

The present invention belongs to the field of nano drug preparations, and specifically relates to a method for preparing a composite nanocarrier using inhalable liposomes and mannose-modified chitosan, and its application in the treatment of acute lung injury. The composite nanocarrier prepared by the present invention contains inhalable liposomes, which can act directly on the lungs, effectively avoid the first-pass effect of the liver, reduce systemic side effects, prolong the action time of the drug, and improve the bioavailability of the drug. Furthermore, by using mannose-modified chitosan to coat the inhalable liposomes, the composite nanocarrier can be specifically bound to the mannose receptor on the surface of macrophages, thereby achieving sustained-release targeted delivery of the drug, and surprisingly, the composite nanocarrier containing two drugs, miR-214 inhibitor and curcumin, can achieve the effect of synergistic treatment of acute lung injury under a suitable mass ratio.

Description

Technical Field

[0001] The invention belongs to the field of nano drug preparations, and specifically relates to a preparation method of a chitosan composite nano carrier modified with inhalable liposomes and mannose, and an application of the chitosan composite nano carrier in treating acute lung injury. Background Art

[0002] Inhalable liposomes refer to drug delivery systems that deliver liposome drugs to the lungs by means of atomization inhalation or powder inhalation. Compared with conventional oral liposomes, they make full use of the advantages of the lungs with rich capillary networks and large absorption areas, so that drugs can quickly enter the blood circulation, achieve local targeting of drugs, reduce the distribution of drugs in other parts of the body, and avoid the first-pass effect of the liver, thereby reducing systemic side effects, prolonging the duration of drug action, and improving the bioavailability of drugs. Due to its direct effect on the lungs, it is particularly suitable for the treatment of respiratory diseases such as acute lung injury, chronic obstructive pulmonary disease, asthma, etc. In addition, due to the advantages of liposomes that can protect nucleic acid drugs such as mRNA from degradation by enzymes in plasma and tissues, and avoid rapid clearance by the liver and kidneys, with the continuous development of nanotechnology and biotechnology, inhalable liposomes have broad development prospects as a popular delivery system for nucleic acid drugs such as mRNA.

[0003] Acute lung injury (ALI) is a serious respiratory disease, mainly manifested by dyspnea and insufficient oxygen supply. It is the early stage of acute respiratory distress syndrome. Its pathogenesis is complex, involving multiple links such as inflammatory response and oxidative stress. At present, the treatment methods for acute lung injury are limited and the efficacy is poor.

[0004] Noncoding RNA-214 (miR-214) is a noncoding RNA that belongs to the microRNA (miRNA) family. It is usually about 22 nucleotides in length and plays an important regulatory role in cells. Studies have shown that during acute lung injury, the expression level of miR-214 usually changes, and these changes may be related to the inflammatory response, apoptosis, proliferation, and repair process of lung tissue. By inhibiting the expression or function of miR-214, the inflammatory response of acute lung injury can be reduced, apoptosis can be inhibited, and cell proliferation and repair can be promoted, thereby improving the prognosis of acute lung injury.

[0005] Curcumin, a polyphenol extracted from ginger plants, has multiple biological activities, including anti-inflammatory, antioxidant, free radical scavenging, anti-tumor, antibacterial, and pharmacological effects on the cardiovascular system and digestive system. It can inhibit the inflammatory response in acute lung injury, reduce the infiltration of inflammatory cells and the release of inflammatory mediators, remove excess free radicals in the body, and reduce the damage of oxidative stress to lung tissue. Curcumin can protect the structure and function of lung tissue and promote the repair and regeneration of lung tissue.

[0006] As potential drugs for the treatment of acute lung injury, miR-214 inhibitors and curcumin have the effects of regulating inflammatory response and anti-oxidative stress. However, the current direct administration or conventional oral liposomes still have problems such as low bioavailability and poor targeting. Therefore, it is of great significance to develop a composite nano-delivery system of combined miR-214 inhibitors and curcumin with high efficiency and targeting. Summary of the invention

[0007] In order to solve the shortcomings and deficiencies of the prior art, the primary purpose of the present invention is to provide a method for preparing an inhalable liposome and mannose-modified chitosan composite nanocarrier.

[0008] Another object of the present invention is to provide a composite nanocarrier prepared by the above preparation method.

[0009] Another object of the present invention is to provide the use of the above-mentioned composite nanocarrier in treating acute lung injury.

