A biomarker for patients with gastric cancer peritoneal metastasis and its application

Abstract

The present invention discloses a biomarker for patients with peritoneal metastasis of gastric cancer and its application, and relates to the field of biomedicine technology. The present invention provides a biomarker SMOC2 for patients with peritoneal metastasis of gastric cancer. By mining the public data set GSE62254 for gastric cancer, it is found that the expression of SMOC2 in the tumor tissue of patients with peritoneal metastasis is significantly increased, and patients with peritoneal metastasis with high expression of SMOC2 are closely associated with a worse survival prognosis. The present invention provides the application of the biomarker SMOC2 in tumor angiogenesis. Through the analysis of the GEO database and the TCGA database, it is found that the expression of SMOC2 is related to the expression of CD31 and CD34. In gastric cancer tissues with high expression of SMOC2, the number of microvessels is relatively large, which is a potential anti-angiogenesis target.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a biomarker for patients with gastric cancer peritoneal metastasis and an application thereof. Background Art

[0002] Gastric cancer is one of the most common malignant tumors in the world and the leading cause of cancer death worldwide. In 2020, the global incidence and mortality of gastric cancer ranked fifth and fourth, respectively. Peritoneal implantation metastasis is a common distant metastasis of gastric cancer, and its development process has multiple steps: (1) cancer cells detach from the primary tumor; (2) survival in the peritoneal microenvironment; (3) adhesion of free tumor cells to peritoneal mesothelial cells and invasion of the basement membrane; (4) angiogenesis promotes abnormal perfusion in the tumor; and (5) growth and progression of peritoneal metastases.

[0003] However, the specific mechanism of gastric cancer peritoneal metastasis is still unclear, and there is a lack of effective treatment methods in clinical practice, which seriously affects the long-term prognosis of patients. Therefore, it is of great clinical significance to explore the key targets in the process of gastric cancer peritoneal metastasis and design targeted intervention strategies, which will help improve the prognosis and survival rate of patients with gastric cancer peritoneal metastasis.

[0004] Through differentially expressed gene analysis and pathway enrichment analysis of the TCGA gastric cancer database, the present invention screened out modular calcium-binding protein 2 (SMOC2), which is highly expressed in patients with peritoneal metastasis of gastric cancer and is associated with poor prognosis. SMOC2 is a member of the SPARC family of extracellular matrix proteins. Studies have shown that SMOC2 can promote angiogenic activity by affecting the production of related vascular growth factors, such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF). Therefore, SMOC2 may play an important role in the process of peritoneal metastasis of gastric cancer.

[0005] At present, the research on biomarkers of gastric cancer peritoneal metastasis is still in the exploratory stage, with insufficient specificity and sensitivity, and is easily interfered by other factors, affecting the accuracy of diagnosis; at the same time, some detection technologies based on ELISA and high-throughput sequencing are costly, time-consuming, and have poor accessibility, which limits the wide application of biomarkers in clinical practice. The present invention uses SMOC2 as a biomarker for patients with gastric cancer peritoneal metastasis, and further studies its role in patients with gastric cancer peritoneal metastasis. Summary of the invention

[0006] The purpose of the present invention is to provide a biomarker for gastric cancer peritoneal metastasis population, which is used to predict the prognosis and intratumoral angiogenesis level of gastric cancer peritoneal metastasis patients.

[0007] To achieve the above technical problems, the present invention provides a biomarker for patients with gastric cancer peritoneal metastasis, including SMOC2. The inventors mined the gastric cancer public dataset GSE62254 and found that SMOC2 expression was significantly increased in tumor tissues of patients with gastric cancer peritoneal metastasis, and peritoneal metastasis patients with high SMOC2 expression were closely associated with worse survival prognosis.

[0008] The present invention discloses a biomarker for patients with gastric cancer peritoneal metastasis, comprising SMOC2.

[0009] Preferably, SMOC2 is highly expressed; or, the cutoff value of the expression amount of SMOC2 is 2.466051817-3.703448772.

[0010] The present invention discloses the use of the above biomarkers in preparing a cell model for regulating tumor angiogenesis and / or a cell model with high migration and invasion.

[0011] The invention discloses a cell model, which expresses the above biomarker, wherein the biomarker is SMOC2.

[0012] Preferably, the cutoff value of the expression amount of SMOC2 is 2.466051817-3.703448772; or, the cutoff value of the expression amount of SMOC2 is 1.305752277-2.442134619.

[0013] Preferably, the cells of the cell model are gastric cancer cells MKN1; or, the culture medium of the cell model is RPMI 1640 containing serum and peptide derivatives, the serum content in the culture medium is 8-12wt%, the peptide derivative content in the culture medium is 1-3wt%, and the peptide derivative has a peptide main group of glycyl-L-phenylalanyl-L-serine.

