Method for creating high and low temperature sterile safe two-line sterile line by rapidly polymerizing rice temperature and humidity sensitive sterile genes

Abstract

The invention discloses a method for creating a high and low temperature sterile safe two-line sterile line by rapidly polymerizing rice temperature and humidity sensitive sterile genes. The invention provides a method for preparing male sterile rice in two-line hybrid rice, which comprises the following step: polymerizing a homozygous temperature-sensitive sterile gene and a homozygous humidity-sensitive sterile gene in rice to be improved to obtain the temperature-humidity-sensitive male sterile rice. Compared with the existing thermo-sensitive sterile line for breeding the two-line hybrid rice, the method provided by the invention overcomes the problem of low purity of hybrid F1 seeds caused by unstable fertility of the sterile line due to temperature, and can ensure the production safety of the two-line hybrid rice. According to the method disclosed by the invention, any stable dominant rice conventional material can be rapidly created into the temperature and humidity sensitive sterile line with stable sterility, so that creation of germplasm resources of the novel sterile line of hybrid rice and innovative development of new quality productivity of seed industry are greatly promoted, and more technical guarantees are provided for guaranteeing national food safety.

Description

Technical Field

[0001] The invention belongs to the field of gene engineering and molecular breeding, and relates to a method for rapidly polymerizing rice temperature-humidity-sensitive sterile genes to create a high-low temperature sterile safe two-line sterile line. Background Art

[0002] Hybrid vigor refers to the phenomenon that after two individuals with certain genetic differences are hybridized, the offspring produced are significantly better than the hybrid parents. The main way to utilize hybrid vigor in rice is through hybrid rice breeding, which mainly includes two-line method and three-line method. The three-line method requires a maintenance line, a sterile line and a restorer line. The two-line method does not require a maintenance line. Whether the male sterile line in the two-line method is fertile is affected by the surrounding environment such as light, temperature, and humidity.

[0003] Environmentally sensitive male sterility includes photosensitive sterility (light intensity sensitive sterility), thermosensitive sterility (temperature sensitive sterility) and humidity sensitive sterility (humidity sensitive sterility). Currently, thermosensitive sterility lines are mainly used in two-line hybrid rice. In China, Annong S-1 is the first discovered indica thermosensitive sterility line, and its sterility is controlled by the tms5 gene. Currently, more than 95% of the two-line hybrid rice in China use the tms5 gene. Since the tms5 gene is relatively stable in inheritance, more than 95% of the male sterility lines of two-line hybrid rice currently use this gene. Due to the uncertainty of temperature changes in nature, the safety of thermosensitive sterility line seed production is an important factor restricting the application of two-line hybrid rice. Therefore, selecting different environmentally sensitive sterility genes and making comprehensive use of these genes is conducive to improving the safety of two-line hybrid rice breeding.

[0004] Rice moisture-sensitive sterility is a type of male sterility that produces fruit normally under high humidity conditions, but not under low humidity conditions. Research by the Institute of Botany, Chinese Academy of Sciences, found that OSC12 can catalyze 2,3-epoxysqualene to produce a dicyclic triterpene compound "feather taperol". The pollen grains produced by rice plants lacking OSC12 function have significantly reduced components of the pollen coat, and the pollen grains are not effectively protected and lose water rapidly, showing male sterility in an environment with a humidity below 60%. South China Agricultural University has identified a moisture-sensitive sterile mutant hms1, which shows complete sterility in an environment with a humidity below 45%. The fertility of these moisture-sensitive sterile lines is only affected by the humidity of the environment during the flowering period, and hybrids can be prepared in areas with drought and little rain in summer, thus breaking through the current geographical limitations of the use of rice hybrid vigor. Summary of the invention

[0005] The purpose of the present invention is to provide a method for rapidly polymerizing rice temperature-humidity-sensitive sterile genes to create a safe two-line sterile line with high and low temperature sterility.

[0006] The invention provides a method for preparing male sterile rice in two-line hybrid rice, comprising the following steps: aggregating a homozygous thermosensitive sterile gene and a homozygous humidity-sensitive sterile gene into the rice to be improved to obtain thermosensitive and humidity-sensitive male sterile rice.

[0007] The rice to be improved can be male sterile rice in two-line hybrid rice, or can be normal fertility rice. The male fertility loss of the male sterile rice is caused by the mutation of the temperature-sensitive fertility gene into the temperature-sensitive sterile gene in a homozygous mutation manner. The male fertility loss of the male sterile rice is caused by the mutation of the humidity-sensitive fertility gene into the humidity-sensitive sterile gene in a homozygous mutation manner.

[0008] The rice to be improved is male sterile rice in two-line hybrid rice, and the loss of male fertility is caused by the mutation of the temperature-sensitive fertility gene into the temperature-sensitive sterile gene in a homozygous mutation manner.

[0009] As a specific form (first form), the method is implemented in the following manner: taking the rice to be improved as the starting material, gene editing with the humidity-sensitive fertility gene as the target gene is performed, and then self-pollination is performed to obtain rice with homozygous temperature-sensitive sterility genes and homozygous humidity-sensitive sterility genes polymerized in the genomic DNA, that is, temperature-humidity-sensitive male sterile rice.

[0010] Specifically, the gene editing is achieved using the Cas9 system.

[0011] Specifically, the gene editing uses 2 sgRNAs.

[0012] Specifically, the two sgRNA target sites are both located in the 6th exon of the OsOSC12 gene.

[0013] Specifically, the two sgRNA target sites, one is shown in SEQ ID NO: 3, and the other is shown in SEQ ID NO: 4.

[0014] Specifically, the method includes the following steps: using the rice to be improved as the starting material, introducing a gene editing plasmid with a moisture-sensitive fertility gene as the target gene, culturing and obtaining T0 generation regenerated plants; screening transgenic plants from the T0 generation regenerated plants and self-pollinating, and the obtained offspring plants are T1 generation plants; screening plants that do not contain exogenous plasmids (i.e., the gene editing plasmid) and have a homozygous thermosensitive sterility gene and a homozygous mutation in the moisture-sensitive fertility gene from the T1 generation plants and self-pollinating, and the obtained offspring plants are T2 generation plants; if the T2 generation plants obtained by self-pollinating a certain T1 generation plant all meet the trait screening conditions, the T1 generation plant and its self-pollinated offspring are rice with homozygous thermosensitive sterility genes and homozygous moisture-sensitive sterility genes polymerized in their genomic DNA.

[0015] Specifically, the T0 generation regenerated plants are cultured in a low temperature and high humidity environment.

[0016] Specifically, the T1 generation plants are cultured in a low temperature and high humidity environment.

[0017] The rice to be improved can be rice 03S or its isotype line or its derived thermosensitive genic male sterile line.

[0018] The rice to be improved can be the dwarf japonica rice 15S or its isotype line or its derived thermosensitive genic male sterile line.

[0019] The rice to be improved can be Tsuen 211S or its isotype line or its derived thermo-sensitive genic male sterile line.

[0020] The rice to be improved can be rice 1892S or its isotype line or its derived thermosensitive genic male sterile line.

[0021] The rice to be improved can be Guangzhan 63S or its isotype line or its derived thermosensitive genic male sterile line.

[0022] The rice to be improved can be Nongken 58S or its isotype line or its derived thermosensitive genic male sterile line.

[0023] As an example, the temperature-sensitive fertility gene is the TMS5 gene, and the temperature-sensitive sterility gene is the tms5 gene.

[0024] As an example, the moisture-sensitive fertility gene is the OsOSC12 gene, and the moisture-sensitive sterility gene is the osc12 gene.

[0025] Specifically, the gene editing plasmid is a gene editing plasmid based on the Cas9 system.

[0026] Specifically, the gene editing plasmid contains a target 1 gRNA expression cassette (as shown in nucleotides 9024-9618 in SEQ ID NO: 1, coding chain) and a target 2 gRNA expression cassette (as shown in nucleotides 9623-10103 in SEQ ID NO: 1, coding chain).

[0027] As an example, the gene editing plasmid is a Cas9-OSC12 dual-target editing binary vector (the Cas9-OSC12 dual-target editing binary vector is a circular plasmid, formed by connecting two segments end to end: the first segment is shown in SEQ ID NO: 1, and the second segment is shown in SEQ ID NO: 2).