[0010] The present invention is implemented by the following technical solutions:

[0011] A method for preparing an inhalable liposome and mannose-modified chitosan composite nanocarrier comprises the following steps:

[0012] Preparation of inhalable liposomes: Soybean lecithin and distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG) were mixed and dissolved in an ethanol aqueous solution, stirred and preheated to obtain a phospholipid solution. The miR-214 inhibitor and curcumin were dissolved in an ethanol aqueous solution to fully dissolve them to obtain a drug solution; the above phospholipid solution and the drug solution were mixed in a 250mL eggplant-shaped bottle, 5ml of chloroform was added, and ultrasonication was performed to completely dissolve them, and rotary evaporation was performed on a rotary evaporator at 37°C to form a uniform film. 100-250ml of pH 6.0 phosphate buffer solution was added, and the mixture was placed in a shaker and shaken for 2h, and then ultrasonication was performed to obtain a miR-214-curcumin liposome suspension, which was spray-dried to obtain a powder.

[0013] Preparation of mannosylated chitosan: Chitosan was dissolved in an acidic aqueous solution containing 1% glacial acetic acid, stirred at room temperature for 5 hours, and the pH of the chitosan solution was adjusted to 6.0 using a 5 mol / L sodium hydroxide solution. Mannose and sodium cyanoborohydride were added to the resulting viscous solution. The reaction mixture was stirred at room temperature for 24 hours, dialyzed for 7 days, and freeze-dried to obtain the finished product.

[0014] Preparation of composite nanocarriers: The miR-214 inhibitor-curcumin liposome powder and the finished product of mannosylated chitosan were re-dissolved to obtain the corresponding solution, the above-mentioned miR-214 inhibitor-curcumin liposome suspension and mannosylated chitosan solution were mixed, stirred at room temperature for 2 hours, and the chitosan was coated on the surface of the liposomes by electrostatic action. Subsequently, centrifugation and dialysis were performed to remove the unbound mannosylated chitosan, and the composite nanocarriers were collected and freeze-dried for storage.

[0015] The soybean lecithin and distearoyl phosphatidylethanolamine-polyethylene glycol (DSPE-PEG) described in step (1) are mixed in a mass ratio of 1 to 7:1.

[0016] The content of ethanol in the ethanol aqueous solution described in step (1) is 0-8% (v / v).

[0017] The stirring speed in step (1) is 300 to 800 rpm, and the stirring time is 30 to 60 min.

[0018] The total amount of phospholipids described in step (1) is mixed with ethanol aqueous solution in a mass (mg) to volume (mL) ratio of 1 to 5:1.

[0019] The miR-214 inhibitor and curcumin described in step (1) are mixed in a mass ratio of 1:1 to 5.

[0020] The nucleotide sequence of miR-214 in step (1) is: GGGUCUGUGGUCGAUCCUGCUGU, and the miR-214 inhibitor is the antisense complementary sequence of miR-214, which is: ACAGCAGGAUCGACCACAGACCC.

[0021] The conditions of ultrasonic dispersion described in step (1) are: 100-500W ultrasound for 10 seconds to 15 minutes.

[0022] The molecular weight of the chitosan in step (2) is 50-100 KDa, and the degree of substitution of the mannosylated chitosan is 6-8%.

[0023] The stirring speed in step (2) is 300 to 800 rpm, and the stirring time is 30 to 60 min.

[0024] The miR-214 inhibitor-curcumin liposome powder and the mannosylated chitosan finished product described in step (3) are mixed in a mass ratio of 1:1 to 8.

[0025] The composite nanocarrier prepared in step (3) is preferably stored at 2-8°C.

[0026] A chitosan composite nanocarrier modified with inhalable liposome and mannose is prepared by the preparation method.

[0027] The application of the inhalable liposome and mannose-modified chitosan composite nanocarrier in biomedical engineering materials.

[0028] Specifically, the inhalable liposome and mannose-modified chitosan composite nanocarrier are used in the preparation of drugs for treating respiratory diseases.

[0029] The respiratory diseases include acute lung injury, chronic obstructive pulmonary disease, asthma, etc.

[0030] The drug also contains pharmaceutically acceptable excipients;

[0031] The pharmaceutically acceptable excipients are preferably: sustained-release agents, excipients, fillers, binders, wetting agents, disintegrants, absorption enhancers, surfactants, etc.;

[0032] The dosage form of the drug is aerosol, powder, etc.

[0033] Compared with the prior art, the present invention has the following advantages and effects:

[0034] The present invention provides a method for preparing a composite nanocarrier of chitosan modified by inhalable liposomes and mannose. The composite nanocarrier prepared by the method contains inhalable liposomes. Compared with conventional oral liposomes, the composite nanocarrier can directly act on the lungs, effectively avoid the first-pass effect of the liver, reduce systemic side effects, prolong the action time of the drug, and improve the bioavailability of the drug.

[0035] The composite nanocarrier prepared by the present invention contains two drugs for treating respiratory diseases, namely, miR-214 inhibitor and curcumin, which can achieve a combined and highly effective synergistic effect under a suitable mass ratio, and provides a new platform for the nanosystem for treating acute lung injury, which is of great significance in the research of safe and efficient treatment.

