Recombinant polypeptide EN-TDLV and vaccine and application thereof

Abstract

The invention belongs to the field of veterinary biological products, and particularly relates to a recombinant polypeptide EN-TDLV and a vaccine and application thereof. By using the immune eimeria poisoning recombinant polypeptide vaccine EN-TDLV protein, chicken bodies can be effectively prevented from being infected with eimeria poisoning, the use amount of anti-coccidiosis drugs in chicken farms is greatly reduced, and chicken coccidiosis is effectively controlled.

Description

Technical Field

[0001] The present invention belongs to the field of veterinary biological products, and specifically relates to a recombinant polypeptide EN-TDLV and a vaccine and application thereof. Background Art

[0002] Eimeria necatrix (E.necatrix) is an obligate intracellular parasite of the apicomplexan protozoan family. It can cause coccidiosis in chickens, which is a serious threat to the production of intensive poultry farming. In the absence of preventive measures or prevention failure (such as drug ineffectiveness due to drug resistance), the incidence of chickens can reach 30%-100%, and the mortality rate can be as high as 80%. The economic losses caused by coccidiosis in chickens exceed more than 3 billion US dollars each year. At present, the prevention and control of coccidiosis in chickens is still mainly carried out by the technical methods of "adding various anticoccidial drugs to feed for drug prevention and control" and "live oocyst vaccines for vaccine prevention and control". However, the widespread and serious drug resistance of chicken coccidia and the potential risk of shedding of live oocyst vaccines have made the prevention and control of coccidiosis in chickens face severe challenges, and the development of new anticoccidial drugs and vaccines has become an urgent problem to be solved. However, people still have no systematic understanding of the detailed interaction mechanism between coccidia and host cells, which makes the development of new anticoccidial drugs and molecular vaccines face great difficulties. Summary of the invention

[0003] The first aspect of the present invention aims to provide a recombinant polypeptide.

[0004] The second aspect of the present invention aims to provide a nucleic acid molecule.

[0005] The third aspect of the present invention is to provide a recombinant vector.

[0006] The fourth aspect of the present invention aims to provide a recombinant cell.

[0007] The purpose of the fifth aspect of the present invention is to provide a method for preparing the recombinant polypeptide of the first aspect of the present invention.

[0008] The sixth aspect of the present invention aims to provide a vaccine.

[0009] The seventh aspect of the present invention aims to provide a kit.

[0010] The eighth aspect of the present invention aims to provide an application.

[0011] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0012] The first aspect of the present invention provides a recombinant polypeptide comprising a CDC50 protein and a major co-transporter that is toxic to Eimeria.

[0013] Preferably, the recombinant polypeptide from N-terminus to C-terminus may be a CDC50 protein, a major co-transporter, or a major co-transporter and a CDC50 protein.

[0014] In one embodiment of the present invention, the recombinant polypeptide is CDC50 protein, a major co-transporter, from N-terminus to C-terminus.

[0015] Preferably, the recombinant polypeptide comprises at least one of a connecting peptide and a tag.

[0016] Preferably, the amino acid sequence of the recombinant polypeptide is as shown in SEQ ID NO:3.

[0017] Preferably, the amino acid sequence of the recombinant polypeptide may also be a sequence substantially similar to the amino acid sequence selected from SEQ ID NO:3.

[0018] Preferably, "substantially similar" means that the given amino acid sequence and the reference sequence have at least 95% identity, for example, 96%, 97%, 98%, 98.5%, 99%, 99.5%. Alternatively, it means that the given amino acid sequence and the reference sequence have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 amino acid differences, and for polypeptides, such differences are preferably amino acid substitutions or deletions.

[0019] Preferably, substantially similar sequences also retain the unique activity of the polypeptide that can detect endogenous antibodies with high efficiency. Usually substitutions are considered conservative substitutions, such as substitutions between aliphatic amino acids Ala, Val, Leu and Ile, interchanges of hydroxyl residues Ser and Thr, exchanges of acidic residues Asp and Glu, substitutions between amide residues Asn and Gln, exchanges between basic residues Lys and Arg, and substitutions between aromatic residues Phe and Tyr.

[0020] The second aspect of the present invention provides a nucleic acid molecule encoding the recombinant polypeptide of the first aspect of the present invention.

[0021] Preferably, the nucleic acid may be DNA or RNA.

[0022] Preferably, the nucleic acid is codon-optimized for the host.

[0023] In some embodiments of the present invention, the nucleotide sequence of the nucleic acid is shown as SEQ ID NO: 1 or SEQ ID NO: 2.

[0024] Preferably, the nucleotide sequence of the recombinant polypeptide may also be a sequence substantially similar to a nucleotide sequence selected from SEQ ID NO: 1 or SEQ ID NO: 2.

[0025] Preferably, "substantially similar" means that the given nucleotide sequence has at least 95% identity with the reference sequence, for example, 96%, 97%, 98%, 98.5%, 99%, 99.5%. Alternatively, it means that the given nucleotide sequence has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleic acid differences with the reference sequence.