[0028] As an example, a method for identifying a plant with a homozygous mutation in a moisture-sensitive fertility gene is as follows: take plant leaves, extract genomic DNA, perform PCR amplification using a primer pair whose target gene is a moisture-sensitive fertility gene (for example, a primer pair consisting of primer osc12-F and primer osc12-R); sequence the PCR amplification product, and if the sequencing result of the PCR amplification product is only one and the sequencing result is different from the sequence of the corresponding segment in the wild-type gene, the plant is a plant with a homozygous mutation in the moisture-sensitive fertility gene. The sequence of the corresponding segment in the wild-type gene is obtained by using the genomic DNA of the leaves of the rice plant to be improved as a template, performing PCR amplification and sequencing using the primer pair.

[0029] As an example, a method for screening transgenic plants is as follows: take plant leaves, extract genomic DNA, and perform PCR amplification using a primer pair that uses the specific DNA in the exogenous plasmid as the target sequence (for example, a primer pair consisting of primer F1 and primer R1). If a characteristic amplification product of the expected size is displayed (for example, an amplification product of 963 bp), the plant is a transgenic plant.

[0030] As an example, a method for identifying plants that do not contain exogenous plasmids is as follows: take plant leaves, extract genomic DNA, and use a primer pair with a specific DNA in the exogenous plasmid as the target sequence (for example, a primer pair consisting of primer F1 and primer R1) to perform PCR amplification. If no amplification product is displayed, the plant does not contain exogenous plasmids.

[0031] As an example, a method for identifying a plant having a homozygous thermosensitive sterile gene: if the plant's genomic DNA contains the same thermosensitive sterile gene as that in the genome of the rice to be improved and is homozygous, the plant is a plant having a homozygous thermosensitive sterile gene.

[0032] As an example, a method for identifying a plant having a homozygous thermosensitive sterility gene is as follows: take plant leaves and extract genomic DNA; use the genomic DNA as a template and perform PCR amplification using a primer set consisting of primer tms5-P1, primer tms5-P2, primer tms5-P3 and primer tms5-P4; if the PCR amplification product contains a 184bp DNA fragment, the plant is a plant having a homozygous thermosensitive sterility gene.

[0033] The rice to be improved is male sterile rice in two-line hybrid rice, and the loss of male fertility is caused by the mutation of the moisture-sensitive fertility gene into the moisture-sensitive sterile gene in a homozygous mutation manner.

[0034] As a specific form (the second form), the method is implemented in the following manner: taking the rice to be improved as the starting material, gene editing with the temperature-sensitive fertility gene as the target gene is carried out, and then rice with homozygous temperature-sensitive sterility gene and homozygous humidity-sensitive sterility gene polymerized in the genomic DNA is obtained by self-pollination, that is, the temperature-humidity-sensitive male sterile rice.

[0035] Specifically, the method includes the following steps: using the rice to be improved as the starting material, introducing a gene editing plasmid with a temperature-sensitive fertility gene as the target gene, culturing and obtaining T0 generation regenerated plants; screening transgenic plants from the T0 generation regenerated plants and self-pollinating, and the obtained offspring plants are T1 generation plants; screening plants that do not contain exogenous plasmids (i.e., the gene editing plasmid) and have a homozygous moisture-sensitive sterility gene and a homozygous mutation in the temperature-sensitive fertility gene from the T1 generation plants and self-pollinating, and the obtained offspring plants are T2 generation plants; if the T2 generation plants obtained by self-pollinating a certain T1 generation plant all meet the trait screening conditions, the T1 generation plant and its self-pollinated offspring are rice with homozygous temperature-sensitive sterility genes and homozygous moisture-sensitive sterility genes polymerized in their genomic DNA.

[0036] Specifically, the T0 generation regenerated plants are cultured in a low temperature and high humidity environment.

[0037] Specifically, the T1 generation plants are cultured in a low temperature and high humidity environment.

[0038] The rice to be improved is rice with normal fertility.

[0039] As a specific form (the third form), the method is implemented in the following manner: taking the rice to be improved as the starting material, gene editing with temperature-sensitive fertility genes as target genes and gene editing with humidity-sensitive fertility genes as target genes are carried out, and then rice with homozygous temperature-sensitive sterility genes and homozygous humidity-sensitive sterility genes polymerized in the genomic DNA is obtained by self-pollination, which is temperature-humidity-sensitive male sterile rice.

[0040] Specifically, the method includes the following steps: using the rice to be improved as the starting material, introducing a gene editing plasmid with a temperature-sensitive fertility gene as the target gene and a gene editing plasmid with a moisture-sensitive fertility gene as the target gene, culturing and obtaining T0 generation regenerated plants; screening transgenic plants from the T0 generation regenerated plants and self-pollinating, and the obtained offspring plants are T1 generation plants; screening plants that do not contain exogenous plasmids (i.e., the gene editing plasmid) and have a homozygous mutation in the temperature-sensitive fertility gene and a homozygous mutation in the moisture-sensitive fertility gene from the T1 generation plants and self-pollinating, and the obtained offspring plants are T2 generation plants; if the T2 generation plants obtained by self-pollinating a certain T1 generation plant all meet the trait screening conditions, the T1 generation plant and its self-pollinated offspring are rice with homozygous temperature-sensitive sterility genes and homozygous moisture-sensitive sterility genes polymerized in their genomic DNA.

[0041] Specifically, the T0 generation regenerated plants are cultured in a low temperature and high humidity environment.

[0042] Specifically, the T1 generation plants are cultured in a low temperature and high humidity environment.

[0043] The rice to be improved is male sterile rice in two-line hybrid rice, and the loss of male fertility is caused by the mutation of the temperature-sensitive fertility gene into the temperature-sensitive sterile gene in a homozygous mutation mode.

[0044] As a specific form (the fourth form), the method is implemented in the following manner: taking the rice to be improved and rice having a homozygous humidity-sensitive sterility gene (rice having a homozygous humidity-sensitive sterility gene is also called donor rice of the homozygous humidity-sensitive sterility gene, referred to as donor rice) as parents, hybridization, backcrossing and self-pollination are carried out in sequence to obtain rice in which homozygous temperature-sensitive sterility genes and homozygous humidity-sensitive sterility genes are polymerized in genomic DNA, that is, the temperature-humidity-sensitive male sterile rice obtained by using the rice to be improved as the improved object.

[0045] Specifically, the hybridization is a first-generation hybridization.

[0046] Specifically, the backcrossing is a first-generation backcrossing.

[0047] Specifically, the selfing is continuous selfing for multiple generations.

[0048] Specifically, the selfing is continuous selfing for 4-7 generations.

[0049] Specifically, the method comprises the following steps: taking the rice to be improved and the donor rice as parents, hybridizing, and obtaining the offspring plants as F1 generation plants; backcrossing the F1 generation plants with the rice to be improved, and obtaining the offspring plants as BC1F1 generation plants; screening the plants "having the temperature-sensitive sterility gene and the moisture-sensitive sterility gene" from the BC1F1 generation plants, self-pollinating the screened plants, and obtaining the offspring plants as BC1F2 generation plants; starting from the BC1F2 generation plants, continuously performing the steps of screening and self-pollination for N generations, and obtaining the BC1F N+2 generation plants; if the BC1F N+2 generation plants obtained by self-pollination of a certain BC1F N+1 generation plant all meet the trait screening conditions, the BC1F N+1 generation plant and its self-pollinated offspring are rice with homozygous temperature-sensitive sterility genes and homozygous moisture-sensitive sterility genes in their genomic DNA.

[0050] The screening in the screening and self-pollination step refers to: screening plants "having homozygous temperature-sensitive sterile genes and homozygous humidity-sensitive sterile genes".

[0051] N is a natural number. Specifically, N is 1 or 2 or 3 or 4 or 5.