[0036] (3) The present invention uses mannose-modified chitosan to coat inhalable liposomes, wherein the surface properties of the chitosan modified by mannose are improved, making it easier to fuse with the organism and reducing potential immune responses, wherein mannose can specifically bind to the mannose receptors on the surface of macrophages, thereby achieving sustained-release targeted delivery of the drug.

[0037] The composite nano-carrier prepared by the present invention has the advantages of abundant sources, low cost, non-toxicity, biodegradability and high biocompatibility, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 is a morphological diagram of inhalable liposome 2;

[0039] Figure 2 is a particle size and morphology diagram of the composite nanocarrier 1;

[0040] Figure 3 The in vitro drug release behavior diagram of inhalable liposome 2 and composite nanocarrier 1-2;

[0041] Figure 4 The lung tissue pathological sections of mice in each group;

[0042] Figure 5 The graph shows the expression level of TNF-α inflammatory factor in peripheral blood of mice in each group;

[0043] Figure 6 The graph shows the expression level of IL-1β inflammatory factor in the peripheral blood of mice in each group. DETAILED DESCRIPTION

[0044] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0045] Unless otherwise specified, the reagents and raw materials of the present invention can be obtained from commercial sources.

[0046] Soy lecithin, DSPE-PEG, curcumin, and sodium cyanoborohydride were purchased from Shanghai Bioengineering; chitosan and mannose were purchased from Sigma; miR-214 and U6 primers were purchased from Shanghai Gene Pharmaceutical Co., Ltd.

[0047] Example 1 Preparation of inhalable liposomes containing mixed phospholipids in different mass ratios

[0048] Example 1-1: Preparation of inhalable liposome 1

[0049] Soybean lecithin and distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG) were mixed and dissolved in 50 mL of 4% (v / v) ethanol aqueous solution at a mass ratio of 1:1, and then stirred at 500 rpm for 30 min and preheated to obtain a phospholipid solution. 2 mg miR-214 inhibitor and 2 mg curcumin (mass ratio of 1:1) were dissolved in 50 mL of 4% (v / v) ethanol aqueous solution to fully dissolve them to obtain a drug solution; the above phospholipid solution and drug solution were mixed in a 250 mL eggplant-shaped bottle, 5 mL chloroform was added, ultrasonically dissolved to completely dissolve them, and rotary evaporated on a rotary evaporator at 37 ° C to form a uniform film. 100 mL pH 6.0 phosphate buffer solution was added, placed in a shaker and shaken for 2 h, and ultrasonically obtained miR-214 inhibitor-curcumin liposome suspension, which was spray-dried to obtain powder.

[0050] Example 1-2: Preparation of inhalable liposome 2

[0051] Soybean lecithin and distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG) were mixed and dissolved in 50 mL of 4% (v / v) ethanol aqueous solution at a mass ratio of 2:1, and then stirred at 500 rpm for 30 min and preheated to obtain a phospholipid solution. 2 mg miR-214 inhibitor and 2 mg curcumin (mass ratio of 1:1) were dissolved in 50 mL of 4% (v / v) ethanol aqueous solution to fully dissolve them to obtain a drug solution; the above phospholipid solution and drug solution were mixed in a 250 mL eggplant-shaped bottle, 5 mL chloroform was added, ultrasonically dissolved to completely dissolve them, and rotary evaporated on a rotary evaporator at 37°C to form a uniform film. 100 mL pH 6.0 phosphate buffer solution was added, placed in a shaker and shaken for 2 h, and then ultrasonically obtained miR-214 inhibitor-curcumin liposome suspension, which was spray-dried to obtain powder.

[0052] Example 1-3: Preparation of inhalable liposome 3

[0053] Soybean lecithin and distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG) were mixed and dissolved in 50 mL of 4% (v / v) ethanol aqueous solution at a mass ratio of 4:1, and then stirred at 500 rpm for 30 min and preheated to obtain a phospholipid solution. 2 mg miR-214 inhibitor and 2 mg curcumin (mass ratio of 1:1) were dissolved in 50 mL of 4% (v / v) ethanol aqueous solution to fully dissolve them to obtain a drug solution; the above phospholipid solution and drug solution were mixed in a 250 mL eggplant-shaped bottle, 5 mL chloroform was added, ultrasonically dissolved to completely dissolve them, and rotary evaporated on a rotary evaporator at 37°C to form a uniform film. 100 mL pH 6.0 phosphate buffer solution was added, placed in a shaker and shaken for 2 h, and then ultrasonically obtained miR-214 inhibitor-curcumin liposome suspension, which was spray-dried to obtain powder.