[0014] The present invention discloses a method for constructing the above-mentioned cell model, comprising: adding cells to a culture medium for cultivation, constructing a cell model, wherein the cell model expresses the above-mentioned biomarker, wherein the biomarker is SMOC2, and the culture medium of the cell model is RPMI 1640 containing serum and peptide derivatives, wherein the content of serum in the culture medium is 8-12wt%, the content of peptide derivatives in the culture medium is 1-3wt%, and the peptide derivatives have a peptide main group and a derivative group of glycyl-L-phenylalanyl-L-serine. Peptide derivatives are added to the culture medium to obtain a culture medium containing peptide derivatives, and the culture medium is used for MKN1 cultivation to promote MKN1 to express SMOC2 protein. The peptide derivatives participate in the expression of proteins by interacting with cells, thereby promoting cells to express SMOC2 protein, and then promoting cell migration.

[0015] Preferably, the peptide derivative is prepared by reacting glycyl-L-phenylalanyl-L-serine with methyl 2-bromobutyrate; or, in the preparation of the peptide derivative, glycyl-L-phenylalanyl-L-serine and methyl 2-bromobutyrate are reacted in a molar ratio of 1-5:1-5.

[0016] The present invention discloses the use of the above-mentioned peptide derivatives in preparing a cell model for regulating tumor angiogenesis and / or a cell model with high migration and invasion. The peptide derivatives have a peptide main group of glycyl-L-phenylalanyl-L-serine, and the above-mentioned biomarkers are highly expressed in the cell model.

[0017] Further preferably, the culture medium in the cell model culture with high expression of SMOC2 in the present invention can also simultaneously use peptide derivatives and (S)-2,6-diaminohexanoic acid hydrochloride. Peptide derivatives and (S)-2,6-diaminohexanoic acid hydrochloride are added to the culture medium to obtain a culture medium containing peptide derivatives and (S)-2,6-diaminohexanoic acid hydrochloride, and the culture medium is used for MKN1 culture to further promote MKN1 to express SMOC2 protein. (S)-2,6-diaminohexanoic acid hydrochloride may promote cell proliferation and synergistically act with peptide derivatives to further promote cell expression of SMOC2 protein, thereby promoting cell migration.

[0018] The preparation steps of the peptide derivatives of the present invention include: mixing glycyl-L-phenylalanyl-L-serine, acetonitrile and triethylamine, then adding methyl 2-bromobutyrate, reacting at room temperature for 1-4 hours, adding ethyl acetate, then washing with sodium carbonate for 1-3 times, washing with saturated brine for 1-3 times, drying, spin drying, and separating and purifying with a silica gel column to obtain the peptide derivatives.

[0019] Preferably, glycyl-L-phenylalanyl-L-serine, acetonitrile and triethylamine are mixed in a ratio of 1-5 mmol:1-5 ml:1-5 mmol.

[0020] Preferably, glycyl-L-phenylalanyl-L-serine and 2-bromobutyric acid methyl ester are used in a molar ratio of 1-5:1-5.

[0021] Preferably, acetonitrile and ethyl acetate are used in a volume ratio of 1-5:1-5.

[0022] Preferably, the concentration of sodium carbonate is 1-5M.

[0023] More preferably, the specific preparation steps of the peptide derivative are as follows: glycyl-L-phenylalanyl-L-serine and acetonitrile are mixed at a ratio of 1-5mmol:1-5ml, and then triethylamine is added dropwise at a molar ratio of glycyl-L-phenylalanyl-L-serine and triethylamine of 1-5:1-5. After sufficient mixing, methyl 2-bromobutyrate is added at a molar ratio of glycyl-L-phenylalanyl-L-serine and methyl 2-bromobutyrate of 1-5:1-5. After reacting at room temperature for 1-4h, ethyl acetate is added at a volume ratio of acetonitrile and ethyl acetate of 1-5:1-5, and then washed with 1-5M sodium carbonate 1-3 times, washed with saturated brine 1-3 times, dried over anhydrous sodium sulfate, spin-dried, and separated and purified by silica gel column to obtain the peptide derivative.

[0024] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a biomarker SMOC2 for people with peritoneal metastasis of gastric cancer. SMOC2 promotes the migration, invasion and in vivo metastasis of gastric cancer cells, and can be used to construct a prognostic evaluation model for people with peritoneal metastasis of gastric cancer. The present invention provides the role of SMOC2 in regulating tumor angiogenesis. SMOC2 can regulate the proliferation and tubular formation ability of vascular endothelial cells and is a potential anti-angiogenesis target. The present invention prepares peptide derivatives. When cells are cultured in a culture medium containing the peptide derivatives, the cells can be promoted to express SMOC2 protein, thereby promoting cell migration. Adding (S)-2,6-diaminohexanoic acid hydrochloride to the culture medium containing the peptide derivatives can further promote the expression of SMOC2 protein by cells, and further promote cell migration. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 For data mining workflow.

[0026] Figure 2 For screening of differentially expressed genes and pathway enrichment analysis.

[0027] Figure 3 is the expression level of SMOC2 in patients.