[0026] The third aspect of the present invention provides a recombinant vector comprising the nucleic acid molecule of the second aspect of the present invention.

[0027] Preferably, the "vector" refers to a nucleic acid carrier into which a polynucleotide can be inserted. When the vector can express the protein encoded by the inserted polynucleotide, the vector is called an expression vector. The vector can be introduced into a host cell by transformation, transduction or transfection, so that the genetic material elements it carries are expressed in the host cell. Vectors are well known to those skilled in the art, and include but are not limited to: plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1-derived artificial chromosomes (PAC); bacteriophages such as lambda phage or M13 phage and animal viruses. Animal viruses that can be used as vectors include but are not limited to retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, papillomas (such as SV40). In some embodiments, the vector of the present invention contains regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal ribosome entry sites (IRES) and other expression control elements (such as transcription termination signals, or polyadenylation signals and poly-U sequences, etc.).

[0028] The fourth aspect of the present invention provides a recombinant cell comprising the nucleic acid molecule of the second aspect of the present invention and / or the recombinant vector of the third aspect of the present invention.

[0029] Preferably, the "recombinant cell" refers to a cell that can be used to introduce a vector, including but not limited to prokaryotic cells such as Escherichia coli or Bacillus subtilis, fungal cells such as yeast cells or Aspergillus, insect cells such as S2 Drosophila cells or Sf9, or animal cells such as fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK 293 cells or chicken cells. Recombinant cells are preferably eukaryotic cells, more preferably avian animal cells. Recombinant cells are usually not omnipotent animal cells (preferably avian cells, such as chicken cells), for example, do not include fertilized eggs, embryos, germ stem cells, embryonic stem cells, etc.

[0030] The fifth aspect of the present invention provides a method for preparing the recombinant polypeptide of the first aspect of the present invention, comprising the following steps:

[0031] The recombinant cell described in the fourth aspect of the present invention is cultured, separated and purified to obtain.

[0032] The sixth aspect of the present invention provides a vaccine, comprising the recombinant polypeptide of the first aspect of the present invention, and / or the nucleic acid molecule of the second aspect of the present invention, and / or the recombinant vector of the third aspect of the present invention.

[0033] In some embodiments, the vaccine further comprises an adjuvant and / or a pharmaceutically acceptable carrier.

[0034] Preferably, an "adjuvant" is a substance that is able to facilitate or amplify the cascade of immunological events, ultimately leading to a better immune response, ie, an integrated body response to an antigen. An adjuvant is generally not required for an immune response to occur, but facilitates or amplifies the response.

[0035] Preferably, the adjuvant can also be at least one of aluminum salts, liposomes, incomplete Freund's adjuvant, complete Freund's adjuvant, alum adjuvant, MF59, monophosphoryl lipid A, flagellin, CpG-ODN and Poly (I: C). In some embodiments, the aluminum salt is selected from aluminum phosphate, potassium aluminum phosphate and aluminum hydroxide. Other well-known adjuvants include hydrocarbon oils, polymers, saponins and / or adjuvants composed of gel particles of sodium acrylate in water, for example, MONTANIDETM PET GEL ATM (Seppic, Paris France). A low molecular weight copolymer adjuvant can form cross-links in solution to become a high molecular weight gel, such as POLYGENTM (MVP Laboratories, Omaha). When added, the amount of adjuvant in the vaccine is generally between about 1% and 20% (v / v). In a specific embodiment, the amount of the adjuvant is between about 2% and 10% (v / v). In a more specific embodiment, the amount of the adjuvant is between about 3% and 6% (v / v).

[0036] In some embodiments, the vaccine is a water-in-oil emulsion having an aqueous phase and an oily phase.

[0037] In some embodiments, the vaccine is an oil-in-water emulsion having an aqueous phase and an oily phase.

[0038] Preferably, the vaccine is typically formulated for parenteral administration. Typical immunizations are achieved by subcutaneous (SC) or intramuscular (IM) injection, but the present invention also contemplates vaccinations by nasal route, or oral, intravenous (IV), intraperitoneal (IP) or intradermal (ID) injection. Alternatively, the vaccine may also be administered via a skin patch, in a delayed release implant, scarification or topical application. It may also be administered via the drinking water and / or food of the recipient bird.

[0039] Preferably, the above-mentioned vaccine is administered in a manner compatible with the dosage formulation, and in an amount such as a therapeutically effective amount and an immunogenic effective amount. The dosage depends on the subject being treated, the ability of the subject's immune system to synthesize antibodies, and the expected degree of protection. The exact amount of active ingredient to be administered depends on the physician's judgment, and the dosage varies from individual to individual. The appropriate regimen for initial administration and booster vaccination may also vary, but typically an injection is performed again or administered in other ways after a certain interval (several weeks or months) after the first administration.