[0054] Example 2: Determination of particle size and drug encapsulation efficiency of inhalable liposomes 1-3

[0055] The inhalable liposomes prepared in the above preparation example were re-dissolved, and the particle size was measured using a Malvern laser particle size analyzer. The morphology of the inhalable liposomes 2 was observed using a transmission electron microscope, and the drug encapsulation efficiency was measured using an ultraviolet spectrophotometer. The calculation formula was: drug encapsulation efficiency % = (1-Mfree / Madministered) * 100%, where Mfree refers to the amount of free unbound drug, and Madministered refers to the total amount of administered drug.

[0056] The results are shown in Table 1. Figure 1 As shown. The measurement results show that the average particle size of the inhalable liposomes prepared by the present invention is about 120-160 nm, the shape is round, and it has good dispersibility. And by adjusting the mass ratio of soybean lecithin and distearoyl phosphatidylethanolamine-polyethylene glycol (DSPE-PEG) in the range of 1:1-4:1, it is found that when the mass ratio of soybean lecithin and distearoyl phosphatidylethanolamine-polyethylene glycol (DSPE-PEG) is 2:1, it has a relatively high drug encapsulation rate. Subsequent experiments are all prepared with this mass ratio for composite nanocarriers.

[0057] Table 1:

[0058]

[0059] Example 3: Preparation of mannose-modified chitosan

[0060] 1000 mg of chitosan with a molecular weight of 100 KDa was dissolved in an acidic aqueous solution containing 1% glacial acetic acid, stirred at room temperature for 5 hours, and the pH of the chitosan solution was adjusted to 6.0 using a 5 mol / L sodium hydroxide solution. 100 mg of mannose and 5 mg of sodium cyanoborohydride were added to the resulting viscous solution. The reaction mixture was stirred at room temperature for 24 hours, dialyzed for 7 days, and freeze-dried to obtain the finished product. 5 mg of the finished product was vacuum dried overnight at 55°C, and the content of each element of carbon, nitrogen, and hydrogen in the finished product was determined using a trace element analyzer, and the degree of substitution of the mannose-modified chitosan was calculated according to the chemical formula. For specific values, see Table 2. The measurement results show that the degree of substitution of the mannose-modified chitosan prepared by the present invention is about 6-8%.

[0061] Table 2:

[0062]

[0063] Example 4: Preparation of composite nanocarriers containing miR-214 inhibitor and curcumin in different mass ratios

[0064] Example 4-1: Preparation of composite nanocarrier 1

[0065] The steps include:

[0066] (1) Preparation of inhalable liposomes: Soybean lecithin and distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG) were mixed and dissolved in 50 mL of 4% (v / v) ethanol aqueous solution at a mass ratio of 2:1, and then stirred at 500 rpm for 30 min and preheated to obtain a phospholipid solution. 2 mg of miR-214 inhibitor and 2 mg of curcumin were dissolved in 50 mL of 4% (v / v) ethanol aqueous solution at a mass ratio of 1:1 to fully dissolve them to obtain a drug solution; the above phospholipid solution and drug solution were mixed in a 250 mL eggplant-shaped bottle, 5 mL of chloroform was added, and ultrasonication was performed to completely dissolve them. The mixture was rotary evaporated on a rotary evaporator at 37°C to form a uniform film. 100 mL of pH 6.0 phosphate buffer solution was added, and the mixture was placed in a shaker and shaken for 2 h. The miR-214 inhibitor-curcumin liposome suspension was obtained by ultrasonication, and the powder was obtained after spray drying.

[0067] (2) Preparation of mannosylated chitosan: 1000 mg of chitosan with a molecular weight of 100 KDa was dissolved in an acidic aqueous solution containing 1% glacial acetic acid, stirred at room temperature for 5 h, and the pH of the chitosan solution was adjusted to 6.0 using a 5 mol / L sodium hydroxide solution. 100 mg of mannose and 5 mg of sodium cyanoborohydride were added to the resulting viscous solution. The reaction mixture was stirred at room temperature for 24 h, dialyzed for 7 days, and freeze-dried to obtain the finished product.

[0068] (3) Preparation of composite nanocarriers: The miR-214 inhibitor-curcumin liposome powder and the finished product of mannosylated chitosan were re-dissolved at a mass ratio of 1:4 to obtain 100 ml of the corresponding solution, and the miR-214 inhibitor-curcumin liposome suspension was mixed with the mannosylated chitosan solution. The mixture was stirred at room temperature for 2 h to allow the chitosan to be coated on the surface of the liposomes by electrostatic action. The unbound mannosylated chitosan was then removed by centrifugation and dialysis. The composite nanocarriers were then collected, frozen, and dried.