[0028] Figure 4 This is the curve of SMOC2 expression level and survival prognosis in patients with peritoneal metastasis.

[0029] Figure 5 The expression levels of SMOC2 in the primary and metastatic lesions of patients with both gastric cancer primary lesions and peritoneal metastases.

[0030] Figure 6 These are the WB results of cells in the MGC-SMOC2 transient knockdown group and the MGC- transient knockdown control group.

[0031] Figure 7These are the WB results of cells in the SGC-SMOC2 transient knockdown group and the SGC- transient knockdown control group.

[0032] Figure 8 These are the WB results of the MGC-SMOC2 stable knockdown group and the MGC-stable knockdown control group cells.

[0033] Fig. 9 These are the WB results of SGC-SMOC2 stable knockdown group and SGC-stable knockdown control group cells.

[0034] Fig.10 Shown are the WB results of cells in the MKN-SMOC2 overexpression group and the MKN-overexpression control group.

[0035] Fig.11 Shown are the QPCR results of cells in the MGC-SMOC2 overexpression group and the MGC-overexpression control group.

[0036] Fig.12 Shown are the QPCR results of cells in the SGC-SMOC2 overexpression group and the SGC-overexpression control group.

[0037] Fig.13 The migration and invasion abilities of cells in the MGC-SMOC2 overexpression group and the MGC-overexpression control group.

[0038] Fig.14 The migration and invasion abilities of cells in the SGC-SMOC2 overexpression group and the SGC-overexpression control group.

[0039] Fig.15 The migration and invasion abilities of cells in the MGC-SMOC2 transient knockdown group and the MGC- transient knockdown control group.

[0040] Fig.16 The migration and invasion abilities of cells in the SGC-SMOC2 transient knockdown group and the SGC- transient knockdown control group.

[0041] Fig.17 The migration ability of cells in the SGC-SMOC2 stable knockdown group, MGC-SMOC2 stable knockdown group, SGC-stable knockdown control group and MGC-stable knockdown control group.

[0042] Fig.18 Lung tissue size in the gastric cancer lung metastasis mouse model.

[0043] Fig.19 Peritoneal metastases in a mouse model of gastric cancer with SMOC2 knockdown.

[0044] Fig. 20 Fluorescence imaging of a mouse model of gastric cancer metastasis with peritoneal implantation in which SMOC2 is overexpressed.

[0045] Fig.21 This is a peritoneal tumor in a mouse model of gastric cancer metastasis with SMOC2 overexpression.

[0046] Fig. 22 Peritoneal tumor weight in the mouse model of gastric cancer metastasis with SMOC2 overexpression.

[0047] Fig.23 is the expression level of vascular endothelial cell markers CD31 and CD34 in patients.

[0048] Fig.24 This is the correlation between SMOC2 and CD31, CD34.

[0049] Fig.25 This is the expression of CD31 in the primary and metastatic lesions of patients with both gastric cancer primary lesions and peritoneal metastases.

[0050] Fig.26 This is the expression of CD34 in the primary and metastatic lesions of patients with both gastric cancer primary lesions and peritoneal metastases.

[0051] Fig. 27 This is the proliferation curve of the co-culture cell model.

[0052] Fig.28 Migration ability of the co-culture cell model.

[0053] Fig.29 This is tubule formation in vitro under a microscope.

[0054] Fig.30 This is the infrared spectrum of the peptide derivative. DETAILED DESCRIPTION

[0055] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0056] The experimental methods in the following examples, unless otherwise specified, are all conventional methods or conditions recommended by the manufacturer. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0057] The gastric cancer cells involved in this experiment include MKN1, SGC-7901, MGC-803 and MKN45.

[0058] Example 1: A biomarker SMOC2 for patients with gastric cancer peritoneal metastasis

[0059] Figure 1 In order to use the public dataset GSE62254 for preliminary data mining, the differentially expressed genes in patients with peritoneal metastasis and non-peritoneal metastasis gastric cancer were screened and pathway enrichment was analyzed. Figure 2 As shown, it was found that the upregulated genes in patients with gastric cancer peritoneal metastasis were mainly enriched in three pathways: angiogenesis, matrix adhesion and growth factor stimulation response, and 7 common expression genes were found.

[0060] The gastric cancer public dataset GSE62254 was analyzed and the results are as follows Figure 3 As shown in the results, it was found that SMOC2 expression was significantly increased in tumor tissues of patients with peritoneal metastasis compared with patients without peritoneal metastasis.

[0061] We analyzed 88 patients with peritoneal metastasis in the gastric cancer public dataset GSE62254, and determined the optimal cutoff value by transcriptome SMCO2 expression. When the cutoff value was between 1.305752277-2.442134619, SMOC2 was considered to be lowly expressed, with a total of 42 cases; when the cutoff value was between 2.466051817-3.703448772, SMOC2 was considered to be highly expressed, with a total of 46 cases. The results are shown in Figure 2. Figure 4 As shown in the results, it was found that high expression of SMOC2 was closely associated with worse survival prognosis in patients with peritoneal metastasis.