[0040] Preferably, the pharmaceutically acceptable carrier is intended to help the stability and administration of the vaccine, while being harmless and well tolerated by the target. Such carriers may be, for example, sterile water or sterile physiological saline solutions. In more complex forms, the carrier may be, for example, a buffer solution, which may contain further additives, such as stabilizers or preservatives. Water or aqueous saline solutions and sugar (e.g., dextrose and / or glycerol) aqueous solutions may be used as carriers, particularly for injectable solutions. In addition, the carrier may be and / or include a hydrocolloid and / or a polymer solution, for example, to thicken the poultry vaccine to be sprayed on the poultry.

[0041] In some embodiments of the invention, the vaccine further comprises inactivated viruses and / or inactivated bacteria (e.g., bacterins) and / or antigens of bacterins. This can be derived from the microorganism pathogenic to poultry in any suitable manner, e.g., as a "live" attenuated, inactivated or subunit antigen.

[0042] Preferably, the additional antigens derived from microorganisms pathogenic to poultry are preferably derived from one or more microorganisms selected from the following group:

[0043] 1) Viruses: infectious bronchitis virus, NDV, egg drop syndrome virus, IBDV, chicken anemia virus, avian encephalomyelitis virus, fowl pox virus, turkey rhinotracheitis virus, pigeon pox virus, MDV, avian leukosis virus, ILTV, avian pneumovirus and reovirus;

[0044] 2) Bacteria: Escherichia coli, Salmonella, Ornitobacterium rhinotracheale, Haemophilus paragallinarum, Pasteurella multocida, Erysipelothrix rhusiopathiae, Erysipelas, Mycoplasma and Clostridium;

[0045] 3) Parasites: Eimeria;

[0046] 4) Fungi: Aspergillus.

[0047] The seventh aspect of the present invention provides a kit comprising the vaccine described in the sixth aspect of the present invention and a container for inoculating the vaccine.

[0048] Preferably, the container comprises a medical syringe or a nasal dropper.

[0049] The eighth object of the present invention is to provide the use of the recombinant polypeptide described in the first aspect, the nucleic acid molecule described in the second aspect, the recombinant vector described in the third aspect, and / or the vaccine described in the sixth aspect in the preparation of products for preventing and treating Eimeria toxicans.

[0050] Preferably, the product is administered to poultry.

[0051] Preferably, the poultry includes chickens, ducks, geese, swans, geese, pigeons and quails.

[0052] The beneficial effects of the present invention are:

[0053] By immunizing with the recombinant polypeptide vaccine EN-TDLV protein of Eimeria toxicans, the infection of Eimeria toxicans in chickens can be effectively controlled, the use of anticoccidial drugs in chicken farms can be greatly reduced, and chicken coccidiosis can be effectively controlled. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 This is a WB analysis of the expression of the eukaryotic expression plasmid of the recombinant polypeptide vaccine EN-TDLV of Eimeria virulentis in DF-1 cells in one embodiment of the present invention; M. Protein molecular mass standard; 1. Expression product of pcDNA3.1-EN-TDLV transfected into DF-1 cells; 2. Total protein control of DF-1 cells transfected with an empty vector.

[0055] Figure 2 This is an SDS-PAGE electrophoresis analysis diagram of the expression product and purification of the recombinant polypeptide vaccine EN-TDLV against Eimeria in one embodiment of the present invention; M. Protein molecular weight standard; 1. Uninduced bacterial solution; 2. 22°C induced bacterial solution; 3. Sample flow-through; 4. Washing solution; 5-7. Eluent.

[0056] Figure 3 This is a WB image of the expression product of the recombinant polypeptide vaccine EN-TDLV of Eimeria toxicans in one embodiment of the present invention; M. Protein molecular weight standard; 1-2. pET30a-EN-TDLV recombinant purified protein. DETAILED DESCRIPTION

[0057] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0058] Example 1 Preparation of EN-TDLV encoding gene

[0059] 1.1 Optimization of coding genes

[0060] Bioinformatics analysis was performed on the related genes encoded by the CDC50 protein and major co-transporter of Eimeria toxicans obtained by the applicant's team, and the CDC50 protein (184 amino acids) and the major co-transporter (213 amino acids) were screened as candidate tandem polypeptides, which were connected by a connecting peptide in the middle. The amino acid sequence is shown in SEQ ID NO: 3. Codon optimization was performed for different hosts using online codon optimization software to obtain prokaryotic expression coding gene sequences, as shown in SEQ ID NO: 1, and eukaryotic expression coding gene sequences, as shown in SEQ ID NO: 2, respectively.

[0061] 1.2 Synthesis of coding genes

[0062] The EN-TDLV prokaryotic encoding gene (SEQ ID NO: 1) and eukaryotic encoding gene (SEQ ID NO: 2) were prepared using whole gene synthesis technology, and T vector plasmids (pMD18-T-EN-TDLV1 and pMD18-T-EN-TDLV2) were prepared respectively, and the plasmid concentration was adjusted to 100 ng / μL.

[0063] Example 2 Preparation of EN-TDLV eukaryotic plasmid

[0064] 2.1 Primer design

[0065] Design primer sequences for the upstream and downstream of the target gene:

[0066] Upstream primer EN-TDLV-ZF:

[0067] GCTAGC GACTTCATGCAGCA (the underlined part is the NheI restriction site, SEQ ID NO: 4);

[0068] Downstream primer EN-TDLV-ZR:

[0069] GGATCCCGCAACTGTAGTTGTT (the underlined part is the BamHI restriction site, SEQ ID NO: 5).