[0069] Example 4-2: Preparation of composite nanocarrier 2

[0070] The steps include:

[0071] (1) Preparation of inhalable liposomes: Soybean lecithin and distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG) were mixed and dissolved in 50 mL of 4% (v / v) ethanol aqueous solution at a mass ratio of 2:1, and then stirred at 500 rpm for 30 min and preheated to obtain a phospholipid solution. 2 mg miR-214 inhibitor and 4 mg curcumin were dissolved in 50 mL of 4% (v / v) ethanol aqueous solution at a mass ratio of 1:2 to fully dissolve them to obtain a drug solution; the above phospholipid solution and drug solution were mixed in a 250 mL eggplant-shaped bottle, 5 mL chloroform was added, and ultrasonication was performed to completely dissolve them. The mixture was rotary evaporated on a rotary evaporator at 37°C to form a uniform film. 100 mL pH 6.0 phosphate buffer solution was added, and the mixture was placed in a shaker and shaken for 2 h. The miR-214 inhibitor-curcumin liposome suspension was obtained by ultrasonication, and the powder was obtained after spray drying.

[0072] (2) Preparation of mannosylated chitosan: 1000 mg of chitosan with a molecular weight of 100 KDa was dissolved in an acidic aqueous solution containing 1% glacial acetic acid, stirred at room temperature for 5 h, and the pH of the chitosan solution was adjusted to 6.0 using a 5 mol / L sodium hydroxide solution. 100 mg of mannose and 5 mg of sodium cyanoborohydride were added to the resulting viscous solution. The reaction mixture was stirred at room temperature for 24 h, dialyzed for 7 days, and freeze-dried to obtain the finished product.

[0073] (3) Preparation of composite nanocarriers: The miR-214 inhibitor-curcumin liposome powder and the finished product of mannosylated chitosan were re-dissolved at a mass ratio of 1:4 to obtain 100 ml of the corresponding solution, and the miR-214 inhibitor-curcumin liposome suspension was mixed with the mannosylated chitosan solution. The mixture was stirred at room temperature for 2 h to allow the chitosan to be coated on the surface of the liposomes by electrostatic action. The unbound mannosylated chitosan was then removed by centrifugation and dialysis. The composite nanocarriers were then collected, frozen, and dried.

[0074] Example 4-3: Preparation of composite nanocarrier 3

[0075] (1) Preparation of inhalable liposomes: Soybean lecithin and distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG) were mixed and dissolved in 50 mL of 4% (v / v) ethanol aqueous solution at a mass ratio of 2:1, and then stirred at 500 rpm for 30 min and preheated to obtain a phospholipid solution. 2 mg miR-214 inhibitor and 8 mg curcumin were dissolved in 50 mL of 4% (v / v) ethanol aqueous solution at a mass ratio of 1:4 to fully dissolve them to obtain a drug solution; the above phospholipid solution and drug solution were mixed in a 250 mL eggplant-shaped bottle, 5 mL chloroform was added, and ultrasonication was performed to completely dissolve them. The mixture was rotary evaporated on a rotary evaporator at 37°C to form a uniform film. 100 mL of pH 6.0 phosphate buffer solution was added, and the mixture was placed in a shaker and shaken for 2 h. The miR-214 inhibitor-curcumin liposome suspension was obtained by ultrasonication, and the powder was obtained after spray drying.

[0076] (2) Preparation of mannosylated chitosan: 1000 mg of chitosan with a molecular weight of 100 KDa was dissolved in an acidic aqueous solution containing 1% glacial acetic acid, stirred at room temperature for 5 h, and the pH of the chitosan solution was adjusted to 6.0 using a 5 mol / L sodium hydroxide solution. 100 mg of mannose and 5 mg of sodium cyanoborohydride were added to the resulting viscous solution. The reaction mixture was stirred at room temperature for 24 h, dialyzed for 7 days, and freeze-dried to obtain the finished product.

[0077] (3) Preparation of composite nanocarriers: The miR-214 inhibitor-curcumin liposome powder and the finished product of mannosylated chitosan were re-dissolved at a mass ratio of 1:4 to obtain 100 ml of the corresponding solution, and the miR-214 inhibitor-curcumin liposome suspension was mixed with the mannosylated chitosan solution. The mixture was stirred at room temperature for 2 h to allow the chitosan to be coated on the surface of the liposomes by electrostatic action. The unbound mannosylated chitosan was then removed by centrifugation and dialysis. The composite nanocarriers were then collected, frozen, and dried.