[0062] 1. Immunohistochemistry of gastric cancer clinical specimens

[0063] Twenty pairs of gastric cancer clinical specimens from patients with both primary lesions and peritoneal metastases were collected.

[0064] Immunohistochemistry was performed on the above-mentioned gastric cancer clinical specimens, and tumor sections were screened at low magnification (100×), and staining intensity and percentage were evaluated at high magnification (400×). All IHC stained sections were examined and evaluated by two independent pathologists in a blinded manner. The expression level of SMOC2 protein in gastric cancer clinical specimen sections was detected, and its correlation with the clinical pathological characteristics and survival prognosis of patients was analyzed. This study was approved by the Ethics Committee of Zhejiang Cancer Hospital, approval number: IRB-204-178, and complied with the Declaration of Helsinki. Informed consent was obtained from all participating patients. The antibody used for immunohistochemistry was SMOC2 antibody, purchased from Abcam, catalog number ab198715, and used at a ratio of 1:200.

[0065] The results are as follows Figure 5 As shown, SMOC2 expression was found to be significantly elevated in paired peritoneal metastases compared with gastric primary lesions.

[0066] 2. Effect of SMOC2 on migration and invasion of gastric cancer cells in vivo

[0067] 2.1 Establishment of in vitro cell model

[0068] SEQ ID NO. 1 (siRNA-SMOC2): GGAATTATTCTCCTGATC.

[0069] SEQ ID NO. 2 (shRNA-SMOC2): GATCCGCAAAGACTCCAAGTTGAATAATTCAAGAGATTATTCAACTTGGAGTCTTTGTTTTTTG.

[0070] SEQ ID NO. 3 (F): AGGTCGACTCTAGAGGATCCCGCCACCATGCTGCTCCCCCAGCTCTG.

[0071] SEQ ID NO. 4(R):TCCTTGTAGTCCATGGATCCTCCTGTTTCCTTGGCTGTCTATTAG.

[0072] The directions of the above sequences are all 5'-3'. SEQ ID NO. 1-4 were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0073] (1) Construction of transient knockdown SMOC2 cell model and transient knockdown control cell model

[0074] SMOC2-specific siRNA (siRNA-SMOC2) was designed, and the sequence of siRNA-SMOC2 is shown in SEQ ID NO.1. The siRNA was diluted with Opti-MEM medium, then mixed with the transfection reagent, and then added to 50% confluent SGC-7901 and MGC-803 cells for culture. The medium was changed after 24 hours, and the culture was continued for 48 hours. The cells were taken for verification. After confirming that SMOC2 was lowly expressed, a transient knockdown SMOC2 cell model was constructed, which can be used for subsequent experiments. The constructed cell models are SGC-SMOC2 transient knockdown group and MGC-SMOC2 transient knockdown group.

[0075] Blank siRNA was designed and synthesized, and a transient knockdown control cell model was constructed according to the experimental steps for constructing a transient knockdown SMOC2 cell model. The constructed cell models were SGC-transient knockdown control group and MGC-transient knockdown control group. The blank siRNA does not interact with SMOC2.

[0076] (2) Construction of SMOC2 stable knockdown cell model and stable knockdown control cell model

[0077] Design SMOC2-specific shRNA (shRNA-SMOC2), the sequence of shRNA-SMOC2 is shown in SEQ ID NO.2, the vector is PLKO.1-copGFP-Puro, and the shRNA-SMOC2 plasmid is constructed. One day in advance, HEK-293T cells are digested and passaged to a new 10 cm culture dish. When the cell density reaches 80%, the medium is replaced with DMEM medium containing 10% FBS and culture is continued. Prepare EP tube A and EP tube B: add shRNA-SMOC2 plasmid, pCMV-DR8.91 plasmid and pCMV-VSVG packaging plasmid to tube A and dilute, add PolyJet transfection reagent to tube B and dilute, mix tube A and tube B, let stand for 10 minutes, and then add to HEK-293T cell culture medium for transfection. Change the medium 10 hours after transfection, collect the cell culture medium at 48 hours and 72 hours of culture, centrifuge and filter, combine the filtrates to obtain the lentiviral solution, and save for later use. MGC-803 and SGC-7901 cells were passaged into 6-well plates, and when the cell density reached 80%, MGC-803 and SGC-7901 cells were infected with lentiviral solution for 48 hours. After infection, the medium was changed and puromycin was added, and the culture was continued for 3 days. The medium was changed, the surviving cells were amplified, and then the RNA and protein samples of the cells were extracted to detect the expression level of SMOC2. After confirming that SMOC2 was lowly expressed, a stable knockdown SMOC2 cell model was constructed, which can be used for subsequent experiments. The constructed cell models are SGC-SMOC2 stable knockdown group and MGC-SMOC2 stable knockdown group.