[0070] 2.2 Gene amplification

[0071] (1) PCR reaction system and amplification conditions

[0072] Using pMD18-T-EN-TDLV2 plasmid as template, PrimeSTAR high-fidelity enzyme was used to amplify the target gene fragment. The specific reaction system and conditions are as follows:

[0073] Table 1 PCR reaction system of EN-TDLV (unit: μL)

[0074]

[0075] PCR reaction procedure:

[0076] Pre-denaturation at 94°C for 5 min→denaturation at 94°C for 30 sec→annealing at 55°C for 30 sec→extension at 72°C for 2 min→extension at 72°C for 10 min→4°C; 30 cycles in total.

[0077] (2) Electrophoresis

[0078] The PCR product was subjected to 1% agarose gel electrophoresis and the result was observed under a UV detector. The product size was about 1200 bp, which was consistent with the expected product size.

[0079] (3) PCR product recovery

[0080] Use DNA gel recovery kit to recover the target fragment and perform enzyme digestion reaction (Table 2):

[0081] Table 2 EN-TDLV2 enzyme digestion reaction system (unit: μL)

[0082]

[0083] After incubation at 37°C for 3 h, 1% agarose gel electrophoresis was performed and the target fragments after enzyme cleavage were recovered using a DNA gel recovery kit.

[0084] 2.3 Expression vector processing

[0085] Take 8 μL (1 μg / μL) of pcDNA3.1 plasmid, double digest with BamHI and NheI, set up the following restriction digestion reaction, and digest the plasmid:

[0086] Table 3 Plasmid restriction enzyme reaction system (unit: μL)

[0087]

[0088] After incubation at 37°C for 3 h, 1% agarose gel electrophoresis was performed. The plasmid after enzyme digestion was recovered using a DNA gel recovery kit;

[0089] 2.4 Ligation of restriction digested vector and restriction digested fragment

[0090] The digested EN-TDLV1 was connected with pcDNA3.1 according to the composition in Table 4 to construct the pcDNA3.1-EN-TDLV2 recombinant eukaryotic expression plasmid.

[0091] Table 4 Reaction system of restriction endonuclease vector and fragment ligation (unit: μL)

[0092]

[0093] 2.5 Transformation of ligation products into E.coli DH5α

[0094] (1) Add 10 μL of the ligation product to 100 μL of E. coli DH5α competent cells in an ice bath. Gently swirl to mix and incubate on ice for 30 min.

[0095] (2) Place the centrifuge tube in a water bath preheated to 42°C and let it stand for 90 seconds.

[0096] (3) Quickly transfer the tube to an ice bath and allow the cells to cool for 1 to 2 minutes.

[0097] (4) Add 800 μL of SOC medium to each tube and incubate at 37°C with slow shaking for 45 min.

[0098] (5) Spread the culture onto LB agar plates (containing 100 μg / mL Amp), place the plates at room temperature until the liquid is absorbed, invert the plates, and culture at 37°C overnight (approximately 12 to 16 h).

[0099] 2.6 Identification of transformed clones by colony PCR

[0100] Pick some colonies and inoculate them into 10 ml LB medium (containing 100 μg / ml ampicillin). After shaking and culturing overnight at 37°C, take the culture to set up the following PCR reaction to screen positive clones:

[0101] Table 5 PCR reaction system for identifying transformed clones (unit: μL)

[0102]

[0103] PCR reaction procedure: same as above.

[0104] Take 10 μL of the PCR reaction product, perform 1% agarose gel electrophoresis, select positive colonies, shake them and sequence them.

[0105] 2.7 Sequencing verification of positive clones

[0106] The positive clones obtained by colony PCR identification were sent to the sequencing company for sequencing verification. After sequencing was completed, the software compared the sequencing results. The sequencing primers are shown in the following table:

[0107] Table 6 Sequencing primers

[0108]

[0109] 2.8 Plasmid extraction

[0110] After sequencing, the correct positive clones were verified and arranged for plasmid mini-extraction. For specific steps, please refer to the instructions of the plasmid mini-extraction kit.

[0111] 2.9 EN-TDLV2 eukaryotic plasmid expression verification

[0112] 2.9.1 Cell transfection

[0113] (1) One day before transfection, DF-1 cells were digested and counted, and the cells were counted as 1.0×10 6 Cells were inoculated into 6-well plates at a concentration of 10 cells / well, so that the confluence of the cells was between 70% and 90% after 24 h, and each well was cultured with 2 ml of complete medium;

[0114] (2) On the day of transfection, cells were replaced with complete medium without dual antibodies and incubated in a 37°C, 5% CO2 incubator;

[0115] (3) Preparation before transfection: a. Dilute the plasmid DNA with 250 μL serum-free DMEM and mix gently; b. Mix the lipofectamin reagent, take an appropriate amount of lipofectamin reagent and dilute it with 250 μL serum-free DMEM, mix gently, and let it stand at room temperature for 5 minutes; c. Mix the DNA diluted in the first two steps and the lipofectamin reagent, mix gently, and let it stand at room temperature for 20 to 30 minutes;

[0116] (4) Add the mixture from step 3 to each well of cells;

[0117] (5) After 4 to 6 hours of transfection, the complete culture medium can be replaced;

[0118] (6) After the cells were incubated at 37°C in a 5% CO2 incubator for 48 to 72 h, post-transfection detection was performed.