[0052] Specifically, the method comprises the following steps: taking the rice to be improved and the donor rice as parents, hybridizing, and obtaining the offspring plants as F1 generation plants; backcrossing the F1 generation plants with the rice to be improved, and obtaining the offspring plants as BC1F1 generation plants; screening the plants "having both the thermosensitive sterility gene and the humidity-sensitive sterility gene" from the BC1F1 generation plants, self-pollinating the screened plants, and obtaining the offspring plants as BC1F2 generation plants; screening the plants "having both the homozygous thermosensitive sterility gene and the homozygous humidity-sensitive sterility gene" from the BC1F2 generation plants, self-pollinating the screened plants, and obtaining the offspring plants as BC1F3 generation plants; screening the plants "having both the homozygous thermosensitive sterility gene and the homozygous humidity-sensitive sterility gene" from the BC1F3 generation plants. "sensitive sterile gene", the screened plants are self-pollinated, and the obtained offspring plants are BC1F4 generation plants; "having homozygous temperature-sensitive sterile gene and homozygous humidity-sensitive sterile gene" are screened from the BC1F4 generation plants, and the screened plants are self-pollinated, and the obtained offspring plants are BC1F5 generation plants; "having homozygous temperature-sensitive sterile gene and homozygous humidity-sensitive sterile gene" are screened from the BC1F5 generation plants, and the screened plants are self-pollinated, and the obtained offspring plants are BC1F6 generation plants; if the BC1F6 generation plants obtained by self-pollination of a BC1F5 generation plant all meet the trait screening conditions, the BC1F5 generation plant and its self-pollinated offspring are rice with homozygous temperature-sensitive sterile gene and homozygous humidity-sensitive sterile gene polymerized in their genomic DNA.

[0053] Specifically, the hybridization uses the rice to be improved as the female parent and the donor rice as the male parent.

[0054] Specifically, the backcrossing uses the hybrid offspring as the female parent and the rice to be improved as the male parent.

[0055] The rice to be improved can be rice 03S or its isotype line or its derived thermosensitive genic male sterile line.

[0056] The rice to be improved can be the dwarf japonica rice 15S or its isotype line or its derived thermosensitive genic male sterile line.

[0057] The rice to be improved can be Tsuen 211S or its isotype line or its derived thermo-sensitive genic male sterile line.

[0058] The rice to be improved can be rice 1892S or its isotype line or its derived thermosensitive genic male sterile line.

[0059] The rice to be improved can be Guangzhan 63S or its isotype line or its derived thermosensitive genic male sterile line.

[0060] The rice to be improved can be Nongken 58S or its isotype line or its derived thermosensitive genic male sterile line.

[0061] As an example, the donor rice is the temperature-humidity-sensitive male sterile rice prepared by the aforementioned method (the first form, the second form, or the third form).

[0062] As an example, the donor rice is the mutant hms1.

[0063] Specifically, the donor rice is rice having a homozygous temperature-sensitive sterile gene and a homozygous humidity-sensitive sterile gene.

[0064] Specifically, the culture conditions for self-pollinated plants are low temperature and high humidity environments.

[0065] As an example, the temperature-sensitive fertility gene is the TMS5 gene, and the temperature-sensitive sterility gene is the tms5 gene.

[0066] As an example, the moisture-sensitive fertility gene is the OsOSC12 gene, and the moisture-sensitive sterility gene is the osc12 gene.

[0067] As an example, the moisture-sensitive fertility gene is the HMS1 gene; the moisture-sensitive sterility gene is the hms1 gene.

[0068] As an example, a method for identifying plants carrying a moisture-sensitive sterile gene is as follows: plant leaves are taken, genomic DNA is extracted, and PCR amplification is performed using a primer pair whose target gene is the moisture-sensitive sterile gene (for example, a primer pair consisting of primer osc12-F and primer osc12-R or a primer pair consisting of primer hms1-F and primer hms1-R); the PCR amplification products are sequenced, and if the sequencing result of at least one of the PCR amplification products is the same as the sequence of the corresponding segment in the moisture-sensitive sterile gene of the donor rice, the plant is a plant carrying the moisture-sensitive sterile gene.

[0069] As an example, a method for identifying a plant having a homozygous moisture-sensitive sterile gene is as follows: take plant leaves, extract genomic DNA, and perform PCR amplification using a primer pair whose target gene is the moisture-sensitive sterile gene (for example, a primer pair consisting of primer osc12-F and primer osc12-R); sequence the PCR amplification product, and if the sequencing result of the PCR amplification product is one and is identical to the sequence of the corresponding segment in the moisture-sensitive sterile gene of the donor rice, the plant is a plant having a homozygous moisture-sensitive sterile gene.

[0070] As an example, a method for identifying a plant having a thermosensitive sterile gene: if the genomic DNA of a plant has the same thermosensitive sterile gene as that in the genome of the rice to be improved, the plant is a plant having the thermosensitive sterile gene.

[0071] As an example, a method for identifying a plant having a homozygous thermosensitive sterile gene: if the plant's genomic DNA contains the same thermosensitive sterile gene as that in the genome of the rice to be improved and is homozygous, the plant is a plant having a homozygous thermosensitive sterile gene.

[0072] As an example, a method for identifying plants with a thermosensitive sterility gene is as follows: take plant leaves and extract genomic DNA; use the genomic DNA as a template and perform PCR amplification using a primer set consisting of primer tms5-P1, primer tms5-P2, primer tms5-P3 and primer tms5-P4; if the PCR amplification product contains a 184bp DNA fragment, the plant is a plant with a thermosensitive sterility gene.

[0073] As an example, a method for identifying a plant having a homozygous thermosensitive sterility gene is as follows: take plant leaves and extract genomic DNA; use the genomic DNA as a template and perform PCR amplification using a primer set consisting of primer tms5-P1, primer tms5-P2, primer tms5-P3 and primer tms5-P4; if the PCR amplification product contains a 184bp DNA fragment, the plant is a plant having a homozygous thermosensitive sterility gene.

[0074] The rice to be improved is male sterile rice in two-line hybrid rice, and the loss of male fertility is caused by the mutation of the moisture-sensitive fertility gene into the moisture-sensitive sterile gene in a homozygous mutation manner.

[0075] As a specific form (the fifth form), the method is implemented in the following manner: taking the rice to be improved and rice with a homozygous thermo-sensitive sterility gene (rice with a homozygous thermo-sensitive sterility gene is also called donor rice of the homozygous thermo-sensitive sterility gene, referred to as donor rice) as parents, hybridization, backcrossing and self-pollination are carried out in sequence to obtain rice in which homozygous thermo-sensitive sterility genes and homozygous humidity-sensitive sterility genes are polymerized in genomic DNA, that is, the thermo-humidity-sensitive male sterile rice obtained by using the rice to be improved as the improved object.

[0076] Specifically, the hybridization is a first-generation hybridization.

[0077] Specifically, the backcrossing is a first-generation backcrossing.

[0078] Specifically, the selfing is continuous selfing for multiple generations.

[0079] Specifically, the selfing is continuous selfing for 4-7 generations.

[0080] Specifically, the method comprises the following steps: taking the rice to be improved and the donor rice as parents, hybridizing, and obtaining the offspring plants as F1 generation plants; backcrossing the F1 generation plants with the rice to be improved, and obtaining the offspring plants as BC1F1 generation plants; screening the plants "having the temperature-sensitive sterility gene and the moisture-sensitive sterility gene" from the BC1F1 generation plants, self-pollinating the screened plants, and obtaining the offspring plants as BC1F2 generation plants; starting from the BC1F2 generation plants, continuously performing the steps of screening and self-pollination for N generations, and obtaining the BC1F N+2 generation plants; if the BC1F N+2 generation plants obtained by self-pollination of a certain BC1F N+1 generation plant all meet the trait screening conditions, the BC1F N+1 generation plant and its self-pollinated offspring are rice with homozygous temperature-sensitive sterility genes and homozygous moisture-sensitive sterility genes in their genomic DNA.

[0081] The screening in the screening and self-pollination step refers to: screening plants "having homozygous temperature-sensitive sterile genes and homozygous humidity-sensitive sterile genes".

[0082] N is a natural number. Specifically, N is 1 or 2 or 3 or 4 or 5.