[0078] According to the experimental steps for constructing SMOC2 stable knockdown cell model, the shRNA-SMOC2 plasmid was replaced with PLKO.1-copGFP-Puro to construct a stable knockdown control cell model. The constructed cell models were SGC-stable knockdown control group and MGC-stable knockdown control group.

[0079] (3) Construction of SMOC2 overexpression cell model and control overexpression cell model

[0080] The SMOC2 gene was amplified by PCR. The front and rear primers for amplifying SMOC2 were shown in SEQ ID NO.3-4. The amplified SMOC2 gene was sequenced and compared for subsequent experiments. The amplified SMOC2 gene was mixed with the GV721 vector plasmid to construct a SMOC2 overexpression plasmid. HEK-293T cells were digested one day in advance and passaged to a new 10 cm culture dish. When the cell density reached 80%, the culture medium was replaced with DMEM medium containing 10% FBS and continued to be cultured. Prepare EP tube A and EP tube B: SMOC2 overexpression plasmid, pCMV-DR8.91 plasmid and pCMV-VSVG packaging plasmid were added to tube A and diluted, PolyJet transfection reagent was added to tube B and diluted, tube A and tube B were mixed, let stand for 10 minutes, and then added to HEK-293T cell culture medium for transfection. The medium was changed 10 hours after transfection, and the cell culture medium was collected and centrifuged at 48 hours and 72 hours of culture, and the filtrates were combined to obtain the lentiviral solution, which was stored for later use. MGC-803, SGC-7901 and MKN1 cells were passaged into 6-well plates, and when the cell density reached 80%, the lentiviral solution was used to infect MGC-803, SGC-7901 and MKN45 cells for 48 hours. After the infection, the medium was changed and puromycin was added, and the culture was continued for 3 days. The medium was changed, the surviving cells were amplified, and then the RNA and protein samples of the cells were extracted to detect the expression level of SMOC2. After confirming the overexpression of SMOC2, a stable overexpression SMOC2 cell model was constructed, which can be used for subsequent experiments. The constructed cell models are SGC-SMOC2 overexpression group, MGC-SMOC2 overexpression group and MKN-SMOC2 overexpression group.

[0081] According to the experimental steps of constructing the SMOC2 overexpression cell model, the SMOC2 overexpression plasmid was replaced with the GV721 vector plasmid to construct the overexpression control cell model. The constructed cell models were SGC-overexpression control group, MGC-overexpression control group and MKN-overexpression control group.

[0082] 2.2 Cell migration assay

[0083] A total of 12 cell models, including the transient knockdown group and transient knockdown control group of the above-mentioned MGC-803 and SGC-7901 cells; the stable knockdown group and the stable knockdown control group; the overexpression group and the overexpression control group, were counted, and 150,000 cells were added to the upper chamber of the Transwell chamber, and culture medium containing 10% serum was added to the lower chamber to carry out cell migration experiments.

[0084] 2.3 Cell invasion assay

[0085] Matrigel was added to the upper chamber of the Transwell chamber in advance and solidified for later use. After counting the 12 cell models mentioned above, 150,000 cells were added to the upper chamber of the Transwell chamber, and culture medium containing 10% serum was added to the lower chamber to carry out cell invasion experiments.

[0086] 2.4 Results Analysis

[0087] (1) Verification of SMOC2 expression in cell models

[0088] A total of 8 cell models were tested for transient and stable knockdown of MGC-803 and SGC-7901 cells. The expression level of SMOC2 in the cell models was detected by WB, with β-actin as the internal reference gene. The results are as follows Figure 6-9 As shown in the figure, it can be seen that after transient knockdown of MGC-803 and SGC-7901 cells, the relative expression levels of SMOC2 in the SGC-SMOC2 transient knockdown group and the MGC-SMOC2 transient knockdown group were lower than the relative expression levels of SMOC2 in the corresponding control group; after stable knockdown of MGC-803 and SGC-7901 cells, the above conclusions were also obtained.

[0089] There are two cell models with MKN-SMOC2 overexpression. The expression level of SMOC2 in the cell models was detected by WB, with GAPDH as the internal reference gene. The results are as follows Fig.10 As shown in the figure, it can be seen that after overexpression in MKN45 cells, the relative expression level of SMOC2 in the MKN-SMOC2 overexpression group is higher than that in the corresponding control group.

[0090] There are 4 cell models with overexpression of MGC-803 and SGC-7901 cells. The expression level of SMOC2 in the cell models was detected by QPCR. The results are as follows Figure 11-12 As shown in the figure, it can be seen that after overexpression of MGC-803 and SGC-7901 cells, the relative expression levels of SMOC2 mRNA in the SGC-SMOC2 overexpression group and the MGC-SMOC2 overexpression group were higher than those in the corresponding control group.