[0078] Example 4-4: Preparation of composite nanocarrier 4

[0079] (1) Preparation of inhalable liposomes: Soybean lecithin and distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG) were mixed and dissolved in 50 mL of 4% (v / v) ethanol aqueous solution at a mass ratio of 2:1, and then stirred at 500 rpm for 30 min and preheated to obtain a phospholipid solution. 2 mg of miR-214 inhibitor was dissolved in 50 mL of 4% (v / v) ethanol aqueous solution to fully dissolve it to obtain a drug solution; the above phospholipid solution and drug solution were mixed in a 250 mL eggplant-shaped bottle, 5 mL of chloroform was added, and ultrasonication was performed to completely dissolve it. The solution was rotary evaporated on a rotary evaporator at 37°C to form a uniform film. 100 mL of pH 6.0 phosphate buffer solution was added, and the solution was placed in a shaker and shaken for 2 h. The miR-214 inhibitor liposome suspension was obtained by ultrasonication, and the powder was obtained after spray drying.

[0080] (2) Preparation of mannosylated chitosan: 1000 mg of chitosan with a molecular weight of 100 KDa was dissolved in an acidic aqueous solution containing 1% glacial acetic acid, stirred at room temperature for 5 h, and the pH of the chitosan solution was adjusted to 6.0 using a 5 mol / L sodium hydroxide solution. 100 mg of mannose and 5 mg of sodium cyanoborohydride were added to the resulting viscous solution. The reaction mixture was stirred at room temperature for 24 h, dialyzed for 7 days, and freeze-dried to obtain the finished product.

[0081] (3) Preparation of composite nanocarriers: The miR-214 inhibitor liposome powder and the finished product of mannosylated chitosan were re-dissolved in a mass ratio of 1:4 to obtain 100 ml of the corresponding solution, and the miR-214 inhibitor liposome suspension was mixed with the mannosylated chitosan solution. The mixture was stirred at room temperature for 2 h to allow the chitosan to be coated on the surface of the liposomes by electrostatic action. The unbound mannosylated chitosan was then removed by centrifugation and dialysis. The composite nanocarriers were then collected, frozen, and dried.

[0082] Example 4-5: Preparation of composite nanocarrier 5

[0083] (1) Preparation of inhalable liposomes: Soybean lecithin and distearoylphosphatidylethanolamine-polyethylene glycol (DSPE-PEG) were mixed and dissolved in 50 mL of 4% (v / v) ethanol aqueous solution at a mass ratio of 2:1, and then stirred at 500 rpm for 30 min and preheated to obtain a phospholipid solution. 4 mg of curcumin was dissolved in 50 mL of 4% (v / v) ethanol aqueous solution to fully dissolve it and obtain a drug solution; the above phospholipid solution and the drug solution were mixed in a 250 mL eggplant-shaped bottle, 5 mL of chloroform was added, and ultrasonication was performed to completely dissolve it. The solution was rotary evaporated on a rotary evaporator at 37°C to form a uniform film. 100 mL of pH 6.0 phosphate buffer solution was added, and the solution was placed in a shaker and shaken for 2 h. The curcumin liposome suspension was obtained by ultrasonication, and the powder was obtained after spray drying.

[0084] (2) Preparation of mannosylated chitosan: 1000 mg of chitosan with a molecular weight of 100 KDa was dissolved in an acidic aqueous solution containing 1% glacial acetic acid, stirred at room temperature for 5 h, and the pH of the chitosan solution was adjusted to 6.0 using a 5 mol / L sodium hydroxide solution. 100 mg of mannose and 5 mg of sodium cyanoborohydride were added to the resulting viscous solution. The reaction mixture was stirred at room temperature for 24 h, dialyzed for 7 days, and freeze-dried to obtain the finished product.

[0085] (3) Preparation of composite nanocarriers: Curcumin liposome powder and mannosylated chitosan finished product were re-dissolved in a mass ratio of 1:4 to obtain 100 ml of the corresponding solution, and the above curcumin liposome suspension was mixed with the above mannosylated chitosan solution. The mixture was stirred at room temperature for 2 h to allow chitosan to be coated on the surface of the liposomes by electrostatic action. The unbound mannosylated chitosan was then removed by centrifugation and dialysis. The composite nanocarriers were collected, frozen, and dried.

[0086] Example 6: Particle size determination of composite nanocarrier 1

[0087] The composite nanocarrier 1 prepared in the above preparation example was re-dissolved, and the particle size was measured using a Malvern laser particle size analyzer, and the morphology was observed using a transmission electron microscope. Figure 2 It can be seen that the average particle size of the composite nanocarrier 1 prepared by the present invention is about 200 nm, the morphology remains round, and it still has good dispersibility. Since the preparation method and process of composite nanocarriers 2-5 are the same as that of composite nanocarrier 1, those skilled in the art can infer that composite nanocarriers 2-5 also have good morphology and dispersibility.