[0083] Specifically, the method comprises the following steps: taking the rice to be improved and the donor rice as parents, hybridizing, and obtaining the offspring plants as F1 generation plants; backcrossing the F1 generation plants with the rice to be improved, and obtaining the offspring plants as BC1F1 generation plants; screening the plants "having both the thermosensitive sterility gene and the humidity-sensitive sterility gene" from the BC1F1 generation plants, self-pollinating the screened plants, and obtaining the offspring plants as BC1F2 generation plants; screening the plants "having both the homozygous thermosensitive sterility gene and the homozygous humidity-sensitive sterility gene" from the BC1F2 generation plants, self-pollinating the screened plants, and obtaining the offspring plants as BC1F3 generation plants; screening the plants "having both the homozygous thermosensitive sterility gene and the homozygous humidity-sensitive sterility gene" from the BC1F3 generation plants. "sensitive sterile gene", the screened plants are self-pollinated, and the obtained offspring plants are BC1F4 generation plants; "having homozygous temperature-sensitive sterile gene and homozygous humidity-sensitive sterile gene" are screened from the BC1F4 generation plants, and the screened plants are self-pollinated, and the obtained offspring plants are BC1F5 generation plants; "having homozygous temperature-sensitive sterile gene and homozygous humidity-sensitive sterile gene" are screened from the BC1F5 generation plants, and the screened plants are self-pollinated, and the obtained offspring plants are BC1F6 generation plants; if the BC1F6 generation plants obtained by self-pollination of a BC1F5 generation plant all meet the trait screening conditions, the BC1F5 generation plant and its self-pollinated offspring are rice with homozygous temperature-sensitive sterile gene and homozygous humidity-sensitive sterile gene polymerized in their genomic DNA.

[0084] Specifically, the hybridization uses the rice to be improved as the female parent and the donor rice as the male parent.

[0085] Specifically, the backcrossing uses the hybrid offspring as the female parent and the rice to be improved as the male parent.

[0086] As an example, the donor rice is the temperature-humidity-sensitive male sterile rice prepared by the aforementioned method (the first form, the second form, or the third form).

[0087] Specifically, the donor rice is rice having a homozygous temperature-sensitive sterile gene and a homozygous humidity-sensitive sterile gene.

[0088] Specifically, the culture conditions for self-pollinated plants are low temperature and high humidity environments.

[0089] As an example, the temperature-sensitive fertility gene is the TMS5 gene, and the temperature-sensitive sterility gene is the tms5 gene.

[0090] As an example, the moisture-sensitive fertility gene is the OsOSC12 gene, and the moisture-sensitive sterility gene is the osc12 gene.

[0091] As an example, the moisture-sensitive fertility gene is the HMS1 gene; the moisture-sensitive sterility gene is the hms1 gene.

[0092] Any of the above-mentioned "trait screening conditions" is: cultivating male sterility in a non-low temperature and high humidity environment.

[0093] Any of the above-mentioned "trait screening conditions" is: cultivating male fertility in a low temperature and high humidity environment, and cultivating male sterility in a non-low temperature and high humidity environment.

[0094] When any of the above-mentioned "screening" is performed, excellent traits can be taken into consideration at the same time, that is, plants with excellent agronomic traits in the field can be screened.

[0095] During any of the above-mentioned "screening", plants having a high stigma exsertion rate may be screened at the same time (the stigma exsertion rate is beneficial to pollination and the stigma exsertion rate can be observed during the heading stage).

[0096] Specifically, the temperature-humidity-sensitive male sterile rice has the following characteristics: it is male fertile when cultivated in a low-temperature and high-humidity environment, and it is male sterile when cultivated in a non-low-temperature and high-humidity environment.

[0097] Specifically, the low temperature and high humidity environment refers to: the ambient temperature during the booting period is less than 24°C and the ambient humidity during the flowering period is ≥60%. Specifically, the low temperature and high humidity environment refers to: the ambient temperature during the booting period is 23°C and the ambient humidity during the flowering period is 80%.

[0098] Specifically, the non-low temperature and high humidity environment refers to: the environmental temperature during the booting period is ≥24° C. and / or the environmental humidity during the flowering period is <60%.

[0099] Specifically, the non-low temperature and high humidity environment is a high temperature and high humidity environment, a high temperature and low humidity environment, or a low temperature and low humidity environment.

[0100] Specifically, the high temperature and high humidity environment refers to: the ambient temperature in the booting stage is ≥24°C and the ambient humidity in the flowering stage is ≥60%. Specifically, the high temperature and high humidity environment refers to: the ambient temperature in the booting stage is 30°C and the ambient humidity in the flowering stage is 80%.

[0101] Specifically, the high temperature and low humidity environment refers to: the ambient temperature in the booting stage is ≥24°C and the ambient humidity in the flowering stage is <60%. Specifically, the high temperature and low humidity environment refers to: the ambient temperature in the booting stage is 30°C and the ambient humidity in the flowering stage is 50%.

[0102] Specifically, the low temperature and low humidity environment refers to: the ambient temperature during the booting period is less than 24°C and the ambient humidity during the flowering period is less than 60%. Specifically, the low temperature and low humidity environment refers to: the ambient temperature during the booting period is 23°C and the ambient humidity during the flowering period is 50%.

[0103] Specifically, any of the above-mentioned temperature-sensitive fertility genes is the TMS5 gene, and any of the above-mentioned temperature-sensitive sterility genes is the tms5 gene.

[0104] Specifically, any of the above moisture-sensitive fertility genes is the OsOSC12 gene, and any of the above moisture-sensitive sterility genes is the osc12 gene.

[0105] Specifically, any of the above moisture-sensitive fertility genes is the HMS1 gene, and any of the above moisture-sensitive sterility genes is the hms1 gene.

[0106] The NCBI number of the TMS5 gene is LOC4328713 (Gene ID: 4328713, updated on 12-Jul-2024). The TMS5 gene (wild-type gene) is a temperature-sensitive fertility gene, and its functional inactivation causes temperature-sensitive male fertility loss. tms5 gene: a functionally inactivated gene corresponding to the TMS5 gene (functional inactivation refers to temperature-sensitive male fertility loss). Specifically, the tms5 gene is a gene after a nucleotide change in the TMS5 gene, and the nucleotide change causes temperature-sensitive male fertility loss in rice.

[0107] The NCBI number of the OsOSC12 gene is LOC4344966 (Gene ID: 4344966, updated on 1-Aug-2024). The OsOSC12 gene (wild-type gene) is a moisture-sensitive fertility gene, and its functional inactivation causes moisture-sensitive male fertility loss. osc12 gene: a functionally inactivated gene corresponding to the OsOSC12 gene (functional inactivation refers to moisture-sensitive male fertility loss). Specifically, the osc12 gene is a gene after the OsOSC12 gene undergoes a nucleotide change, and the nucleotide change causes moisture-sensitive male fertility loss in rice.

[0108] The NCBI number of the HMS1 gene is LOC4336955 (Gene ID: 4336955, updated on 12-Jul-2024).

[0109] The HMS1 gene (wild-type gene) is a moisture-sensitive fertility gene, and its functional inactivation causes moisture-sensitive male fertility loss. hms1 gene: the functionally inactivated gene corresponding to the HMS1 gene (functional inactivation refers to moisture-sensitive male fertility loss). Specifically, the hms1 gene is a gene after the nucleotide change of the HMS1 gene, and the nucleotide change causes moisture-sensitive male fertility loss in rice.

[0110] In the present invention, the temperature-sensitive sterility gene (tms5 gene) and the moisture-sensitive sterility gene (osc12 gene or hms1 gene) are aggregated in the same genome to cultivate a polymerized system of temperature-sensitive sterility and moisture-sensitive sterility. Compared with the temperature-sensitive sterile line currently used for two-line hybrid rice breeding, the present invention overcomes the problem of low purity of hybrid F1 seeds due to unstable fertility of the sterile line caused by temperature, and can ensure the safety of two-line hybrid rice production. The present invention can quickly create any stable superior rice conventional material into a temperature-humidity-sensitive sterile line with stable sterility, greatly promoting the creation of new sterile line germplasm resources of hybrid rice and the innovative development of new quality productivity of the seed industry, and providing more technical guarantees for ensuring national food security.