[0091] (2) Effects of SMOC2 on gastric cancer cells in vitro

[0092] from Fig.13 and Fig.14 It can be seen that SMOC2 overexpression promotes the migration and invasion ability of gastric cancer cells MGC-803 and SGC-7901. Fig.15 and 16It can be seen that transient knockdown of SMOC2 inhibits the migration and invasion ability of gastric cancer cells MGC-803 and SGC-7901. Fig.17 It can be seen that the in vitro migration ability of the cell models with stable knockdown of SMOC2 (SGC-SMOC2 stable knockdown group and MGC-SMOC2 stable knockdown group) was also significantly decreased.

[0093] 3. Effect of SMOC2 on the metastasis of gastric cancer cells in vivo

[0094] 3.1 Establishment of animal model

[0095] (1) Gastric cancer lung metastasis mouse model

[0096] BALB / c nude mice were inoculated with gastric cancer cell SGC-SMOC2 stable knockdown group and SGC- stable knockdown control group. The gastric cancer cell SGC-SMOC2 stable knockdown group and SGC- stable knockdown control group were digested and counted, and then slowly injected into 5-week-old BALB / c nude mice through the tail vein at 1 million cells / mouse to obtain SMOC2 knockdown group BALB / c nude mice and control group BALB / c nude mice. After 6 weeks, the nude mice were dissected to obtain lung tissues, and the lung metastases were observed, weighed, and photographed for record.

[0097] (2) Mouse model of gastric cancer peritoneal implantation and metastasis

[0098] A: NOD SCID mice were inoculated with gastric cancer cell SGC-SMOC2 stable knockdown group and SGC- stable knockdown control group. The gastric cancer cell SGC-SMOC2 stable knockdown group and SGC- stable knockdown control group were digested and counted, and injected into 4-week-old male NOD SCID mice by intraperitoneal injection at 10 million cells / mouse to obtain control group NOD SCID mice and SMOC2 knockdown group NOD SCID mice. After 6 weeks, the nude mice were killed by cervical dislocation, the abdominal cavity was exposed, the dissemination and implantation of cancer cells were directly observed, and photographed and recorded; at the same time, the implanted tumor nodules of the greater omentum and mesentery were peeled off, and the size and weight of the total tumor were measured.

[0099] B: NSG mice were inoculated with gastric cancer cells MKN-SMOC2 overexpression group and MKN-overexpression control group. Gastric cancer cells MKN-SMOC2 overexpression group and MKN-overexpression control group were digested and counted, and injected into 5-week-old male NSG mice by intraperitoneal injection at 2 million cells / mouse to obtain control group NSG mice and SMOC2 overexpression group NSG mice. After 21 days, active animal fluorescence imaging was performed, and then the mice were killed by cervical dislocation, the abdominal cavity was exposed for photography, and the weight of the tumor was weighed and statistically analyzed.

[0100] 3.2 Results Analysis

[0101] from Fig.18 As can be seen in the figure, in the gastric cancer lung metastasis mouse model, the lung tissue of the SMOC2 knockdown group BALB / c nude mice was significantly smaller than that of the control group BALB / c nude mice, indicating that knocking down SMOC2 can significantly inhibit the ability of gastric cancer cells to metastasize to the lung tissue. Fig.19 It can be seen that the ability of NOD SCID mice to form peritoneal nodules in the SMOC2 knockdown group was significantly reduced, which also indicates that knocking down SMOC2 can significantly inhibit the ability of gastric cancer cells to metastasize to the peritoneal cavity; Fig. 20 It can be seen that the relative fluorescence intensity of the peritoneum of NSG mice in the SMOC2 overexpression group is higher. Fig.21 and Fig. 22 It can be seen that the ability of peritoneal nodule formation in NSG mice in the SMOC2 overexpression group was significantly enhanced.

[0102] In summary, SMOC2 plays an important role in the process of gastric cancer peritoneal metastasis, can promote the migration and invasion of gastric cancer cells and metastasis in vivo, and can be used as a biomarker for patients with gastric cancer peritoneal metastasis.

[0103] Example 2: SMOC2 regulates tumor angiogenesis

[0104] like Fig.23 As shown in the analysis of the GEO database, the expression of two vascular endothelial cell markers CD31 and CD34 in the tumor tissue of patients with gastric cancer peritoneal metastasis was significantly enhanced compared with patients without peritoneal metastasis, suggesting that angiogenesis plays an important role in the process of gastric cancer peritoneal metastasis. Fig.24 As shown in the figure, the analysis results of TCGA database showed that the expression of SMOC2 in gastric cancer tissues was correlated with the expression of CD31 and CD34.