[0088] Example 7: In vitro drug release behavior of inhalable liposomes and composite nanocarriers

[0089] Add the above-mentioned inhalable liposome 2 and composite nanocarrier 1-2 into the dialysis bag, tie the bag tightly, place it in pH 7.4 PBS buffer medium, place it in an air bath constant temperature oscillator at 37.0±0.5℃, and rotate at 300r·min. -1 The samples were taken at 0.5, 1, 2, 4, 8, 12 and 24 h, and fresh release medium was added in time. The content of drug release samples was determined by ultraviolet spectrophotometer, and the cumulative drug release percentage was calculated.

[0090] As can be seen from Figure 3, the composite nanocarrier 1-2 has a better sustained release effect than the inhalable liposome 2, and can basically reach a release of 90% within 24 hours. It can be seen that the use of mannosylated chitosan can significantly improve the sustained release effect of inhalable liposomes, thereby prolonging the drug's duration of action and improving patient compliance.

[0091] Example 8: Therapeutic test of composite nanocarrier on acute lung injury mice

[0092] The mice used in the experiment were clean-grade 6-week-old male C57BL / 6J mice (purchased from the Experimental Animal Center of Sun Yat-sen University, randomly divided into 7 groups according to body weight, 3 mice in each group), with an average body weight of 20±2g. They were placed in a closed box with a temperature of 25-26℃ and a humidity of 70% for feeding, and the experiment was conducted 7 days later.

[0093] Acute lung injury (ALI) model of mice: The mice were divided into 7 groups, namely: control group, model group, and treatment groups 1-5. The ALI model of mice was established by lipopolysaccharide (LPS) aerosol inhalation (modeling was assisted by air compression aerosolizer, flow rate 0.1ml / min, injury chamber container volume 700 cm3, aerosol concentration 2.5mg / ml, aerosol time 30min). After 24h of aerosol injury, it was found that the left and right lung tissues began to show obvious pathological damage, that is, the chronic sinusitis mouse model was established. After the model was successfully established, the control group was not treated; the model group used a homemade lung administration needle to simulate the administration process of saline; in the treatment groups 1-5, the mouse mouth was opened with a laryngoscope to expose the trachea, and 2ml of 2mg / ml composite nanocarrier 1-5 resuspension was sprayed directly into the lungs through the trachea with a homemade lung administration needle. The administration frequency was 2 times / day. After continuous administration for 1 week, the mice were bled and killed, and lung tissue samples were taken to prepare samples and detect relevant indicators.

[0094] Pathological examination: The upper lobe of the lung tissue was fixed in 4% paraformaldehyde, embedded in paraffin, and sliced. The pathological changes of the tissue were observed under a light microscope. HE staining slides were shown in Figure 4 .

[0095] Peripheral blood inflammatory factor levels: 6 hours after the last administration, 1 ml of aortic blood was collected from each group of mice. After treatment, the expression levels of TNF-α and IL-1β inflammatory factors in the peripheral blood of mice were determined by ELISA. The results are shown in Figure 5-6 .

[0096] Figure 4 As shown in the results, the lung tissue of mice in the ALI group induced by LPS was significantly damaged, and the alveolar structure of mice in the normal group was clear, the alveolar wall was thin, there was no bleeding, and there was no inflammatory cell infiltration. The alveoli of mice in the model group were collapsed, the alveolar wall was thickened, there was very obvious bleeding, and a large number of inflammatory cell infiltration symptoms; while in the treatment groups 1-5, the alveoli of the composite nanocarrier 4 containing the miR-214 inhibitor alone and the composite nanocarrier 5 containing curcumin alone still had partial collapse, a small part of bleeding, and a small amount of inflammatory cell infiltration symptoms, and the alveolar wall thickness was improved relative to the model group, but the composite nanocarrier 1-3 had extremely significant improvement in symptoms relative to the model group, that is, the combined use of miR-214 inhibitor and curcumin had a significant synergistic effect on acute lung injury, especially the alveoli containing the miR-214 inhibitor and curcumin composite nanocarrier 2 with a mass ratio of 1:2 were very complete, the alveolar wall was thin, and there was basically no inflammatory cell infiltration symptoms, and its effect was similar to that of the control group.

[0097] Figure 5-6 As shown in the results, the concentrations of TNF-α and IL-1β in the serum of the mice in the model group were significantly increased. After treatment with composite nanocarriers 1-5, the concentrations of TNF-α and IL-1β in the serum of the mice in the treatment group decreased. However, surprisingly, the combined use of composite nanocarriers 1-3 containing miR-214 inhibitor and curcumin made the concentrations of TNF-α and IL-1β lower, and there were significant differences (*P<0.05), especially the composite nanocarrier 2 containing miR-214 and curcumin with a mass ratio of 1:2, which had a very significant effect in reducing the concentrations of TNF-α and IL-1β (**P<0.01, ***P<0.001), indicating that the composite nanocarrier containing miR-214 and curcumin has a significant synergistic effect on reducing the concentrations of inflammatory factors TNF-α and IL-1β in acute lung injury, especially when the mass ratio of miR-214 inhibitor and curcumin is 1:2, the reducing effect is the best.