[0111] The beneficial effects of the present invention are as follows: 1. Safe two-line hybrid rice seed production: for the first time, the thermosensitive sterile gene and the moisture-sensitive sterile gene are aggregated. Compared with the thermosensitive sterile line currently used for two-line hybrid rice breeding, the problem of unstable fertility of the sterile line caused by temperature is overcome, the purity of hybrid F1 seeds is guaranteed, and the safety of two-line hybrid rice seed production is ensured; 2. Overcoming the geographical limitations of hybrid seed production: the present invention aggregates the thermosensitive sterile gene and the moisture-sensitive sterile gene, and hybrids can be prepared in areas with high and low temperatures in summer and autumn, breaking through the current two-line hybrid rice seed production that requires an average temperature of more than 24.5°C in the middle and late stages of heading. ③ Improved breeding efficiency: Traditional rice breeding often relies on phenotypic selection and breeders' experience, with a long breeding cycle and low selection efficiency. The present invention utilizes gene editing technology to directionally improve rice moisture-sensitive fertility on the basis of rice temperature-sensitive sterility, which greatly shortens the breeding cycle and improves breeding efficiency; ④ The present invention can quickly create any stable superior rice conventional material into a temperature- and humidity-sensitive sterile system with stable sterility, greatly promoting the creation of new sterile system germplasm resources of hybrid rice and the innovative development of new quality productivity of the seed industry, providing more technical guarantees for ensuring national food security. BRIEF DESCRIPTION OF THE DRAWINGS

[0112] Figure 1 Schematic representation of the components of the binary vector for Cas9-OSC12 dual-target editing.

[0113] Figure 2 This is a schematic diagram of the process of Example 3.

[0114] Figure 3 This is a schematic diagram of the process of Example 4.

[0115] Figure 4 These are exemplary photographs of the microscopic examination of pollen fertility in Example 4. DETAILED DESCRIPTION

[0116] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0117] The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples are repeated three times, and the results are averaged.

[0118] The TMS5 gene (wild-type gene) is a temperature-sensitive fertility gene, and its functional inactivation causes temperature-sensitive male fertility loss. The NCBI number of the TMS5 gene is LOC4328713 (Gene ID: 4328713, updated on 12-Jul-2024). tms5 gene: the functionally inactivated gene corresponding to the TMS5 gene (functional inactivation refers to temperature-sensitive male fertility loss).

[0119] The OsOSC12 gene (wild-type gene) is a moisture-sensitive fertility gene, and its functional inactivation causes moisture-sensitive male fertility loss. The NCBI number of the OsOSC12 gene is LOC4344966 (Gene ID: 4344966, updated on 1-Aug-2024). osc12 gene: the functionally inactivated gene corresponding to the OsOSC12 gene (functional inactivation refers to moisture-sensitive male fertility loss).

[0120] The HMS1 gene (wild-type gene) is a moisture-sensitive fertility gene, and its functional inactivation causes moisture-sensitive male fertility loss. The NCBI number of the HMS1 gene is LOC4336955 (Gene ID: 4336955, updated on 12-Jul-2024). hms1 gene: the functional inactivation gene corresponding to the HMS1 gene (functional inactivation refers to moisture-sensitive male fertility loss).

[0121] In the embodiments, unless otherwise specified, the ambient temperature for rice cultivation is 23° C. In the embodiments, unless otherwise specified, the ambient humidity for rice cultivation is 80% by default. Since the male fertility is affected by the temperature during the booting period and the humidity during the flowering period, only the temperature during the booting period and the humidity during the flowering period are described in the embodiments. In the absence of description, the temperature is the default temperature and the humidity is the default humidity.

[0122] Example 1: Gene editing using CRISPR / Cas9 to obtain a thermo-humidity-sensitive male sterile line of indica rice

[0123] The variety right number of rice 03S is CNA20060418.X, the variety right authorization announcement date is January 1, 2010, and the variety right authorization announcement number is CNA002828G. Rice 03S is an indica thermosensitive male sterile line (the loss of male fertility is caused by the mutation of the TMS5 gene to the tms5 gene in a homozygous mutation manner). Rice 03S has the advantages of good rice quality, good plant type, high compatibility, easy seed production, and good disease resistance.

[0124] In this embodiment, rice 03S was used as the starting material, and CRISPR / Cas9 gene editing with OsOSC12 gene as the target gene was performed to obtain a new rice germplasm in which genomic DNA was aggregated with homozygous tms5 gene and homozygous osc12 gene, namely, a temperature-humidity-sensitive sterile line of indica rice.

[0125] 1. Construction of recombinant plasmid

[0126] 1. Through preliminary experiments, two sgRNA target sites located in the rice genomic DNA were screened. Both sgRNA target sites are located in the 6th exon of the OsOSC12 gene.

[0127] Target 1 (SEQ ID NO: 3): ATTATGGAGTCACTTCCGAA;

[0128] Target 2 (SEQ ID NO: 4): TGTCGGTCCTATAACAAGAT.

[0129] 2. Prepare the Cas9-OSC12 dual-target editing binary vector. The Cas9-OSC12 dual-target editing binary vector is a circular plasmid, which is formed by connecting two segments end to end: the first segment is shown in SEQ ID NO: 1, and the second segment is shown in SEQ ID NO: 2. In SEQ ID NO: 1, there is a hygromycin resistance gene (as shown in nucleotides 317-1342 in SEQ ID NO: 1, the template chain), a target 1 gRNA expression cassette (as shown in nucleotides 9024-9618 in SEQ ID NO: 1, the coding chain) and a target 2 gRNA expression cassette (as shown in nucleotides 9623-10103 in SEQ ID NO: 1, the coding chain). The schematic diagram of the elements of the Cas9-OSC12 dual-target editing binary vector is shown in Figure 1 .

[0130] 2. Genetic transformation and regeneration of plants

[0131] The Cas9-OSC12 dual-target editing binary vector was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was used to genetically transform the embryonic callus of rice 03S by the Agrobacterium infection method, and then the resistant callus was screened (50 mg / L hygromycin was used for resistance screening), and then differentiation and regeneration culture were performed, and then rooting culture was performed to obtain regenerated plants, which were T0 generation plants.

[0132] 3. Breeding of Thermo-Humidity-Sensitive Male Sterile Rice Lines

[0133] 1. Cultivate the T0 generation plants obtained in step 2 in an artificial climate chamber. Select transgenic plants from the T0 generation plants, and then self-pollinate the transgenic plants individually and harvest seeds, which are T1 generation seeds. Plants grown from T1 generation seeds are T1 generation plants.

[0134] Method for screening transgenic plants: Take plant leaves, extract genomic DNA, and use a primer pair consisting of primer F1 and primer R1 (the target sequence is located at the hygromycin phosphotransferase gene on the vector backbone, and the target sequence is 963bp) for PCR amplification. If an amplification product of 963bp is displayed, the plant is a transgenic plant.

[0135] F1 (SEQ ID NO: 5): 5'-AAAAGCCTGAACTCACCGC-3';

[0136] R1 (SEQ ID NO: 6): 5'-CTACACAGCCATCGGTCCA-3'.

[0137] 2. Cultivate T1 generation plants in an artificial climate chamber. Select plants from the T1 generation that "do not contain exogenous plasmids and have homozygous tms5 genes and homozygous mutations in the OsOSC12 gene", self-pollinate the selected plants and obtain seeds, which are T2 generation seeds. Plants grown from T2 generation seeds are T2 generation plants.

[0138] Method for identifying plants that do not contain exogenous plasmids: Take plant leaves, extract genomic DNA, and use a primer pair consisting of primer F1 and primer R1 (primer sequence see step 1) to perform PCR amplification. If no amplification product is displayed, the plant does not contain exogenous plasmids.

[0139] The method for identifying a plant with a homozygous mutation in the OsOSC12 gene is as follows: taking plant leaves, extracting genomic DNA, and performing PCR amplification using a primer pair consisting of primer osc12-F and primer osc12-R (the target gene is the OsOSC12 gene); sequencing the PCR amplification product, if the sequencing result of the PCR amplification product is only one and the sequencing result is different from the sequence of the corresponding segment in the wild-type gene, the plant is a plant with a homozygous mutation in the OsOSC12 gene. The sequence of the corresponding segment in the wild-type gene is obtained by using the genomic DNA of the leaves of the rice 03S plant as a template, using the primer pair consisting of primer osc12-F and primer osc12-R to perform PCR amplification and sequencing.