[0105] 1. Immunohistochemistry of gastric cancer clinical specimens

[0106] Immunohistochemistry was performed on 20 pairs of gastric cancer clinical specimens from patients with both primary lesions and peritoneal metastases. Tumor sections were screened at low magnification (100×), and staining intensity and percentage were evaluated at high magnification (400×). All IHC stained sections were examined and evaluated by two independent pathologists in a blinded manner. The expression level of SMOC2 protein in gastric cancer clinical specimen sections was detected, and immunohistochemical staining of CD31 and CD34 was performed to evaluate the state of angiogenesis in the tumor microenvironment. The antibodies used for immunohistochemistry included SMOC2 antibody, CD31 antibody, and CD34 antibody. Among them, SMOC2 antibody was purchased from Abcam, catalog number ab198715, and used at a ratio of 1:200; CD31 antibody was purchased from Abcam, catalog number ab28364, and used at a ratio of 1:50; CD34 antibody was purchased from Abcam, catalog number ab81289, and used at a ratio of 1:100.

[0107] In clinical samples of gastric cancer, Fig.25 As shown in Figure 2, the number of microvessels in peritoneal metastases was significantly increased compared with paired gastric cancer primary lesions. Fig.26 It was found that the microvessel density was higher in gastric cancer tissues with high expression of SMOC2, suggesting that SMOC2 also plays a role in regulating tumor angiogenesis during the peritoneal metastasis of gastric cancer.

[0108] 2. Establishment of cell co-culture model

[0109] Using a 0.4 μm pore size co-culture Transwell chamber, 2×10 5 Gastric cancer cells MGC-stable knockdown control group (MGC-sh-con) and MGC-SMOC2 stable knockdown group (MGC-sh-SMOC2) were inoculated in the upper chamber of a 6-well plate, and 2×10 5 In the lower chamber, 2×10 HUVECs were seeded in the lower chamber to construct the +MGC-sh-con and +MGC-sh-SMOC2 co-culture models. 5 The HUVEC single culture model was constructed by using 100 HUVECs.

[0110] After culturing the above model for 48 hours, endothelial cells were collected, and the migration ability of endothelial cells was detected by cell migration experiment, the invasion ability of endothelial cells was detected by cell invasion experiment, the proliferation ability of endothelial cells was detected by CCK8, and the angiogenesis effect of SMOC2-mediated gastric cancer cells on endothelial cells was explored by in vitro tubule formation experiment.

[0111] like Fig. 27 As shown in Figure 2, after knocking down SMOC2 in gastric cancer cells, the proliferation ability of endothelial cells in the MGC-sh-SMOC2 group was significantly decreased; Fig.28 As shown in Figure 2, after knocking down SMOC2 in gastric cancer cells, the migration ability of endothelial cells in the MGC-sh-SMOC2 group was significantly decreased; Fig.29 As shown in the results, it was found that after knocking down SMOC2 in gastric cancer cells, the tubular formation ability of endothelial cells in the MGC-sh-SMOC2 group was significantly reduced. The above results suggest that SMOC2 regulates tumor angiogenesis, but the specific mechanism still needs further experimental study.

[0112] Example 3: Construction and culture of a SMOC2 high-expression cell model

[0113] The gastric cancer cell MKN1 was used to construct a SMOC2 high-expression cell model. The density of MKN1 was adjusted to 3×10 5100 μg / mL, and a cell suspension was obtained. 2 mL of the cell suspension was added to a 6-well plate and cultured in an incubator. The culture medium was RPMI 1640 containing 10% serum.

[0114] Example 4: Construction and culture of a SMOC2 high-expressing cell model

[0115] The difference between Example 4 and Example 3 is that the culture medium used in Example 4 contains 1 wt % of the peptide derivative.

[0116] The preparation steps of peptide derivatives are as follows:

[0117] 130 mL of acetonitrile was added to 53.2 mmol of glycyl-L-phenylalanyl-L-serine while stirring; 58.5 mmol of triethylamine was then added dropwise to the system and mixed thoroughly; 55 mmol of methyl 2-bromobutyrate was then slowly added dropwise and reacted at room temperature for 2 h; 145 mL of ethyl acetate was added and mixed thoroughly, then washed once with a 2M sodium carbonate solution and twice with saturated brine; finally, dried with anhydrous sodium sulfate, spin-dried, and separated and purified using a silica gel column to obtain a peptide derivative.

[0118] Example 5: Construction and culture of a SMOC2 high-expression cell model

[0119] The difference between Example 5 and Example 4 is that the culture medium used in Example 5 contains 3 wt % of the peptide derivative. The preparation steps of the peptide derivative are as shown in Example 4.

[0120] Example 6: Construction and culture of a SMOC2 high-expression cell model

[0121] The difference between Example 6 and Example 5 is that the culture medium in Example 6 further contains (S)-2,6-diaminohexanoic acid hydrochloride. The culture medium contains 3 wt % of the peptide derivative and 1 wt % of (S)-2,6-diaminohexanoic acid hydrochloride.

[0122] Example 7: Construction and culture of a SMOC2 high-expressing cell model

[0123] The difference between Example 7 and Example 6 is that the culture medium in Example 7 contains 3 wt % of the peptide derivative and 2 wt % of (S)-2,6-diaminohexanoic acid hydrochloride.