[0119] 2.9.2 Western blot verification

[0120] 2.9.2.1 Sample preparation

[0121] (1) Remove the cell culture medium, gently rinse the cells with PBS, scrape the cells from the culture dish with a scraper, transfer them to a 1.5 ml EP tube, centrifuge at 1000 rpm for 5 min, wash three times with PBS, centrifuge at 1000 rpm for 5 min, and discard the supernatant;

[0122] (2) Add 100 μL of lysis buffer to each tube and lyse on ice for 10 min;

[0123] (3) Centrifuge at 12000 rpm and 4°C for 10 min and transfer the supernatant to a new 1.5 ml EP tube.

[0124] 2.9.2.2 Protein quantification

[0125] Take 5 (1 μL), 10 (2 μL), 15 (3 μL), 20 (4 μL), 25 (5 μL), 30 (6 μL), 35 (7 μL) μg of BSA (5ug / μL) to make a standard curve, take 2 μL of sample, measure in triplicate, and finally take the average value. Add 1 mL of Bradford to each tube for staining, vortex and oscillate for 20 seconds, and measure the absorbance after it is fully mixed. The operation interval between two samples should also be about 20 seconds. Be even when injecting liquid to avoid bubbles.

[0126] 2.9.2.3 SDS-PAGE gel electrophoresis

[0127] According to the quantitative results, take 20ug of each sample, add ddH2O to 18μL, add 6μL 4×Loading buffer, boil at 100℃ for 5min, centrifuge at 12000rpm at 4℃ for 3min, load the sample, and start electrophoresis. Constant voltage 130V / gel electrophoresis until bromophenol blue runs out of the bottom of the gel, stacking gel concentration 4%, separation gel 10%.

[0128] 2.9.2.4 Electrophoresis transfer

[0129] (1) Prepare NC membrane and wear gloves when cutting the membrane.

[0130] (2) Open the clamp and keep the black side horizontal. Place a sponge pad on top and use a glass rod to roll it back and forth several times to remove the bubbles inside. Place two layers of filter paper on the sponge pad, fix the filter paper with one hand and use the glass rod to roll out the bubbles with the other hand.

[0131] (3) Place the sample gel and membrane into the transfer plate marked with positive and negative electrodes: starting from the cathode side, in the following order: sponge gasket → 2 layers of filter paper → sample gel → NC membrane → 2 layers of filter paper (note: remove bubbles) → sponge gasket. Fasten the transfer plate and place it in the transfer electrophoresis tank containing transfer buffer.

[0132] (4) Transfer time: 1 hour and 30 minutes, constant current: 300 mA.

[0133] 2.9.2.5 Closure

[0134] 5% skim milk powder was dissolved in 1× TBST and blocked at room temperature for 1 h.

[0135] 2.9.2.6 Incubation with Antibodies

[0136] (1) Dilute the primary mouse HIS monoclonal antibody (cat. 66005-1-Ig, Proteintech) to an appropriate concentration using 1× TBST and incubate the cells with the primary antibody at 4°C overnight.

[0137] (2) After incubation with primary antibody overnight, wash the membrane three times with PBST on a shaker, 5 min each time.

[0138] (3) Dilute the secondary antibody goat anti-mouse IgG-HRP (cat. CW0102S, Kangwei Century) to an appropriate concentration with 1× TBST, incubate with the membrane at room temperature for 2 h, and then wash the membrane three times with 1× PBST on a shaker, each time for 5 min.

[0139] 2.9.2.7 Chemiluminescence, development, and fixation

[0140] (1) First use filter paper to absorb the liquid on the membrane

[0141] (2) Mix equal volumes of two luminescent reagents A and B in an EP tube, apply the luminescent reagent on a glass plate, place the film face down, flatten it with a gun, and time for 2 minutes.

[0142] (3) Evenly spot the prepared ECL chemiluminescent solution on the NC membrane and expose it with a chemiluminescent gel imaging system after 10 to 30 seconds. Figure 1 , the plasmid prepared in this example can be successfully expressed.

[0143] Example 3 Preparation of EN-TDLV protein

[0144] 3.1 Primer design

[0145] Design primer sequences for the upstream and downstream of the target gene:

[0146] Upstream primer EN-TDLV-YF:

[0147] CATATG GACTTCATGCAGCAGC (the underlined part is the NdeI restriction site, SEQ ID NO: 8);

[0148] Downstream primer EN-TDLV-YR:

[0149] CTCGAGCGCAACTGTAGTTGTT (the underlined part is the XhoI restriction site, SEQ ID NO: 9).