[0098] Furthermore, the combined effect of miR-214 inhibitor and curcumin was determined based on the combined Conbination Index (CI): CI>1 indicates drug antagonism, CI=1 indicates additive effect between drugs, and CI<1 indicates synergistic effect between drugs.

[0099] Conventional CalcuSyn software (Biosoft, Ferguson) was used to analyze and calculate the CI values ​​corresponding to the composite nanocarriers 1-3, and the results are shown in Table 3.

[0100] Table 3:

[0101]

[0102] From the results in Table 3, it can be seen that the mass ratio of miR-214 inhibitor and curcumin contained in the composite nanocarrier has a significant effect on the therapeutic effect. When the mass ratio of miR-214 inhibitor and curcumin is 1:2, the corresponding CI value is much less than 1, indicating that the composite nanocarrier at this value has a synergistic effect on the treatment of acute lung injury.

[0103] The protection scope of the present invention is not limited to the above-mentioned embodiments. Any equivalent substitution or change made by a person skilled in the art based on the present invention is within the protection scope of the present invention. The protection scope of the present invention is subject to the claims.

Claims

1. A method for preparing an inhalable liposome and a mannose-modified chitosan composite nanocarrier, comprising the following steps: (1) Preparation of inhalable liposomes: soybean lecithin and distearoyl phosphatidylethanolamine-polyethylene glycol (DSPE-PEG) were mixed and dissolved in 50 mL of ethanol aqueous solution, stirred and preheated to obtain a phospholipid solution, and miR-214 inhibitor and curcumin were dissolved in 50 mL of ethanol aqueous solution to fully dissolve them to obtain a drug solution; the above phospholipid solution and drug solution were mixed in a 250 mL eggplant-shaped bottle, 5 mL of chloroform was added, and ultrasonic was used to completely dissolve them, and rotary evaporated on a rotary evaporator at 37°C to form a uniform thin film, 100 mL of pH 6.0 phosphate buffer solution was added, and the mixture was placed in a shaker and shaken for 2 h, and then ultrasonically obtained. The miR-214 inhibitor-curcumin liposome suspension was spray-dried to obtain a powder, and the ethanol content in the ethanol aqueous solution was 4-8% (v / v); (2) Preparation of mannosylated chitosan: Chitosan was dissolved in an acidic aqueous solution containing 1% glacial acetic acid, stirred at room temperature for 5 h, the pH of the chitosan solution was adjusted to 6.0 using a 5 mol / L sodium hydroxide solution, mannose and 5 mg sodium cyanoborohydride were added to the resulting viscous solution, the reaction mixture was stirred at room temperature for 24 h, dialyzed for 7 days, and freeze-dried to obtain the finished product; (3) Preparation of composite nanocarriers: The miR-214 inhibitor-curcumin liposome powder and the finished product of mannosylated chitosan were re-dissolved to obtain 100 mL of the corresponding solution, and the miR-214 inhibitor-curcumin liposome suspension was mixed with the mannosylated chitosan solution. The mixture was stirred at room temperature for 2 h to allow the chitosan to be coated on the liposome surface by electrostatic action. The unbound mannosylated chitosan was then removed by centrifugation and dialysis. The composite nanocarriers were collected and freeze-dried for storage. in, The soybean lecithin and distearoyl phosphatidylethanolamine-polyethylene glycol (DSPE-PEG) described in step (1) are mixed at a mass ratio of 2:1; the miR-214 inhibitor and curcumin are mixed at a mass ratio of 1:2; the miR-214 inhibitor is the antisense complementary sequence of miR-214, which is: ACAGCAGGAUCGACCACAGACCC; The molecular weight of the chitosan in step (2) is 50-100 KDa; the degree of substitution of the mannosylated chitosan is 6-8%; The miR-214 inhibitor-curcumin liposome powder and the mannosylated chitosan finished product described in step (3) are mixed in a mass ratio of 1:4 to prepare a composite nanocarrier.

2. The preparation method according to claim 1, characterized in that The stirring speed in step (2) is 300 to 800 rpm, and the stirring time is 30 to 60 min.

3. The preparation method according to claim 1, characterized in that: The composite nanocarrier described in step (3) is stored at 2-8°C.

4. A chitosan composite nanocarrier using inhalable liposomes and mannose modified, characterized in that: The method is obtained by any one of the preparation methods of claims 1 to 3.

5. Use of the composite nanocarrier as claimed in claim 4 in preparing a drug for treating acute lung injury.

Images