[0124] Experimental Example 1: Protein expression of SMOC2

[0125] The cells of Examples 3-7 were cultured in a 6-well plate for 2 days, and then the expression of SMOC2 protein in the cells was detected by Western blotting. GAPDH was used as an internal reference protein, and the expression level of SMOC2 protein was quantified by Image J to obtain the relative gray value. The results are shown in Table 1.

[0126] Comparing Examples 3, 4, and 5, it can be seen that the protein expression level of SMOC2 in Examples 4 and 5 is higher. Examples 4 and 5 use a medium containing peptide derivatives to culture cells, indicating that the peptide derivatives can promote the expression of SMOC2 protein by cells, and the peptide derivatives can interact with cells to promote the expression of SMOC2 protein. Among them, the culture medium containing 3wt% of the peptide derivative can better promote the expression of SMOC2 protein by cells.

[0127] Compared with Examples 5, 6, and 7, it was found that the addition of (S)-2,6-diaminohexanoic acid hydrochloride can further improve the expression of SMOC2 protein. (S)-2,6-diaminohexanoic acid hydrochloride may promote cell proliferation, thereby increasing the expression level of SMOC2 protein. Among them, the culture medium containing 3wt% peptide derivatives and 2wt% (S)-2,6-diaminohexanoic acid hydrochloride can better promote the expression of SMOC2 protein by cells.

[0128] Table 1 Expression of SMOC2 protein

[0129]

[0130] Test Example 2: Cell migration ability

[0131] The gastric cancer cell MKN1 was respectively cultured with the culture medium of Examples 3-7 to adjust the cell density to 1×10 6 pcs / mL to obtain a cell suspension, and then 100 μl of the cell suspension was added to the upper chamber of the Transwell chamber, and RPMI 1640 containing 15% serum was added to the lower chamber to carry out a cell migration experiment. The results are shown in Table 2.

[0132] Comparing Examples 3, 4, and 5, it can be seen that the number of migrating cells in Examples 4 and 5 is larger. Examples 4 and 5 use a medium containing peptide derivatives to culture cells, indicating that peptide derivatives can promote cell migration. Peptide derivatives promote SMOC2 protein expression, thereby promoting cell migration. Among them, the culture medium containing 3wt% peptide derivatives can better promote cell migration.

[0133] Compared with Examples 5, 6, and 7, it was found that the addition of (S)-2,6-diaminohexanoic acid hydrochloride can further increase the number of migrating cells. (S)-2,6-diaminohexanoic acid hydrochloride may promote cell migration by promoting cell proliferation. Among them, the culture medium containing 3wt% peptide derivatives and 2wt% (S)-2,6-diaminohexanoic acid hydrochloride can better promote cell migration.

[0134] Table 2 Cell migration

[0135]

[0136] Experimental Example 3: Infrared spectrum of peptide derivatives

[0137] For infrared analysis of peptide derivatives, see Fig.30 , can be seen at 3300-3400cm -1 There is an amide stretching vibration peak near 1650-1750cm -1 There is a stretching vibration peak of carbon-oxygen double bond near 1200-13000cm -1 There are stretching vibration peaks of carbon, oxygen and carbon near 1600-1450cm -1 Near the peak is the stretching vibration peak of the carbon-carbon double bond of the benzene ring.

[0138] The embodiments and / or implementation methods described above are only used to illustrate the preferred embodiments and / or implementation methods for realizing the technology of the present invention, and are not intended to limit the implementation methods of the technology of the present invention in any form. Any technical personnel in this field may make slight changes or modifications to other equivalent embodiments without departing from the scope of the technical means disclosed in the content of the present invention, but they should still be regarded as technologies or embodiments that are essentially the same as the present invention.

Claims

1. A method for constructing a cell model, comprising: The cells are added to a culture medium for cultivation to construct a cell model, wherein the cell model expresses a biomarker, the biomarker is SMOC2, the culture medium of the cell model is RPMI 1640 containing serum and a peptide derivative, the content of serum in the culture medium is 8-12wt%, the content of the peptide derivative in the culture medium is 1-3wt%, and the cell model is a gastric cancer cell model; The peptide derivative is prepared by reacting glycyl-L-phenylalanyl-L-serine with 2-bromobutyric acid methyl ester; in the preparation of the peptide derivative, glycyl-L-phenylalanyl-L-serine and 2-bromobutyric acid methyl ester are reacted in a molar ratio of 1-5:1-5.

2. Use of a peptide derivative in preparing a cell model for regulating tumor angiogenesis and / or a cell model with high migration and invasion, wherein the peptide derivative is prepared by reacting glycyl-L-phenylalanyl-L-serine with methyl 2-bromobutyrate; in the preparation of the peptide derivative, glycyl-L-phenylalanyl-L-serine and methyl 2-bromobutyrate are reacted in a molar ratio of 1-5:1-5, and the cell model is a gastric cancer cell model; a biomarker is highly expressed in the cell model, and the biomarker is SMOC2; the cutoff value of the expression amount of SMOC2 is 2.466051817-3.703448772.

Images