[0150] 3.2 Gene amplification

[0151] (1) PCR reaction system and amplification conditions: pMD18-T-EN-TDLV1 plasmid was used as template and PrimeSTAR high-fidelity enzyme was used to amplify the target gene fragment. The specific reaction system and conditions are as follows:

[0152] Table 7 PCR reaction system of EN-TDLV1 (unit: μL)

[0153]

[0154] PCR reaction procedure:

[0155] Pre-denaturation at 94°C for 5 min→denaturation at 94°C for 30 sec→annealing at 55°C for 30 sec→extension at 72°C for 2 min→extension at 72°C for 10 min→4°C; 30 cycles in total.

[0156] (2) Electrophoresis: The PCR product was subjected to 1% agarose gel electrophoresis and the results were observed under a UV detector. The product size was approximately 1250 bp, which was consistent with the expected product size.

[0157] (3) PCR product recovery: Use a DNA gel recovery kit to recover the target fragment and perform enzyme digestion reaction (Table 8):

[0158] Table 8 EN-TDLV2 enzyme digestion reaction system (unit: μL)

[0159]

[0160] After incubation at 37°C for 3 h, 1% agarose gel electrophoresis was performed and the target fragments after enzyme cleavage were recovered using a DNA gel recovery kit.

[0161] 3.3 Treatment of expression vector

[0162] Take 6 μL (1 μg / μL) of pET30a plasmid, double-digest with NdeI and XhoI, and establish the following restriction digestion reaction to digest the plasmid:

[0163] Table 9 Reaction system of plasmid restriction enzyme digestion (unit: μL)

[0164]

[0165] After incubation at 37°C for 3 h, 1% agarose gel electrophoresis was performed. The plasmid after enzyme digestion was recovered using a DNA gel recovery kit;

[0166] 3.4 Ligation of restriction digested vector and restriction digested fragment

[0167] The digested EN-TDLV2 was connected to pET30a according to the composition in Table 10 to construct the pET30a-EN-TDLV1 recombinant prokaryotic expression plasmid.

[0168] Table 10 Reaction system of restriction endonuclease vector and fragment ligation (unit: μL)

[0169]

[0170] 3.5 Transformation of ligation products into E. coli DH5α

[0171] (1) Add 10 μL of the ligation product to 100 μL of E. coli DH5α competent cells in an ice bath. Gently swirl to mix and incubate on ice for 30 min.

[0172] (2) Place the centrifuge tube in a water bath preheated to 42°C and let it stand for 90 seconds.

[0173] (3) Quickly transfer the tube to an ice bath and allow the cells to cool for 1 to 2 minutes.

[0174] (4) Add 800 μL of SOC medium to each tube and incubate at 37°C with slow shaking for 45 min.

[0175] (5) Spread the culture onto LB agar plates (containing 50 μg / mL kanamycin sulfate), place the plates at room temperature until the liquid is absorbed, invert the plates, and culture at 37°C overnight (approximately 12 to 16 hours).

[0176] 3.6 Identification of transformed clones by colony PCR

[0177] Pick some colonies and inoculate them into 10 ml LB medium (containing 50 μg / mL kanamycin sulfate). After shaking and culturing overnight at 37°C, take the culture to set up the following PCR reaction to screen positive clones:

[0178] Table 11 PCR reaction system for identifying transformed clones (unit: μL)

[0179]

[0180] PCR reaction procedure: same as above.

[0181] Take 10 μL of the PCR reaction product, perform 1% agarose gel electrophoresis, select positive colonies, shake them and sequence them.

[0182] 3.7 Plasmid extraction

[0183] After sequencing, the correct positive clones were verified and arranged for plasmid mini-extraction. For specific steps, please refer to the instructions of the plasmid mini-extraction kit.

[0184] 3.8 Inducible expression of pET30a-EN-TDLV1 in expression bacteria

[0185] 3.8.1 Expression vector transformation and induced expression

[0186] The constructed pET30a-EN-TDLV1 plasmid was transformed into BL21 (DE3) competent cells, and then evenly spread on LB plates (containing 50 μg / mL kanamycin sulfate), and then inverted in a 37°C incubator overnight.

[0187] Select a single clone from the transformed plate and inoculate it into 4 L of LB medium (containing 50 μg / mL kanamycin sulfate) and culture until OD 600 The final concentration of IPTG was 0.1 mM, and the culture medium was placed at 22°C to induce expression.

[0188] 3.8.2 SDS-PAGE analysis and identification of induced expression results

[0189] Take the induced culture medium and centrifuge it at 12000rpm for 5min, remove the supernatant, add PBS solution to resuspend the precipitate, and finally add SDS-PAGE loading buffer to heat the sample at 100℃ for 10min, then centrifuge and take the supernatant for electrophoresis. 10min before electrophoresis, run electrophoresis at 100V, wait for the bromophenol blue indicator to enter the separation gel, run electrophoresis at 200V until the bromophenol blue band migrates to 1cm from the bottom of the gel, take out the gel and stain it with Coomassie Brilliant Blue staining solution, then transfer it to decolorizing solution and decolorize until the background is clear. See the results. Figure 2 .