[0140] osc12-F (SEQ ID NO: 7): 5'-GAGGTCAAGTCGTCTTCTGCAATTA-3';

[0141] osc12-R (SEQ ID NO: 8): 5'-ATTTGTCTGCGCTCTGCACATG-3'.

[0142] The method for identifying a plant having a homozygous tms5 gene is as follows: taking plant leaves and extracting genomic DNA; using the genomic DNA as a template and using a primer set (the primer set consists of four primers, namely, primer tms5-P1, primer tms5-P2, primer tms5-P3 and primer tms5-P4) for PCR amplification; if the amplification product of the PCR amplification contains a 184 bp DNA fragment (called a characteristic DNA fragment), the plant is a plant having the tms5 gene; since rice 03S is a male sterile line of two-line hybrid rice in the prior art and has a homozygous tms5 gene, as long as a plant is identified as a plant having the tms5 gene, the plant must be a plant having the homozygous tms5 gene.

[0143] Primer tms5-P1 (SEQ ID NO: 9): AACCGGTAATGTCGTAAGGAAATG;

[0144] Primer tms5-P2 (SEQ ID NO: 10): GGCGTGGGAGATGAAGAGGAA;

[0145] Primer tms5-P3 (SEQ ID NO: 11): GCCGCCACCGGGTCGGCCGAAGTA;

[0146] Primer tms5-P4 (SEQ ID NO: 12): CGGTGAGGGGCGGCGCCTTCG.

[0147] 3. The T2 generation plants were cultured in an artificial climate chamber and divided into three groups (10 plants in each group), namely, the high temperature and high humidity group, the high temperature and low humidity group, and the low temperature and low humidity group. In the high temperature and high humidity group, the environmental temperature of the plants during the booting period was set to 30°C, and the environmental humidity during the flowering period was set to 80%. In the high temperature and low humidity group, the environmental temperature of the plants during the booting period was set to 30°C, and the environmental humidity during the flowering period was set to 50%. In the low temperature and low humidity group, the environmental temperature of the plants during the booting period was set to 23°C, and the environmental humidity during the flowering period was set to 50%.

[0148] During the cultivation process of step 3, pollen is continuously collected for examination under a microscope. If the pollen produced by self-pollination of a certain T1 generation plant under the above three treatments is 100% sterile, the T1 generation plant is the target plant.

[0149] The target plant screened is a new rice germplasm whose genomic DNA is aggregated with homozygous tms5 gene and homozygous osc12 gene. The target plant and its self-pollinated offspring are the temperature-humidity-sensitive sterile line of indica rice.

[0150] For the convenience of description, the indica rice thermo-humidity-sensitive sterile line obtained in this example is named thermo-humidity-sensitive sterile polymorphic rice TH03S-4, abbreviated as rice TH03S-4 (the T2 generation plants are used in subsequent examples).

[0151] Example 2: Gene editing using CRISPR / Cas9 to obtain a Japonica rice thermo-humidity sensitive male sterile line

[0152] The variety right number of rice dwarf japonica 15S is CNA20131056.2, the variety right authorization announcement date is April 23, 2018, and the variety right authorization announcement number is CNA010449G. Rice dwarf japonica 15S is a japonica thermosensitive male sterile line (its male fertility loss is caused by the homozygous mutation of the TMS5 gene to the tms5 gene).

[0153] In this example, rice dwarf japonica 15S was used as the starting material, and CRISPR / Cas9 gene editing with OsOSC12 gene as the target gene was performed to obtain a new rice germplasm whose genomic DNA was aggregated with homozygous tms5 gene and homozygous osc12 gene, namely, a japonica rice temperature-humidity-sensitive sterile line.

[0154] 1. Genetic transformation and regeneration of plants

[0155] The Cas9-OSC12 dual-target editing binary vector constructed in step 1 of Example 1 was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was used to genetically transform the embryonic callus of rice dwarf japonica 15S by the Agrobacterium infection method, and then the resistant callus was screened (50 mg / L hygromycin was used for resistance screening), and then differentiation and regeneration culture were performed, and then rooting culture was performed to obtain regenerated plants, namely T0 generation plants.

[0156] 2. Breeding of Thermo-Humidity-Sensitive Male Sterile Rice Lines

[0157] 1. Cultivate the T0 generation plants obtained in step 1 in an artificial climate chamber. Screen transgenic plants from the T0 generation plants (the method for screening transgenic plants is shown in step 3 of Example 1, 1), then self-pollinate the transgenic plants individually and harvest seeds, which are T1 generation seeds. Plants grown from T1 generation seeds are T1 generation plants.

[0158] 2. Cultivate T1 generation plants in an artificial climate chamber. Select plants from the T1 generation that "do not contain exogenous plasmids and have homozygous tms5 genes and homozygous mutations in the OsOSC12 gene", self-pollinate the selected plants and obtain seeds, which are T2 generation seeds. Plants grown from T2 generation seeds are T2 generation plants.

[0159] The method for identifying plants without exogenous plasmids is shown in step 3, step 2 of Example 1.

[0160] Method for identifying plants with homozygous mutations in the OsOSC12 gene: take plant leaves, extract genomic DNA, and perform PCR amplification using a primer pair consisting of primer osc12-F and primer osc12-R (primer sequences are shown in step 3 of Example 1, 2); sequence the PCR amplification products, and if the sequencing result of the PCR amplification products is only one and the sequencing result is different from the sequence of the corresponding segment in the wild-type gene, the plant is a plant with homozygous mutations in the OsOSC12 gene. The sequence of the corresponding segment in the wild-type gene is obtained by using the genomic DNA of the leaves of the dwarf japonica 15S plant as a template, and using a primer pair consisting of primer osc12-F and primer osc12-R to perform PCR amplification and sequencing.

[0161] A method for identifying plants having a homozygous tms5 gene: taking plant leaves and extracting genomic DNA; using the genomic DNA as a template and using a primer set (the primer set consists of four primers, namely primer tms5-P1, primer tms5-P2, primer tms5-P3 and primer tms5-P4, and the primer sequences are shown in step 3 of Example 1, 2) to perform PCR amplification; if the amplified product of the PCR amplification contains a 184 bp DNA fragment (called a characteristic DNA fragment), the plant is a plant having the tms5 gene; since Dwarf Japonica 15S is a male sterile line of two-line hybrid rice in the prior art and has a homozygous tms5 gene, as long as a plant is identified as a plant having the tms5 gene, the plant must be a plant having the homozygous tms5 gene.

[0162] 3. Same as step 3 of embodiment 1.

[0163] During the cultivation process of step 3, pollen is continuously collected for examination under a microscope. If the pollen produced by self-pollination of a certain T1 generation plant under the above three treatments is 100% sterile, the T1 generation plant is the target plant.

[0164] The target plant screened is a new rice germplasm whose genomic DNA is aggregated with homozygous tms5 gene and homozygous osc12 gene. The target plant and its self-pollinated offspring are the temperature-humidity-sensitive sterile line of japonica rice.

[0165] For the convenience of description, the thermo-humidity-sensitive male sterile line of japonica rice obtained in this example is named thermo-humidity-sensitive male sterile polymorphic rice TH Quanjing Rice S-1, abbreviated as TH Quanjing Rice S-1 (the T2 generation plants are used in subsequent examples).

[0166] Example 3: Obtaining a new indica thermo-humidity-sensitive male sterile line using thermo-humidity-sensitive male sterile poly rice as a moisture-sensitive gene donor

[0167] The variety right number of rice Quan 211S is CNA20173312.4, the variety right authorization announcement date is June 18, 2021, and the variety right authorization announcement number is CNA017120G. Rice Quan 211S is an indica thermosensitive male sterile line (its male fertility loss is caused by the mutation of the TMS5 gene to the tms5 gene in a homozygous mutation manner).