[0190] 3.8.3 Protein purification

[0191] The inclusion bodies were washed with 20mM PBS (pH7.2), 150mM NaCl containing 1% Triton X-100, 2mM EDTA, and 2mM DTT, and then dissolved with 20mM PB (pH7.2), 150mM NaCl, 8M Urea, and 20mM Imidazole buffer, and the Ni-IDA column was balanced. Finally, the target protein was eluted with the equilibrium buffer of different concentrations of imidazole, and each elution fraction was collected for SDS-PAGE analysis. After Ni-IDA affinity chromatography purification analysis, Lane 6-8 with higher purity was collected and added to the treated dialysis bag. At 4°C, it was dialyzed into the dialysate with different urea concentrations of 6M, 4M, and 1M for 2 hours respectively. The EN-TDLV protein was renatured in a buffer solution of 1×PBS (pH 7.4), 4mM GSH, 0.4mM GSSG, 2mM EDTA, and 0.4M L-Arginine. The renatured EN-TDLV protein was finally dialyzed in a storage solution of 1×PBS (pH 7.4), 10% Glycerol solution for about 6-8 hours. After the dialysis and renaturation, the supernatant was filtered with a 0.22μm filter and aliquoted and stored at -80°C. The results are shown in Figure 2 .

[0192] 3.9 Western blot analysis of recombinant proteins

[0193] The recombinant EN-TDLV2 protein was identified by Western blot. The primary antibody was mouse his monoclonal antibody (Sigma) and the secondary antibody was goat anti-mouse IgG-HRP (Sigma). Figure 3 .

[0194] Example 4 Immunoprotective test of EN-TDLV

[0195] 4.1 Materials

[0196] Coccidian oocysts: Sporulated oocysts of the Huizhou strain of Eimeria toxicophila, preserved by the Parasitic Biology Laboratory, Institute of Animal Health, Guangdong Academy of Agricultural Sciences, and rejuvenated in coccidian-free chicks before use.

[0197] Chicks: Lingnan yellow chicks were provided by the Institute of Animal Science of Guangdong Academy of Agricultural Sciences and were raised in a disinfected special animal room; the chicken cages and utensils used were strictly disinfected, and the chicks were free to eat and drink purified water; before the experiment, the chicks were observed for clinical symptoms and the feces were checked for coccidia oocysts for 3 consecutive days for later use.

[0198] Feed: The starter feed is customized by the Animal Science Institute of Guangdong Academy of Agricultural Sciences and does not contain any anticoccidial drugs.

[0199] 4.2 Test methods

[0200] Grouping: 150 one-day-old test chicks were weighed one by one, and the thin or overweight chicks were eliminated. Healthy chickens with individual weight differences within 10g were selected and randomly divided into 5 groups, with 30 chicks in each group.

[0201] deal with:

[0202] Emulsification of EN-TDLV1 recombinant protein: Take the EN-TDLV1 recombinant protein obtained after purification in 3.8 of Example 3 and mix it with Freund's adjuvant (FCA) in a mass ratio of 1:1; use a No. 7 needle syringe to repeatedly aspirate until it does not spread within 5 minutes when dropped on water.

[0203] One hundred and fifty one-day-old chickens were randomly divided into five groups, including two immunization groups with different immunization schedules, an empty vector control group, a non-immunized and non-infested control group, and a non-immunized and non-infested control group. The immunized groups were first vaccinated at 3 days of age, and boosted at 10 and 17 days of age. At 24 days of age, all experimental chickens except the non-immunized and non-infested control group were orally infected with 5×10 3 Fresh E.necatrix sporulated oocysts were used, and all experimental chickens were killed at 32 days of age. The immune protection effect was evaluated by indicators such as the reduction rate of intestinal lesion scores, relative oocyst production, cytokine levels, and serum IgG antibody levels. The mental state, feed intake, feces, etc. of the chickens were observed and recorded every day; dead chicks were weighed and dissected. If the death was caused by infection with Eimeria toxicus, the lesion score was +4 points; all chicks were weighed and dissected on the 8th day after infection, and the lesions in the middle of the small intestine were scored. The specific experimental groups are shown in Table 12:

[0204] Table 12 Experimental group design

[0205]

[0206] The plasmid in the above table is the pcDNA3.1-EN-TDLV-2 eukaryotic plasmid.

[0207] Evaluation criteria for anticoccidial index:

[0208] Relative weight gain rate: Weigh the chickens at the beginning and end of the experiment, and calculate the average weight gain and relative weight gain rate. Relative weight gain rate = (weight gain rate of each group / weight gain rate of the non-immune and non-infected group) × 100%.

[0209] Survival rate: record the number of dead chickens in each group, determine the cause of death by autopsy, and calculate the survival rate. Survival rate = (number of surviving chickens at the end of the experiment / number of chickens in the experimental group) × 100%.

[0210] Lesion value: Chickens were sacrificed on the 8th day after infection. According to the lesion scoring method designed by Johnson and Reid (1970), the intestinal lesions of each chicken were scored, and the lesion score was converted into a lesion value;

[0211] On the 8th day after infection, the middle part of the small intestine was dissected.

[0212] 0 No macroscopic lesions were visible;

[0213] 1 Pinpoint-sized scattered bleeding points and white dots were visible on the serosal surface of the middle part of the small intestine. A small amount of orange-red content was visible in the intestinal lumen, and the intestinal wall was slightly thickened;

[0214] 2 The intestinal wall was thickened, and there were a large number of bleeding points and white dots on the serosal surface. Mild flatulence occurred in the middle part of the small intestine, and the intestinal lumen was locally mixed with blood clots;

[0215] 3 The serosal surface was covered with red bleeding points and white dots. The intestinal lumen was distended with gas, the intestinal wall was significantly thickened, and a large amount of blood clots and necrotic exfoliated epithelial tissues were contained in the entire intestinal content. The intestinal mucosal surface was rough and there was no normal intestinal content;

[0216] 4 The middle part of the small intestine was highly swollen, the intestinal segment showed atrophy and obvious shortening, the lesion extended to the duodenum and the posterior segment of the small intestine. The small intestinal content contained soy sauce-colored or brown mucus, and the intestinal mucosa was hemorrhagic and necrotic. Chickens dead due to this coccidia were recorded as +4 points.

[0217] Lesion value (0 - 40) = average lesion score (0 - 4) of each experimental group × 10.

[0218] Oocyst value: The fecal oocyst count was performed using the McMaster counting method to obtain the number of oocysts per gram of feces (OPG) in each group, calculate the oocyst number, and convert it to the oocyst value according to Table 13.

[0219] Table 13 Conversion relationship between oocyst number and oocyst value

[0220]

[0221] Anticoccidial index (ACI): ACI = (relative weight gain rate + survival rate) × 100 - (lesion value + oocyst value) was calculated.

[0222] Immune effect judgment criteria: ACI > 180 is highly effective; 160 < ACI < 180 is moderately effective; 120 < ACI < 160 is lowly effective; ACI < 120 is ineffective against coccidia.

[0223] 4.3 Test results

[0224] Clinical symptom observation:

[0225] After the non-immune infection control group was infected with sporulated oocysts, the experimental chickens gradually showed reactions such as reduced feeding and poor spirits. On the 5th day after infection, the pcDNA3.1 group and the non-immune infection control group had a small amount of coffee-colored bloody feces excreted, and the amount of water consumed decreased. The 5th and 6th days were more serious. The autopsy showed small intestinal lesions, red bleeding spots and white spots were visible on the mucosal and serosal surfaces, the intestinal cavity was bulging and dilated, and the intestinal wall was significantly thickened. No lesions were observed in other organs; the plasmid + protein + protein immune group, the recombinant protein + plasmid + plasmid immune group and the non-immune non-infected control group had no bloody feces, and the feeding and drinking were normal.

[0226] The test results showed that the anticoccidial index of the plasmid+plasmid+protein group was 174, and the anticoccidial index of the protein+plasmid+plasmid group was 172, which had a medium anticoccidial effect. The results are shown in Table 14.

[0227] Table 14 Evaluation of immune protection effect of EN-TDLV

[0228]

Claims

1. A recombinant polypeptide, characterized in that: The recombinant polypeptide comprises the CDC50 protein and the major co-transporter protein that is poisonous to Eimeria.

2. The recombinant polypeptide according to claim 1, characterized in that: The recombinant polypeptide includes at least one of a connecting peptide and a tag; Preferably, the amino acid sequence of the recombinant polypeptide is as shown in SEQ ID NO:

3.

3. A nucleic acid molecule encoding the recombinant polypeptide according to any one of claims 1 or 2.

4. The nucleic acid molecule according to claim 3, characterized in that: The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 1 or SEQ ID NO:

2. A recombinant vector comprising the nucleic acid molecule according to any one of claims 3 or 4.

6. A recombinant cell comprising the nucleic acid molecule according to any one of claims 3 or 4, and / or the recombinant vector according to claim 5; Preferably, the recombinant cell comprises at least one of a eukaryotic cell and a prokaryotic cell.

7. The method for preparing the recombinant polypeptide according to claim 1, comprising the following steps: The recombinant cell according to claim 6 is cultured, isolated and purified to obtain.

8. A vaccine comprising the recombinant polypeptide according to any one of claims 1 or 2, the nucleic acid molecule according to any one of claims 3 or 4, and / or the recombinant vector according to claim 5; Preferably, the vaccine comprises an adjuvant and / or a pharmaceutically acceptable excipient.

9. A kit comprising the vaccine according to claim 8, and a container for inoculating the vaccine.

10. Use of the recombinant polypeptide according to any one of claims 1 or 2, the nucleic acid molecule according to any one of claims 3 or 4, the recombinant vector according to claim 5, and / or the recombinant cell according to claim 6, and / or the vaccine according to claim 8 in the preparation of a product for preventing and treating Eimeria toxicans.

Images