[0168] In this example, the rice TH03S-4 obtained in Example 1 was used as the osc12 gene donor, and the rice Quan 211S was used as the improvement object, and a new thermohygroscopic and moisture-sensitive sterile rice germplasm was created through hybridization, backcrossing and selfing. Figure 2 .

[0169] 1. Use rice Quan 211S as the female parent and rice TH03S-4 as the male parent for hybridization and harvest seeds, which are F1 generation seeds. Plants grown from F1 generation seeds are F1 generation plants. The female parent is cultured in an artificial climate chamber (the ambient temperature during the booting stage is set to 26°C), under which conditions the males are sterile. The male parent is cultured in an artificial climate chamber (the ambient temperature during the booting stage is set to 23°C, and the ambient humidity during the flowering stage is set to 80%), under which conditions the males are fertile, and pollen is collected.

[0170] 2. Using the F1 generation plant as the female parent and the rice Quan 211S as the male parent, backcrossing was performed and seeds were harvested, which were the BC1F1 generation seeds. Plants grown from the BC1F1 generation seeds were the BC1F1 generation plants. The female parent was cultured in an artificial climate chamber (the ambient temperature during the booting stage was set to 26°C, and the ambient humidity during the flowering stage was set to 50%), under which conditions the males were sterile. The male parent was cultured in an artificial climate chamber (the ambient temperature during the booting stage was set to 23°C), under which conditions the males were fertile, and pollen was collected.

[0171] 3. Cultivate BC1F1 plants in an artificial climate chamber (the ambient temperature during the booting stage is set to 23°C, and the ambient humidity during the flowering stage is set to 80%). Select plants with "tms5 gene and osc12 gene" from the BC1F1 plants, self-pollinate the selected plants and obtain seeds, which are BC1F2 seeds. Plants grown from BC1F2 seeds are BC1F2 plants.

[0172] A method for identifying plants having the osc12 gene: taking plant leaves, extracting genomic DNA, and performing PCR amplification using a primer pair consisting of primer osc12-F and primer osc12-R (the primer sequence is shown in step 3 of Example 1, 2); sequencing the PCR amplification products, and if the sequencing result of at least one of the PCR amplification products is the same as the sequence of the corresponding segment in the osc12 gene of rice TH03S-4, the plant is a plant having the osc12 gene.

[0173] A method for identifying plants having the tms5 gene: take plant leaves and extract genomic DNA; use the genomic DNA as a template and a primer set (the primer set consists of four primers, namely primer tms5-P1, primer tms5-P2, primer tms5-P3 and primer tms5-P4, and the primer sequences are shown in step 3 of Example 1, 2) for PCR amplification; if the amplified product of the PCR amplification contains a 184 bp DNA fragment (called a characteristic DNA fragment), the plant is a plant having the tms5 gene.

[0174] 4. Cultivate BC1F2 generation plants in an artificial climate chamber (the ambient temperature during the booting stage is set to 23°C, the ambient temperature during the flowering stage is set to 26°C, and the ambient humidity during the flowering stage is set to 80%). Select plants with "homozygous tms5 gene and homozygous osc12 gene" from the BC1F2 generation plants, self-pollinate the selected plants and obtain seeds, which are BC1F3 generation seeds. Plants grown from BC1F3 generation seeds are BC1F3 generation plants.

[0175] A method for identifying plants with a homozygous osc12 gene: take plant leaves, extract genomic DNA, and perform PCR amplification using a primer pair consisting of primer osc12-F and primer osc12-R (the primer sequence is shown in step 3 of Example 1, 2); sequence the PCR amplification product, and if the sequencing result of the PCR amplification product is one and is identical to the sequence of the corresponding segment in the osc12 gene of rice TH03S-4, the plant is a homozygous osc12 gene plant.

[0176] A method for identifying a plant having a homozygous tms5 gene: taking plant leaves and extracting genomic DNA; using the genomic DNA as a template and using a primer set (the primer set consists of four primers, namely primer tms5-P1, primer tms5-P2, primer tms5-P3 and primer tms5-P4, and the primer sequences are shown in step 3 of Example 1, 2) to perform PCR amplification; if the amplified product of the PCR amplification contains a 184 bp DNA fragment (called a characteristic DNA fragment), the plant is a plant having the tms5 gene; since rice Quan 211S is a male sterile line of two-line hybrid rice in the prior art and has a homozygous tms5 gene, and since rice TH03S-4 is a temperature- and humidity-sensitive male sterile line obtained in Example 1 and has a homozygous tms5 gene, as long as a plant is identified as a plant having the tms5 gene, the plant must be a plant having the homozygous tms5 gene.

[0177] 5. Replace the BC1F2 generation plants with the BC1F3 generation plants, and proceed as in step 4 to obtain BC1F4 generation seeds. Plants grown from BC1F4 generation seeds are BC1F4 generation plants.

[0178] 6. Replace the BC1F2 generation plants with the BC1F4 generation plants, and proceed as in step 4 to obtain BC1F5 generation seeds. Plants grown from BC1F5 generation seeds are BC1F5 generation plants.

[0179] 7. Replace the BC1F2 generation plants with the BC1F5 generation plants, and proceed as in step 4 to obtain BC1F6 generation seeds. Plants grown from BC1F6 generation seeds are BC1F6 generation plants.

[0180] 8. The BC1F6 generation plants were cultured in an artificial climate chamber and divided into three groups (10 plants in each group), namely the high temperature and high humidity group, the high temperature and low humidity group, and the low temperature and low humidity group. In the high temperature and high humidity group, the environmental temperature of the plants during the booting period was set to 30°C, and the environmental humidity during the flowering period was set to 80%. In the high temperature and low humidity group, the environmental temperature of the plants during the booting period was set to 30°C, and the environmental humidity during the flowering period was set to 50%. In the low temperature and low humidity group, the environmental temperature of the plants during the booting period was set to 23°C, and the environmental humidity during the flowering period was set to 50%.

[0181] During the culture process of step 8, pollen is continuously collected for examination under a microscope. If the pollen produced by a BC1F6 plant obtained by self-pollination of a BC1F5 plant is 100% sterile under the three treatments, the BC1F5 plant is the target plant.

[0182] The screened target plants and their self-pollinated offspring are new rice germplasm obtained by improving rice TH211S and whose genomic DNA is polymerized with homozygous tms5 gene and homozygous osc12 gene. They are named thermo-humidity sensitive sterile rice TH211S, or rice TH211S for short (the BC1F6 generation plants are used in subsequent examples).

[0183] Example 4: Using existing temperature-sensitive sterile germplasm and existing moisture-sensitive sterile germplasm to create an indica temperature-humidity-sensitive sterile line

[0184] The variety right number of rice 1892S is CNA20040612.4, the variety right authorization announcement date is November 1, 2007, and the variety right authorization announcement number is CNA001353G. Rice 1892S is an indica thermosensitive male sterile line (its male fertility loss is caused by the homozygous mutation of the TMS5 gene to the tms5 gene).

[0185] The mutant hms1 is described in the following literature: HMS1 interacts with HMS1I to regulate very-long-chain fatty acid biosynthesis and the humidity-sensitive genic malesterility in rice (Oryza sativa) New Phytologist, 2020, 225(5): 2077-2093. The mutant hms1 is an indica type humidity-sensitive sterile rice (the loss of male fertility is caused by the mutation of the HMS1 gene to the hms1 gene in a homozygous mutation manner).

[0186] In this example, the mutant hms1 was used as the hms1 gene donor, and rice 1892S was used as the improvement object. A new thermohygroscopic and moisture-sensitive sterile rice germplasm was created through hybridization, backcrossing and selfing. Figure 3 .

[0187] Rice 1892S was used to replace rice 211S, and mutant hms1 was used to replace rice TH03S-4. The method was basically the same as that in Example 3. The following are the different steps:

[0188] A method for identifying plants having the hms1 gene: take plant leaves, extract genomic DNA, and use a primer pair consisting of primer hms1-F and primer hms1-R (the target gene is the OsHMS1 gene) to perform PCR amplification; sequence the PCR amplification products, and if the sequencing result of at least one of the PCR amplification products is the same as the sequence of the corresponding segment in the hms1 gene of the mutant hms1, the plant is a plant having the hms1 gene.

[0189] A method for identifying plants with a homozygous hms1 gene: take plant leaves, extract genomic DNA, and use a primer pair consisting of primer hms1-F and primer hms1-R (the target gene is the OsHMS1 gene) for PCR amplification; sequence the PCR amplification product, and if the sequencing result of the PCR amplification product is one and is identical to the sequence of the corresponding segment in the hms1 gene of the mutant hms1, the plant is a homozygous hms1 gene plant.

[0190] hms1-F (SEQ ID NO: 13): 5'-GTTGAAGCTGGGGTACCAGTATC-3';

[0191] hms1-R (SEQ ID NO: 14): 5'-AAACGATACTGGTACCCCAGCTT-3'.

[0192] During the culture process of step 8, pollen is continuously collected for examination under a microscope. If the pollen produced by a BC1F6 plant obtained by self-pollination of a BC1F5 plant is 100% sterile under the three treatments, the BC1F5 plant is the target plant.

[0193] The screened target plants and their self-pollinated offspring are new rice germplasm obtained by improving rice 1892S and whose genomic DNA is polymerized with homozygous tms5 gene and homozygous hms1 gene. They are named thermo-humidity sensitive sterile rice TH1892S, abbreviated as rice TH1892S (the BC1F6 generation plants are used in subsequent examples).

[0194] Embodiment 5,

[0195] The inventor analyzed the meteorological data of Suixi County, Huaibei City, Anhui Province from 2019 to 2023: during the rice booting and flowering period (July 23-August 22), the average temperature was below 24°C and the average relative air humidity was ≥60% for less than 1 day per year on average (which would not cause fertility conversion). The inventor analyzed the meteorological data of Hefei City, Anhui Province for nearly 2 years: during the rice flowering period (July 23-August 22), the average temperature was below 24°C and the average relative air humidity was ≥60% for 0 days. It can be seen that the probability of low temperature and high humidity weather is extremely low, and the sterility of the temperature-humidity sensitive sterile line is stable.

[0196] 1. Sterility Characteristics Detection

[0197] The tested rice germplasms were: rice 03S, rice dwarf japonica 15S, rice TH211S, rice 1892S, rice TH03S-4, TH TH211S-1, rice TH211S and rice TH1892S.

[0198] The test rice germplasm was cultured in an artificial climate chamber and divided into three groups (10 plants in each group), namely, the high temperature and high humidity group, the high temperature and low humidity group, and the low temperature and low humidity group. In the high temperature and high humidity group, the environmental temperature of the plants during the booting period was set to 30°C, and the environmental humidity during the flowering period was set to 80%. In the high temperature and low humidity group, the environmental temperature of the plants during the booting period was set to 30°C, and the environmental humidity during the flowering period was set to 50%. In the low temperature and low humidity group, the environmental temperature of the plants during the booting period was set to 23°C, and the environmental humidity during the flowering period was set to 50%.

[0199] During the culture process, pollen was continuously taken for examination under a microscope. Most of the pollen of rice 03S grown in a low temperature and low humidity environment was fertile pollen. Most of the pollen of rice dwarf japonica 15S grown in a low temperature and low humidity environment was fertile pollen. Most of the pollen of rice Quan 211S grown in a low temperature and low humidity environment was fertile pollen. Most of the pollen of rice 1892S grown in a low temperature and low humidity environment was fertile pollen. The pollen of rice TH03S-4 grown in the above three groups of environments were all sterile pollen. The pollen of TH Quan japonica rice S-1 grown in the above three groups of environments were all sterile pollen. The pollen of rice TH211S grown in the above three groups of environments were all sterile pollen (see exemplary photos). Figure 4 , A corresponds to high temperature and high humidity, B corresponds to high temperature and low humidity, and C corresponds to low temperature and low humidity). The pollens of rice TH1892S under the above three environments are all sterile pollens.

[0200] 2. Fertilization Characteristics Detection

[0201] The tested rice germplasms were: rice TH03S-4, THquan japonica rice S-1, rice TH211S and rice TH1892S.

[0202] The tested rice germplasm was cultured in an artificial climate chamber in a low temperature and high humidity environment, that is, the environmental temperature during the booting stage of the plant was set at 23°C, and the environmental humidity during the flowering stage was set at 80%.

[0203] During the culture process, pollen was continuously collected for examination under a microscope. The pollen fertility of the four tested rice varieties was 100%.

[0204] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A method for preparing male sterile rice in two-line hybrid rice, comprising the following steps: aggregating a homozygous temperature-sensitive sterile gene and a homozygous humidity-sensitive sterile gene into the rice to be improved to obtain temperature-humidity-sensitive male sterile rice.

2. The method according to claim 1, characterized in that: The rice to be improved is male sterile rice in two-line hybrid rice, and the loss of male fertility is caused by the mutation of the temperature-sensitive fertility gene into the temperature-sensitive sterile gene in a homozygous mutation manner; The method is implemented in the following manner: using the rice to be improved as the starting material, performing gene editing with the humidity-sensitive fertility gene as the target gene, and then obtaining rice with homozygous temperature-sensitive sterility gene and homozygous humidity-sensitive sterility gene polymerized in genomic DNA through self-pollination, that is, temperature-humidity-sensitive male sterile rice.

3. The method according to claim 1, characterized in that: The rice to be improved is male sterile rice in two-line hybrid rice, and the loss of male fertility is caused by the mutation of the moisture-sensitive fertility gene into the moisture-sensitive sterile gene in a homozygous mutation manner; The method is implemented in the following manner: using the rice to be improved as the starting material, performing gene editing with the temperature-sensitive fertility gene as the target gene, and then obtaining rice with homozygous temperature-sensitive sterility gene and homozygous humidity-sensitive sterility gene polymerized in genomic DNA through self-pollination, that is, the temperature-humidity-sensitive male sterile rice.

4. The method according to claim 1, characterized in that: The rice to be improved is rice with normal fertility; The method is implemented in the following manner: using the rice to be improved as the starting material, performing gene editing with the temperature-sensitive fertility gene as the target gene and gene editing with the humidity-sensitive fertility gene as the target gene, and then obtaining rice with homozygous temperature-sensitive sterility gene and homozygous humidity-sensitive sterility gene polymerized in genomic DNA through self-pollination, that is, temperature-humidity-sensitive male sterile rice.

5. The method according to claim 1, characterized in that: The rice to be improved is male sterile rice in two-line hybrid rice, and the loss of male fertility is caused by the mutation of the temperature-sensitive fertility gene into the temperature-sensitive sterile gene in a homozygous mutation manner; The method is achieved in the following manner: using the rice to be improved and rice with a homozygous humidity-sensitive sterile gene as parents, hybridization, backcrossing and self-pollination are performed in sequence to obtain rice with homozygous temperature-sensitive sterile genes and homozygous humidity-sensitive sterile genes polymerized in genomic DNA, namely, temperature-humidity-sensitive male sterile rice.

6. The method according to claim 1, characterized in that: The rice to be improved is male sterile rice in two-line hybrid rice, and the loss of male fertility is caused by the mutation of the moisture-sensitive fertility gene into the moisture-sensitive sterile gene in a homozygous mutation manner; The method is achieved by taking the rice to be improved and the rice with homozygous thermosensitive sterile gene as parents, performing hybridization, backcrossing and self-pollination in sequence, and obtaining rice with homozygous thermosensitive sterile gene and homozygous humidity-sensitive sterile gene polymerized in genomic DNA, namely, thermo-humidity-sensitive male sterile rice.

7. The method according to any one of claims 1 to 6, characterized in that: The temperature-sensitive fertility gene is the TMS5 gene; the temperature-sensitive sterility gene is the tms5 gene.

8. The method according to any one of claims 1 to 7, characterized in that: The moisture-sensitive fertility gene is the OsOSC12 gene; the moisture-sensitive sterility gene is the osc12 gene.

9. The method according to any one of claims 1 to 7, characterized in that: The moisture-sensitive fertility gene is the HMS1 gene; the moisture-sensitive sterility gene is the hms1 gene.

Images